validation of a sensitive and speci fi c real time pcr for detection and quantitation of hepatitis b virus covalently closed circular dna in plasma of chronic hepatitis b patients

Báo cáo khoa học: "Development of real time PCR for detection and quantitation of Dengue Viruses" potx

Báo cáo khoa học: "Development of real time PCR for detection and quantitation of Dengue Viruses" potx

Ngày tải lên : 12/08/2014, 04:21
... [11,16], core [9] and < /b> Table 2: Nucleotide sequence of < /b> primers and < /b> probe used in the qRT -PCR < /b> assay Sequence Forward Primer Reverse Primer TaqMan MGB Probe 5'-GARAGACCAGAGATCCTGCTGTCT-3' 5'-ACCATTCCATTTTCTGGCGTT-3' ... malaria, Chikungunya, rickettsia and < /b> leptospira co-exist and < /b> are clinically indistinguishable In areas where other flaviviruses are circulating, IgM detection < /b> is not conclusive because of < /b> cross reactivity ... establishing a < /b> group specific RT -PCR < /b> assay This could have been because of < /b> lack of < /b> a < /b> suitable stretch of < /b> conserved nucleotides for < /b> designing the conventional TaqMan probes, earlier observed by...
  • 8
  • 352
  • 0
Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

Ngày tải lên : 07/08/2014, 23:22
... tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a < /b> ggtaaaggggcttcggtatc tattggctccctgaatacgc Cy5-tggtggtgtagccactgtcccgt-BHQ 1a < /b> GenBank Accession number (Nucleotide position) ... sefA Name Sequence (5′ to 3′) S16R-F S16R -R Scom-FAM SfC-F SfC -R ST-JOE SsA-F SsA-R SE-Cy5 aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a < /b> tgcagaaaattgatgctgct ttgcccaggttggtaatagc ... real-< /b> time < /b> PCR < /b> assays have been successfully applied in the detection < /b> of < /b> bacterial pathogens in food products [11,12,24,25] A < /b> single real-< /b> time < /b> PCR < /b> assay was applied for < /b> specific detection < /b> of < /b> major...
  • 9
  • 410
  • 0
Báo cáo y học: " Prediction of conformational changes by single mutation in the hepatitis B virus surface antigen (HBsAg) identified in HBsAg-negative blood donors" ppsx

Báo cáo y học: " Prediction of conformational changes by single mutation in the hepatitis B virus surface antigen (HBsAg) identified in HBsAg-negative blood donors" ppsx

Ngày tải lên : 12/08/2014, 02:20
... overcome the issues regarding detection < /b> failure by diagnostic assays and < /b> the global use of < /b> vaccines, particularly in endemic areas, as one possible mechanism of < /b> selecting escape mutants Acknowledgements ... mutation-induced conformational changes at the antigenic a< /b> determinant of < /b> its surface antigen [2,3,5] Selection of < /b> variants is usually indicated by certain serological markers, such as isolated anti-HBc, co-occurrence ... co-occurrence of < /b> both HBsAg and < /b> anti-HBs, and < /b> inconsistent HBsAg assay results [34] The presence of < /b> these variants poses potential threat to the success of < /b> vaccination and < /b> supply of < /b> safe blood...
  • 9
  • 328
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Ngày tải lên : 21/02/2014, 00:20
... inhibition and < /b> hemagglutinatin study The lectin is unique from that of < /b> other sialic acidspeci c < /b> lectins O-Acetyl sialic acid -speci< /b> c < /b> lectin was Ó FEBS 2003 A < /b> sialic acid speci< /b> c < /b> lectin from P jacquemontii ... in deriving the binding affinity of < /b> the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and,< /b> 8,9-di-O-acetylneuraminic ... Paulson, J .C < /b> (1985) Purification and < /b> characterization of < /b> an O-acetyl sialic acid speci< /b> c < /b> lectin from a < /b> marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13 Kawai, T Kato, A < /b> Higashi, H Kato,...
  • 8
  • 616
  • 0
Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-specific expression may account for retention of these duplicated genes in the zebrafish (Danio rerio) genome docx

Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-specific expression may account for retention of these duplicated genes in the zebrafish (Danio rerio) genome docx

Ngày tải lên : 07/03/2014, 12:20
... involved in the binding at site of < /b> the human FABP1, and < /b> possibly in zebrafish FABP 1a < /b> and < /b> zebrafish FABP 1b, may reflect differences in the binding affinities of < /b> the zebrafish FABP 1a < /b> and < /b> zebrafish FABP 1b to ... zebrafish FABP 1a < /b> and < /b> FABP 1b (A)< /b> The 827 bp fabp 1a < /b> cDNA sequence, excluding the poly (A)< /b> tail, was determined by cloning and < /b> sequencing of < /b> 3¢-RACE and < /b> 5¢-RLM-RACE products The cDNA sequence contained ... mRNAs in adult zebrafish RT -PCR < /b> generated a < /b> fabp 1a < /b> and < /b> fabp 1b mRNA -speci< /b> c < /b> product from total RNA extracted from adult zebrafish intestine (I) No fabp 1a < /b> or fabp 1b mRNAspeci c < /b> product was generated...
  • 14
  • 554
  • 0
Báo cáo Y học: A complex fruit-specific type-2 ribosome-inactivating protein from elderberry (Sambucus nigra) is correctly processed and assembled in transgenic tobacco plants doc

Báo cáo Y học: A complex fruit-specific type-2 ribosome-inactivating protein from elderberry (Sambucus nigra) is correctly processed and assembled in transgenic tobacco plants doc

Ngày tải lên : 31/03/2014, 23:20
... between Cys259 of < /b> the A-< /b> chain ˚ and < /b> Cys4 of < /b> the B- chain of < /b> ricin (4.81 A < /b> in ricin), which form the disulfide bridge connecting both chains One can reasonably assume therefore that the A-< /b> and < /b> B- chain ... B- chain, the agglutination activity and < /b> carbohydrate-binding speci< /b> city, and < /b> RNA N-glycosylase activity of < /b> SNA-If and < /b> rSNA-If were compared As shown in Table 1, rSNA-If exhibits the same speci< /b> c < /b> ... in the catalytic activity of < /b> the A-< /b> chain and < /b> the carbohydratebinding activity of < /b> the B- chain are identical in SNA-I and < /b> SNA-If This explains why no difference could be observed between the catalytic...
  • 10
  • 256
  • 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

Ngày tải lên : 19/06/2014, 08:20
... 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3'] Cycling temperatures were the same as for < /b> the HSV realtime ... 'spiked' into a < /b> PCR < /b> reaction containing approximately 100 copies of < /b> bacteriophage λ DNA and < /b> a < /b> primer pair directed against λ DNA The performance of < /b> the PCR < /b> was monitored by quantitative real-< /b> time < /b> PCR < /b> ... most common aetiological agent of < /b> GUD [5] Studies of < /b> HSV-2 seroprevalence have found high rates in African-Americans [6] and < /b> in African populations in Uganda, Zimbabwe, Tanzania, Central African...
  • 10
  • 458
  • 0
báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf

báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf

Ngày tải lên : 20/06/2014, 04:20
... 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3'] Cycling temperatures were the same as for < /b> the HSV realtime ... 'spiked' into a < /b> PCR < /b> reaction containing approximately 100 copies of < /b> bacteriophage λ DNA and < /b> a < /b> primer pair directed against λ DNA The performance of < /b> the PCR < /b> was monitored by quantitative real-< /b> time < /b> PCR < /b> ... most common aetiological agent of < /b> GUD [5] Studies of < /b> HSV-2 seroprevalence have found high rates in African-Americans [6] and < /b> in African populations in Uganda, Zimbabwe, Tanzania, Central African...
  • 10
  • 440
  • 0
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Ngày tải lên : 12/08/2014, 02:20
... SYBR Green I-based real-< /b> time < /b> PCR < /b> TaqMan-based real-< /b> time < /b> PCR < /b> may be more specific than SYBR Green I-based real-< /b> time < /b> PCR < /b> because the former requires specific probes that bind with PPV DNA template, ... means of < /b> four replicates from each of < /b> four times) were relatively small (Table 1) Detection < /b> of < /b> PPV in clinical samples by real-< /b> time < /b> PCR < /b> and < /b> conventional PCR < /b> Real-< /b> time < /b> PCR < /b> and < /b> conventional PCR < /b> were ... primers and < /b> probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The probe...
  • 4
  • 587
  • 0
báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot

báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot

Ngày tải lên : 12/08/2014, 03:21
... CAGGCAGGTTAAGGCAAAGC/ CTAGCAAGGTACAGAAACGGC AAGCTCCCACCTGTCTGGAAA/ AACAGATTGCCGGAAGCCA CTTACGACGAGTTCAGATGCC/ TAAGTCCTCAACACGCATGC TGGAAACTCAACCTCCATCCA/ TTTCGTCCATTCCTTCACCTG 135 1.83 ± 0.09 114 1.70 ... EF 1a < /b> Elongation factor 1-alpha SGN-U207468 (At5 g60390.1) CCTGGTCAAATTGGAAACGG/ CAGATCGCCTGTCAATCTTGG 103 1.62 ± 0.08 AACAACTCACTCCTACACCGG/ GGTAGCACTAGAGACACAGCCTT CAGGCAGGTTAAGGCAAAGC/ CTAGCAAGGTACAGAAACGGC ... SGN-U208507 (At3 g12110.1) 2e-110 TGCACTCCCACATGCTATCCT/ TCAGCCGAAGTGGTGAAAGAG 114 1.75 ± 0.07 CYP Cyclophilin SGN-U207595 (At2 g21130.1) 1.9e-75 AGGCTCATCATTCCACCGTGT/ TCATCTGCGAACTTAGCACCG 111 1.64...
  • 11
  • 330
  • 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

Ngày tải lên : 12/08/2014, 04:20
... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and < /b> Dabcyl at ... assay for < /b> hepatitis < /b> B virus DNA and < /b> comparison with two commercial assays J Clin Microbiol 2000, 38:2897-2901 Lole KS, Arankalle VA: Quantitation < /b> of < /b> hepatitis < /b> B virus DNA by real-< /b> time < /b> PCR < /b> using ... of < /b> chronic hepatitis < /b> B virus infection J Clin Microbiol 1992, 30:1111-1119 Abe A,< /b> Inoue K, Tanaka T, Kato J, Kajiyama N, Kawaguchi R, et al: Quantitation < /b> of < /b> hepatitis < /b> B virus genomic DNA by real-< /b> time...
  • 6
  • 536
  • 1
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

Ngày tải lên : 12/08/2014, 04:20
... (bp) Product (bp) Nf CCCGGGTTGAAAAGCCTCGTGT 22 22 8a < /b> Nr GGCTTCTCCGGGTTTTTCTTCCTA 24 371f CCCGGGTTGAAAAGCCTCGTGT 22 371r TGTAACTTATCCTCCCTGAATCTG 24 a < /b> Length of < /b> product amplified by one step real-< /b> time < /b> ... specific and < /b> rapid method for < /b> detection < /b> and < /b> quantitation < /b> of < /b> PRRSV in field samples Materials and < /b> methods Virus strain and < /b> field samples CH- 1a < /b> (GenBank access number: AY032626) virus strain, CSFV, ... transcription for < /b> 30 at 50 C,< /b> followed by a < /b> PCR < /b> activation for < /b> at 94 C,< /b> 30 cycles of < /b> amplification (50 s at 94 C,< /b> 50 s at 56 C,< /b> and < /b> at 72 C)< /b> , and < /b> a < /b> final extension step at 72 C < /b> for < /b> The resulting PCR...
  • 7
  • 350
  • 0
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

Ngày tải lên : 12/08/2014, 04:21
... TCID50/cell .A < /b> significant difference in binding to HeLa in Figure Binding studies for < /b> DAF and < /b> CAR Binding studies for < /b> DAF and < /b> CAR A)< /b> MOI 0.5 TCID50/cell ofCVB2O, EV7W and < /b> CVB5 was incubated with ... limited amount of < /b> cells was also investigated A < /b> decreasing number of < /b> cells were incubated with CVB5 at a < /b> concentration of < /b> MOI 0.05 TCID50/cell and < /b> significant differences in binding to HeLa in comparison ... clinical isolate and < /b> performed the radioactive measured binding assay SI participated in handling and < /b> analysing recombinant cell lines AML was involved in the study design, draft and < /b> revision of...
  • 6
  • 230
  • 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Ngày tải lên : 12/08/2014, 04:21
... detection < /b> of < /b> H5N1 influenza A < /b> virus of < /b> both clade and < /b> directly in clinical specimens, and < /b> evaluated it with a < /b> large number clinical samples Using this assay, reliable diagnostic results can be obtained ... study Name Sequencea Nucleotideb Sense 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a < /b> Y = T or C,< /b> R = A < /b> or ... rRT -PCR < /b> for < /b> detection < /b> of < /b> clade and < /b> H5N1 viruses in a < /b> large number of < /b> clinical specimens (n = 58) The assay described here has been established within the laboratories of < /b> the South East Asia Infectious...
  • 5
  • 460
  • 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Ngày tải lên : 05/09/2013, 10:15
... ctcctcccacaaatcaggac Saito et al., 200 3b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt ... ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., 2000 Real-< /b> time < /b> PCR < /b> The microcystin-degrading bacteria were quantified by real-< /b> time < /b> PCR < /b> using QMF and < /b> QMR oligonucleotide primers, and < /b> a < /b> QMT TaqMan ... microcystin-degrading bacteria in the biofilm, the concentration of < /b> total bacteria was quantified by real-< /b> time < /b> PCR < /b> using BACT1369F and < /b> PROK1492R primers and < /b> a < /b> TM1389BACT2 probe Microcystin-degrading bacteria...
  • 9
  • 522
  • 0
Báo cáo khoa học: A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein potx

Báo cáo khoa học: A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein potx

Ngày tải lên : 30/03/2014, 20:20
... 5¢-GTGGCCCACTATTTACCCTCCCCTC-3¢; ONNFjBmut- 2c,< /b> 5¢-GCCTTCTCCCGAACCC-3¢; ON-NFjBmut-2m, 5¢-GGGTTCGGGAGAAGGC-3¢; ON-NFjB-1m, 5¢-GGGTTCGGGAGGAGGATCCCGAAGGC-3¢; ONNFjB- 1c,< /b> 5¢-GCCTTCGGGATCCTCCTCCCGAACCC-3¢; ... ON-polj-2m, 5¢-GACAAGCCGCCCTG GAAAGCAGGCCC-3¢; ON-polj-3m, 5¢-GCAGCACAGC TGCATCCCTACCCCGCCCTCTC-3¢; ON-SP1Del, 5¢-CG CCGGGAGGGGGACGTAGTGGGGGAGAAT-3¢; ONNFjBmut, 5¢-TCTAGAGGGTTCGGGAGAAGGCTCGG CGTGTCG-3¢; ... ON-SP1del -c,< /b> 5¢-CCCCCACTACGTCCCCCTCCC-3¢; ONPromMouse-F, 5¢-GACTCTAGAGGGAGCGTCGCGAG CCGCCGGGAG-3¢; ON-PromMouse-R, 5¢-GACTCTAG ACGGGTCCACTATTTACCCTCCCTC-3¢; ON-EcoRIprom-1m, 5¢-GAGAATTCGGGTTCGGGAGGAGGAT...
  • 15
  • 134
  • 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Ngày tải lên : 18/06/2014, 18:20
... viruses, probably reflecting variability in both virus strain and < /b> cell type Notable differences included 18sRNA being a < /b> relatively reliable gene in MDDCs infected with HIVBaL, but unreliable in other ... infection and < /b> percentage of < /b> cells infected are shown in table Cells were infected with each virus strain at a < /b> MOI and < /b> duration in order to achieve the maximal percentage of < /b> infected cells as determined ... GAPDH TBP HMBS B2 M 18sRNA PP 1A < /b> TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP 1A*< /b> PGK1* GAPDH*...
  • 5
  • 481
  • 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Ngày tải lên : 19/06/2014, 08:20
... by 40 cycles of < /b> 95 C < /b> for < /b> 10 sec and < /b> 60 C < /b> for < /b> 15 sec and < /b> the amplification fluorescence was read at 60 C < /b> at the end of < /b> the cycle Real-< /b> time < /b> PCR < /b> amplification data were analyzed using the Bio-Rad ... HA units 40 50 60 70 Figure A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data employed for < /b> the determination of < /b> JC viral load A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data ... examined the fidelity of < /b> real-< /b> time < /b> quantitative PCR < /b> in detecting and < /b> quantitating JCV T-antigen gene sequences from clinical specimens Quantitative real-< /b> time < /b> PCR < /b> proved to be an appropriate technique...
  • 5
  • 358
  • 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Ngày tải lên : 20/06/2014, 01:20
... viruses, probably reflecting variability in both virus strain and < /b> cell type Notable differences included 18sRNA being a < /b> relatively reliable gene in MDDCs infected with HIVBaL, but unreliable in other ... infection and < /b> percentage of < /b> cells infected are shown in table Cells were infected with each virus strain at a < /b> MOI and < /b> duration in order to achieve the maximal percentage of < /b> infected cells as determined ... GAPDH TBP HMBS B2 M 18sRNA PP 1A < /b> TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP 1A*< /b> PGK1* GAPDH*...
  • 5
  • 574
  • 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx

báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx

Ngày tải lên : 20/06/2014, 04:20
... by 40 cycles of < /b> 95 C < /b> for < /b> 10 sec and < /b> 60 C < /b> for < /b> 15 sec and < /b> the amplification fluorescence was read at 60 C < /b> at the end of < /b> the cycle Real-< /b> time < /b> PCR < /b> amplification data were analyzed using the Bio-Rad ... HA units 40 50 60 70 Figure A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data employed for < /b> the determination of < /b> JC viral load A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data ... examined the fidelity of < /b> real-< /b> time < /b> quantitative PCR < /b> in detecting and < /b> quantitating JCV T-antigen gene sequences from clinical specimens Quantitative real-< /b> time < /b> PCR < /b> proved to be an appropriate technique...
  • 5
  • 327
  • 0

Xem thêm