follow this protocol if a real time pcr instrument and reagents are unavailable
Báo cáo nghiên cứu khoa học " IMPROVING CAPABILITY FOR ASSESSING SOIL CONSTRAINTS USING THE SCAMP DECISION SUPPORT SYSTEM " docx
... EC An Extremely compacted alluvial soil from Phan Rang Thap Cham, Ninh Thuan where custard apples and grapes are grown In contrast, so easy to make a soil pit on a sandy soil grown to onion and ... national agricultural initiative SCAMP assessment of local soils in association with a mobile lab to undertake analyses on farmer samples has tremendous potential for extending sustainable land management ... at both sites SCAMP treatments (balanced fertilisation using fertiliser ‘straights’ such as FMP and urea, and the application of locally available plant amendments) had higher benefit cost ratios...
- 4
- 318
- 0
The factors affecting user?s satisfaction in using the Customer Management Information System at Vietnam?s Northern Power Corporation (NPC)
... Data Analysis Descriptive Analysis Factor Analysis ANOVA Test Regression Analysis References The DeLone and McLean Moel of Information Systems Success: A Ten – Year Update, William H.Delone and ... Companies, and power sub-companies are using a Customer Management Information System (CMIS) for power production and sale management CMIS is responsible for overall management of information about ... management Customer debt collection and tracking Metering equipment management Loss management and calculation Business report making System Administration Literature Review (Cont’d) DeLone and...
- 21
- 877
- 0
Báo cáo khoa học: "Optimization of in situ hybridization assay using nonradioactive DNA probes for the detection of canine erpesvirus (CHV) in paraffin-embedded sections" pdf
... the changes of enzyme-concentrations, the time of hybridization and hybridization probes, were compared in formalin fixed and paraffin embedded CHV-infected cells The optimum result was obtained ... proteinase K induce less non-specific signals and similar signal intensity as compared with digestion with 200 µg/ml proteinase K in situ hybridization for CHV In this study, several ISH protocols, ... proteinase K concentrations, there are no differences in the detection limit of ISH However, digestion with 200 µg/ml proteinase K caused some tissue degradation and increased background staining...
- 3
- 301
- 0
Learning DebianGNU Linux-Chapter 6: Using the X Window System
... such as Kfract, a fractal generator, and Kview, an image viewer Multimedia applications such as Kmix, a sound mixer, and Kmedia, a media player Network applications such as Kmail, a mail client, ... example, a launcher applet launches an application when clicked 6.5.3.5 Date & time applet The date and time applet displays your system's current date and time If the date and time applet is not ... provides a file manager, a help system, a configuration utility and a variety of accessories and applications, including: Games such as Kmines, Kpoker, and Ktetris Graphical applications such as...
- 34
- 298
- 0
Tài liệu Lab 5.1.3 Using the Boot System Command pptx
... example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics ... _ ROM: Will this be a full IOS image? b To ensure that these commands are available for the router to use the next time it is restarted, what command would need to ... are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An...
- 5
- 395
- 0
Tài liệu Lab 5.1.3 Using the Boot System Command doc
... information about the flash memory and what IOS image file(s) are stored there b Document the following information c How much flash memory is available and used? _ d What is ... example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics ... are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An...
- 5
- 351
- 0
Tài liệu Network Application Security Using The Domain Name System pptx
... vanlia a ga namnuppslagningstj¨ nsten, Dom¨ nnamnssystemet (DNS), kan anv¨ ndas f¨ r att a a a o ˚ l¨ sa det problemet Vi visar hur DNS kan anv¨ ndas f¨ r att astadkomma s¨ ker epost o a o a ... messages for its user A User Agent may be a stand alone software application (sometimes called a Mailer), or it may be integrated into another application such as a Web Browser The message transfer ... keys are, after all, public In practice, this is a negligible advantage—current techniques to guarantee integrity and authentication also require keying material This would create a chicken and...
- 109
- 762
- 0
Báo cáo khoa học: "Question Answering System in the Web using the Web" doc
... recognition/classification in the ngrams and n-gram filtering Figure Named entity recognition/classification and filtering in the n-grams The final answers of the system are the best scored candidate answers ... different techniques used, Esfinge participated in the QA task at CLEF in 2004 and 2005 (Vallin et al, 2005) In this task the participants receive 200 questions prepared by the organization and ... the morphological analyzer jspell (Simões and Almeida, 2002) to check the PoS of the various tokens in each answer This filter rejects the answers whose first and last answer are not common or...
- 4
- 454
- 0
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
... international ship traffic as All/15 for the year 2020) Appendix A Figure A1 A2 A3 A4 A5 A6 A6 A8 A9 A1 0 A1 1 -A1 3 A1 4 A1 5 A1 6 A1 7 A1 8 A1 9 A2 0 -A2 2 A2 3 A2 4 *The North Sea (NoS) and Baltic Sea (BaS) are ... human health and related external costs in Europe and Denmark from international ship traffic in the Baltic Sea and the North Sea? Q5: What are the total health impacts and associated externalities ... constitute a large fraction of the particle mass Before the pollutants reach humans and can be respired the particles have had time to mix and react and neither primary nor secondary particles are breathed...
- 98
- 634
- 0
Báo cáo hóa học: " Neurorehabilitation using the virtual reality based Rehabilitation Gaming System: methodology, design, psychometrics, usability and validation" pot
... were able to identify a dissimilar pattern of performance and task parameters in paretic and nonparetic arms The paretic arm always required a lower level of difficulty in order to sustain performance ... performance and game parameters in stroke patients and controls The individual game parameters are weighted to produce the appropriate game parameters that are adapted online to the individual capabilities ... Performance as a function of Size and Range; d) Performance as a function of Interval and Speed; e) Performance as a function of Range and Speed; f) Performance as a function of Range and Interval...
- 14
- 498
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and ... Statistical analysis Basic and batch-wise calculations for behavioural analysis and Ct method were performed using Microsoft Excel 2010 tables All statistical analyses including regressions and...
- 58
- 262
- 0
Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro
... 10 min, and 40 cycles of 95°C for 15 s and 60°C for qPCR data was analyzed using the ABI 7500 software v2.0.6 The amount of DNA quantified for each sample is calculated as a percentage that of ... leading to greater binding affinity 10 of the latter to LTR DNA and enhanced strand transfer activity It is a nuclear phosphoprotein of approximately 300 kDa and initially isolated as an interaction ... (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’) primers to amplify the region covering the ORF of p3xFLAG-CMV14 vector (small letters),...
- 125
- 395
- 0
AN1024 PKE system design using the PIC16F639
... the three antennas are placed orthogonally on the same PCB board This increases the probability that at least one of the transponder antennas faces toward the base station antenna at a given incident ... ISO/TS-16949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona, Gresham, Oregon and Mountain View, California The Company’s quality system ... the carrier frequency of the base station The loop antenna is made of a coil (inductor) and capacitors that are forming a parallel LC resonant circuit The voltage across the antenna is also maximized...
- 26
- 408
- 0
Expert Service Oriented Architecture in C Sharp Using the Web Services Enhancements
... Hiroshi Maruyama (IBM), Anthony Nadalin (IBM, editor), Nataraj Nagaratnam (IBM), Paul Patrick (BEA), Claus von Riegen (SAP), and John Shewchuk (Microsoft) Whitepaper (December 2003) Located at MSDN ... 12) J.D Meier, Alex Mackman, Michael Dunner, Srinath Vasireddy, Ray Escamilla, and Anandha Murukan Patterns & Practices whitepaper (June 2003) Located at MSDN Home ➤ MSDN Library ➤ NET Development ... well-defined interfaces that process and deliver XML messages A servicebased approach makes sense for building solutions that cross organizational, departmental, and corporate domain boundaries A business...
- 336
- 841
- 2
The UNIX Time Sharing System
... devices this way: file and device I/O are as similar as possible; file and device names have the same syntax and meaning, so that a program expecting a file name as a parameter can be passed a device ... command to the input of another A sequence of commands separated by vertical bars causes the shell to execute all the commands simultaneously and to arrange that the standard output of each command ... variable-speed communications interfaces attached to 300- and 1200-baud data sets, and an additional 12 communication lines hard-wired to 9600-baud terminals and satellite computers There are also...
- 15
- 942
- 0
Shop Manual & ETM BCM KIA Cerato 2010 - Auto Lighting Control System
... of this supply and raises up a failure as soon as the supply’s voltage is out of range Then this failure occurs and as long as this is present, the head lamp must be turned on without taking care ... Inspection In the state of IGN1 ON, when multi function switch module detects auto light switch on, tail lamp relay output and head lamp low relay output are controlled according to auto light sensor's ... Auto light sensor Head lamps Lighting switch (Auto) 2010 > G 1.6 DOHC > Body Electrical System Circuit Diagram Tail lamps Body control module (BCM) Language 2010 > G 1.6 DOHC > Body Electrical...
- 5
- 465
- 2
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM
... hierarchy model Guidelines for formulation of a hierarchy are available in the literature and numerous proven ready-made hierarchies are also available Saaty and Forman [55] have published a book ... authority and loyalty A similar analogy can be drawn for the differences that exist at large between the scientific or academic world and the world of organizations and management as shown in Table ... Clarification on the format and factors are made to all the respondents Additional clarification and explanation were made to the respondent, if they are not clear or confused with the initial...
- 73
- 495
- 2
Thể dục Tiết 30
... đ a hình tự nhiên - Chạy liên tục cự li 400 1500m ( tuỳ theo thứ tiết ) thở chạy 3.Củng cố: - Kĩ thuật chắn bóng, đập C Phần kết thúc - Thả lỏng dũ chân tay kết hợp thở sâu - Nhận xét học - Ra ... hìng IV Rút kinh nghiệm - GV gọi 2HS HS yếu lên thực Lớp quan sát ,so sánh - Gv nhận xét, rút kinh nghiệm chung - Học sinh tự thả lỏng sau lần thực động tác - Gv nhận xét u, khuyết điểm - Dặn học ... C Phần kết thúc - Thả lỏng dũ chân tay kết hợp thở sâu - Nhận xét học - Ra tập nhà + Chống đẩy nam 30l x 2- tổ nữ 25l x - tổ - GVnêu tập, học sinh thực động tác - GV nhận xét cho điểm - GV tổ...
- 2
- 366
- 0
You can draw in 30 days (bạn có thể vẽ trong 30 ngày!)
... thoi NASA, tàu thám hiểm h a nhiều sinh viên khác tham gia vào dự án lớn Shrek, Madagascar, Flushed Away, the Incredibles, Happy Feet A bug's Life Nhưng bí mật - học học mà vẽ vẽ, không cần biết ... học, ngày, đ a điểm Sau vẽ hai điểm cách đoạn 2 Dùng bàn tay không cầm bút chì bạn, để đầu ngón tay hai điểm hình, sau dùng bút vẽ hai điểm cách đầu ngón tay bạn đoạn hình Cố gắng giữ hai điểm vẽ ... xác định khối cầu xa Nó xuất dưới, sau vật thể gần Ví dụ, đan hai tay bạn vào trước mặt bàn Quan sát kĩ bạn thấy khoảng bóng tối nhỏ hình thành đường bao ngón tay khớp ngón tay Trong nháp bạn,...
- 330
- 5,600
- 41
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25