validation of a sensitive and speci fi c real time pcr for detection and quantitation of hepatitis b virus covalently closed circular dna in plasma of chronic hepatitis b patients
... [11,16], core [9] and < /b> Table 2: Nucleotide sequence of < /b> primers and < /b> probe used in the qRT -PCR < /b> assay Sequence Forward Primer Reverse Primer TaqMan MGB Probe 5'-GARAGACCAGAGATCCTGCTGTCT-3' 5'-ACCATTCCATTTTCTGGCGTT-3' ... malaria, Chikungunya, rickettsia and < /b> leptospira co-exist and < /b> are clinically indistinguishable In areas where other flaviviruses are circulating, IgM detection < /b> is not conclusive because of < /b> cross reactivity ... establishing a < /b> group specific RT -PCR < /b> assay This could have been because of < /b> lack of < /b> a < /b> suitable stretch of < /b> conserved nucleotides for < /b> designing the conventional TaqMan probes, earlier observed by...
... overcome the issues regarding detection < /b> failure by diagnostic assays and < /b> the global use of < /b> vaccines, particularly in endemic areas, as one possible mechanism of < /b> selecting escape mutants Acknowledgements ... mutation-induced conformational changes at the antigenic a< /b> determinant of < /b> its surface antigen [2,3,5] Selection of < /b> variants is usually indicated by certain serological markers, such as isolated anti-HBc, co-occurrence ... co-occurrence of < /b> both HBsAg and < /b> anti-HBs, and < /b> inconsistent HBsAg assay results [34] The presence of < /b> these variants poses potential threat to the success of < /b> vaccination and < /b> supply of < /b> safe blood...
... inhibition and < /b> hemagglutinatin study The lectin is unique from that of < /b> other sialic acidspeci c < /b> lectins O-Acetyl sialic acid -speci< /b> c < /b> lectin was Ó FEBS 2003 A < /b> sialic acid speci< /b> c < /b> lectin from P jacquemontii ... in deriving the binding affinity of < /b> the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and,< /b> 8,9-di-O-acetylneuraminic ... Paulson, J .C < /b> (1985) Purification and < /b> characterization of < /b> an O-acetyl sialic acid speci< /b> c < /b> lectin from a < /b> marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13 Kawai, T Kato, A < /b> Higashi, H Kato,...
... involved in the binding at site of < /b> the human FABP1, and < /b> possibly in zebrafish FABP 1a < /b> and < /b> zebrafish FABP 1b, may reflect differences in the binding affinities of < /b> the zebrafish FABP 1a < /b> and < /b> zebrafish FABP 1b to ... zebrafish FABP 1a < /b> and < /b> FABP 1b (A)< /b> The 827 bp fabp 1a < /b> cDNA sequence, excluding the poly (A)< /b> tail, was determined by cloning and < /b> sequencing of < /b> 3¢-RACE and < /b> 5¢-RLM-RACE products The cDNA sequence contained ... mRNAs in adult zebrafish RT -PCR < /b> generated a < /b> fabp 1a < /b> and < /b> fabp 1b mRNA -speci< /b> c < /b> product from total RNA extracted from adult zebrafish intestine (I) No fabp 1a < /b> or fabp 1b mRNAspeci c < /b> product was generated...
... between Cys259 of < /b> the A-< /b> chain ˚ and < /b> Cys4 of < /b> the B- chain of < /b> ricin (4.81 A < /b> in ricin), which form the disulfide bridge connecting both chains One can reasonably assume therefore that the A-< /b> and < /b> B- chain ... B- chain, the agglutination activity and < /b> carbohydrate-binding speci< /b> city, and < /b> RNA N-glycosylase activity of < /b> SNA-If and < /b> rSNA-If were compared As shown in Table 1, rSNA-If exhibits the same speci< /b> c < /b> ... in the catalytic activity of < /b> the A-< /b> chain and < /b> the carbohydratebinding activity of < /b> the B- chain are identical in SNA-I and < /b> SNA-If This explains why no difference could be observed between the catalytic...
... 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3'] Cycling temperatures were the same as for < /b> the HSV realtime ... 'spiked' into a < /b> PCR < /b> reaction containing approximately 100 copies of < /b> bacteriophage λ DNAand < /b> a < /b> primer pair directed against λ DNA The performance of < /b> the PCR < /b> was monitored by quantitative real-< /b> time < /b> PCR < /b> ... most common aetiological agent of < /b> GUD [5] Studies of < /b> HSV-2 seroprevalence have found high rates in African-Americans [6] and < /b> in African populations in Uganda, Zimbabwe, Tanzania, Central African...
... 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- http://www.virologyj.com/content/2/1/61 CCCAGCAT-3'; HSV-M13 reverse 5'-CAGGAAACAGCTATGACCTGGGCCTTCACGAAGA-3'] Cycling temperatures were the same as for < /b> the HSV realtime ... 'spiked' into a < /b> PCR < /b> reaction containing approximately 100 copies of < /b> bacteriophage λ DNAand < /b> a < /b> primer pair directed against λ DNA The performance of < /b> the PCR < /b> was monitored by quantitative real-< /b> time < /b> PCR < /b> ... most common aetiological agent of < /b> GUD [5] Studies of < /b> HSV-2 seroprevalence have found high rates in African-Americans [6] and < /b> in African populations in Uganda, Zimbabwe, Tanzania, Central African...
... SYBR Green I-based real-< /b> time < /b> PCR < /b> TaqMan-based real-< /b> time < /b> PCR < /b> may be more specific than SYBR Green I-based real-< /b> time < /b> PCR < /b> because the former requires specific probes that bind with PPV DNA template, ... means of < /b> four replicates from each of < /b> four times) were relatively small (Table 1) Detection < /b> of < /b> PPV in clinical samples by real-< /b> time < /b> PCR < /b> and < /b> conventional PCR < /b> Real-< /b> time < /b> PCR < /b> and < /b> conventional PCR < /b> were ... primers and < /b> probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The probe...
... (bp) Product (bp) Nf CCCGGGTTGAAAAGCCTCGTGT 22 22 8a < /b> Nr GGCTTCTCCGGGTTTTTCTTCCTA 24 371f CCCGGGTTGAAAAGCCTCGTGT 22 371r TGTAACTTATCCTCCCTGAATCTG 24 a < /b> Length of < /b> product amplified by one step real-< /b> time < /b> ... specific and < /b> rapid method for < /b> detection < /b> and < /b> quantitation < /b> of < /b> PRRSV in field samples Materials and < /b> methods Virus strain and < /b> field samples CH- 1a < /b> (GenBank access number: AY032626) virus strain, CSFV, ... transcription for < /b> 30 at 50 C,< /b> followed by a < /b> PCR < /b> activation for < /b> at 94 C,< /b> 30 cycles of < /b> amplification (50 s at 94 C,< /b> 50 s at 56 C,< /b> and < /b> at 72 C)< /b> , and < /b> a < /b> final extension step at 72 C < /b> for < /b> The resulting PCR...
... TCID50/cell .A < /b> significant difference in binding to HeLa in Figure Binding studies for < /b> DAF and < /b> CAR Binding studies for < /b> DAF and < /b> CAR A)< /b> MOI 0.5 TCID50/cell ofCVB2O, EV7W and < /b> CVB5 was incubated with ... limited amount of < /b> cells was also investigated A < /b> decreasing number of < /b> cells were incubated with CVB5 at a < /b> concentration of < /b> MOI 0.05 TCID50/cell and < /b> significant differences in binding to HeLa in comparison ... clinical isolate and < /b> performed the radioactive measured binding assay SI participated in handling and < /b> analysing recombinant cell lines AML was involved in the study design, draft and < /b> revision of...
... detection < /b> of < /b> H5N1 influenza A < /b> virusof < /b> both clade and < /b> directly in clinical specimens, and < /b> evaluated it with a < /b> large number clinical samples Using this assay, reliable diagnostic results can be obtained ... study Name Sequencea Nucleotideb Sense 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a < /b> Y = T or C,< /b> R = A < /b> or ... rRT -PCR < /b> for < /b> detection < /b> of < /b> clade and < /b> H5N1 viruses ina < /b> large number of < /b> clinical specimens (n = 58) The assay described here has been established within the laboratories of < /b> the South East Asia Infectious...
... ctcctcccacaaatcaggac Saito et al., 200 3b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt ... ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., 2000 Real-< /b> time < /b> PCR < /b> The microcystin-degrading bacteria were quantified by real-< /b> time < /b> PCR < /b> using QMF and < /b> QMR oligonucleotide primers, and < /b> a < /b> QMT TaqMan ... microcystin-degrading bacteria in the biofilm, the concentration of < /b> total bacteria was quantified by real-< /b> time < /b> PCR < /b> using BACT1369F and < /b> PROK1492R primers and < /b> a < /b> TM1389BACT2 probe Microcystin-degrading bacteria...
... viruses, probably reflecting variability in both virus strain and < /b> cell type Notable differences included 18sRNA being a < /b> relatively reliable gene in MDDCs infected with HIVBaL, but unreliable in other ... infection and < /b> percentage of < /b> cells infected are shown in table Cells were infected with each virus strain at a < /b> MOI and < /b> duration in order to achieve the maximal percentage of < /b> infected cells as determined ... GAPDH TBP HMBS B2 M 18sRNA PP 1A < /b> TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP 1A*< /b> PGK1* GAPDH*...
... by 40 cycles of < /b> 95 C < /b> for < /b> 10 sec and < /b> 60 C < /b> for < /b> 15 sec and < /b> the amplification fluorescence was read at 60 C < /b> at the end of < /b> the cycle Real-< /b> time < /b> PCR < /b> amplification data were analyzed using the Bio-Rad ... HA units 40 50 60 70 Figure A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data employed for < /b> the determination of < /b> JC viral load A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data ... examined the fidelity of < /b> real-< /b> time < /b> quantitative PCR < /b> in detecting and < /b> quantitating JCV T-antigen gene sequences from clinical specimens Quantitative real-< /b> time < /b> PCR < /b> proved to be an appropriate technique...
... viruses, probably reflecting variability in both virus strain and < /b> cell type Notable differences included 18sRNA being a < /b> relatively reliable gene in MDDCs infected with HIVBaL, but unreliable in other ... infection and < /b> percentage of < /b> cells infected are shown in table Cells were infected with each virus strain at a < /b> MOI and < /b> duration in order to achieve the maximal percentage of < /b> infected cells as determined ... GAPDH TBP HMBS B2 M 18sRNA PP 1A < /b> TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP 1A*< /b> PGK1* GAPDH*...
... by 40 cycles of < /b> 95 C < /b> for < /b> 10 sec and < /b> 60 C < /b> for < /b> 15 sec and < /b> the amplification fluorescence was read at 60 C < /b> at the end of < /b> the cycle Real-< /b> time < /b> PCR < /b> amplification data were analyzed using the Bio-Rad ... HA units 40 50 60 70 Figure A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data employed for < /b> the determination of < /b> JC viral load A < /b> – C:< /b> Analysis of < /b> HA and < /b> quantitative real-< /b> time < /b> PCR < /b> data ... examined the fidelity of < /b> real-< /b> time < /b> quantitative PCR < /b> in detecting and < /b> quantitating JCV T-antigen gene sequences from clinical specimens Quantitative real-< /b> time < /b> PCR < /b> proved to be an appropriate technique...