luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model system

VIETNAM NATIONAL UNIVERSITY, HANOI INSTITUTE OF MICROBIOLOGY AND BIOTECHNOLOGY and UNIVERSITY OF LIÈGE - Đinh Duy Thành TOXICITY ASSESSMENT OF SMALL MOLECULES USING THE ZEBRAFISH AS A MODEL SYSTEM Subject: Biotechnology Code: 60.42.02.01 MASTER’S THESIS SUPERVISORS: Prof Marc Muller Dr Nguyễn Lai Thành Hà Nội - 2014 ACKNOWLEDGEMENT This thesis would not have been possible without all the support, guidance, inspiration, and patience of the following people and organisations during the course of my study It is a privilege to convey my gratefulness to them in my humble acknowledgements First and foremost, I own my deepest gratitude to Prof Marc Muller, who gave me the opportunity to pursue my own interests as a trainee in the GIGA-Research Your wisdom, guidance, support, and endurance enable me to develop and improve my expertise in both laboratory works and scientific writing Moreover, you did motivate me through my inner pressures as well as outer obstacles I offer my thankfulness to my co-supervisor, Dr Nguyễn Lai Thành, for continuously encouraging me to explore my own ideas Your knowledge, gentleness, and trust have inspired me and other students to keep following the scientific path Special thanks to Dr Nguyễn Huỳnh Minh Quyên, Prof Jacques Dommes, the Institute of Microbiology and Biotechnology (VNUIMBT), and the University of Liège (ULg) for organising this Master Program in Biotechnology It is also an honour for me to i study with devoted professors and lectures within the course They not only gave me the knowledge but also a new vision to perceive the Science of Life It is my great pleasure to thank Benoist, Yoann, and Audrey in the Toxicology team as well as the Mullerians and members of the BMGG: Thomas, Marie, David, and all others Your supports and helps during my stay in Liège crucially contributed to the completion of my research I would also like to express my thanks to my friends and colleagues: Lung, Tuấn, An, Loan, and others for their cares and encouragements in life and work My research trip was co-sponsored by the Wallonia-Brussels International (WBI) and the Wallonia-Brussels delegation to Vietnam I would like to thank you for your commitment to supporting scientific innovations as well as strengthening the collaborations between the two laboratories and between our countries Last, but by no means least, my sincerest admiration and gratitude are dedicated to my dear family, particularly my beloved wife for unconditionally trusting and pushing me to overcome all kinds of difficulty I encounter in the past, present, and future ii TABLE OF CONTENTS TABLE OF CONTENTS i LIST OF TABLES AND FIGURES v ABBREVIATIONS vii PREFACE Chapter 1: BACKGROUND INFORMATION .2 1.1 Small molecules: safety concerns 1.1.1 Pharmaceuticals and personal care products (PPCPs) 1.1.2 Food additives 1.1.3 Household chemicals 1.2 The Zebrafish embryo toxicity test (ZET) Chapter 2: METHODS 11 2.1 Substances .11 2.2 Zebrafish maintenance 12 2.3 Chemical exposure and embryo observation .12 2.4 Behavioural analysis .14 2.5 Gene expression analysis 14 2.5.1 Reverse transcription and quantitative polymerase chain reaction 14 2.5.2 Transgenic fluorescent lines 16 2.6 Statistical analysis 16 2.7 Quality control 17 Chapter 3: RESULTS AND DISCUSSION 18 iii 3.1 Morphological and lethal effects 18 3.2 Locomotor defects 29 3.3 Specific transgene expression in living embryos 33 3.4 Reverse transcriptive – qPCR .38 Chapter 4: CONCLUSIONS 41 REFERENCES 43 iv LIST OF TABLES AND FIGURES Tables Table 2-1: List of studied chemicals 11 Table 2-2: Lethality endpoints 13 Table 2-3: Quantitative PCR primer set 15 Table 3-1: Concentration ranges selected for the main study 18 Table 3-2: Lethal concentrations, effective concentrations, teratogenic indices, and typical defects of studied substances 25 Figures Figure 1.1: Orthologous genes shared among the zebrafish, human, mouse and chicken genomes (reprinted from Howe et al [33]) Figure 1.2: Literature analysis using the Scopus database in February 2014 Figure 1.3: Comparisons between the ZET test and the classical acute fish toxicity test (reprinted from Lammer et al [40]) 10 Figure 2.1: Normal morphological stages of zebrafish development at 28.5 C (photos excerpted from Kimmel et.al [39]) Scale bars = 250 M 13 Figure 3.1: Morphological phenotypes in hatched zebrafish larvae 19 Figure 3.2: Concentration-response curves and frequency of typical phenotypes caused by tested substances 22 Figure 3.3: LC50, EC50 Hill slope values of tested chemicals 27 Figure 3.4: Correlation between LC50s resulting from this study and those obtained using the procedure described in the OECD 236 guideline [59] 28 Figure 3.5: Larval motion measurements during the dark/light cycles 30 Figure 3.6: Comparative analysis of larval activity 31 Figure 3.7: Motoneuron visualisation in dpf hb9:GFP embryos and larvae 33 v Figure 3.8: Vascularisation in dpf Tg[fli1:EGFP] embryos and larvae 36 Figure 3.9: Amplification plots of two reference candidates for this study 38 Figure 3.10: Relative expression of five tested genes using ef1α as internal control (mean  SD) 39 Figure 3.11: Expression profiles of five substances on the selected genes 40 vi ABBREVIATIONS DCA 3,4-Dichloroaniline DMSO Dimethyl sulfoxide dpf Day post fertilisation EtOH Ethanol hpf Hour post fertilisation MSG Monosodium glutamate OECD Organisation for Economic Co-operation and Development PPCPs Pharmaceuticals and Personal Care Products qPCR Quantitative polymerase chain reaction QY Quinoline yellow SB Sodium Benzoate TTZ Tartrazine ZET Zebrafish embryo toxicity test vii PREFACE The human population are increasingly exposed to various chemicals whose beneficial or deleterious properties often remain unexplored The rising public concern about hazardous substances existing in foods and consumer products has forced legislators to tighten chemical management policy that requires extensive toxicity testing However, assessment of chemical toxicity is a challenging task, especially in terms of reliability and efficiency Ethical issues over the use of animal testing also add further complication to the task The zebrafish (Danio rerio) embryo is an emerging model system for chemical testing that is attracting scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent organism retaining the “non-animal” status, the zebrafish embryo is the ideal vertebrate testing model Inspired by the promising applications of the zebrafish embryo model in toxicology research, with the objectives of developing analysis techniques and applying them in testing of different small molecular compounds, we decided to carry out the project “Toxicity assessment of small molecules using the zebrafish as a model system” Chapter 1: BACKGROUND INFORMATION 1.1 Small molecules: safety concerns Chemicals have become an integral part of modern daily life They play an important role in almost all industries and economic sectors Consumer goods of our everyday-use are either containing chemicals, or involving them during production Global chemical production has increased from million tonnes in 1930 to 400 million tonnes in 2001 [25], with more than 143,000 substances in the European market* It is undeniable that these chemicals are progressively benefiting people’s life and economy However, many chemicals are also posing potential deleterious effects on human and environment health, especially those with small molecular size (50-fold) and EtOH (>10-fold) – suggesting long-lasting stress caused by all chemical treatments Interestingly, the -actin level generally considered as an invariant house-keeping gene, also increased up to more than 2fold in DCA-treated and more than 6-fold in EtOH-treated groups, raising a question on similar studies which used this gene as the reference Although less significant, the nerve cell markers foxd3 and mbpa were down regulated following EtOH treatment and up regulated in the MSG-treated group Another weak, but significant change was the down regulation of the vascularisation marker vegfr2 after EtOH-, DMSO-, SB-, and MSG-treatments, as these seem to correlate with minor haemostasis phenotypes observed in the corresponding treated groups Figure 3.11: Expression profiles of five substances on the selected genes In order to visualise patterns of chemical-induced regulation of our gene set, a radar graph representing the expression profile for the selected genes by different substances was built (Figure 3.11) This graph may also provide a valuable tool for chemical toxicity categorisation in further studies 40 Chapter 4: CONCLUSIONS Zebrafish embryos and larvae are increasingly utilised as a powerful tool to investigate the potential harmful effects of chemicals on an entire living vertebrate In this study, we employed a panel of developmental toxicity tests with emphasis on vasculogenic and neurobehavioural defects to assess seven substances representing different chemical classes of various physico-chemical properties In addition to using standard substances (i.e EtOH, DMSO, and DCA) to validate our approach, we also tested four common food additives (SB, MSG, TTZ, and QY) for their potential toxicity on the zebrafish embryo model Although more tests must be conducted on more standard substances, the correlation between LC50 values obtained using our established method and the validated OECD protocol (Figure 3.4) has initially verified our approach’s reliability Moreover, while the OECD guideline only considers lethal effects, our methodology allows detecting more specific effects as well as planning subsequent experiments Following morphological and lethal observation, behavioural tests and gene expression experiments have provided additional toxicological data as well as supportive information on observed defects Despite not being able to fully elucidate the mechanisms involved, the panel of tests has proven to be an effective screening tool for chemical toxicity assessment which may provide suggestions for subsequent studies In addition, the substance-specific pattern of effects based on our test panel may serve as a tool to categorise chemical toxicity using methods such as principal component analysis (PCA) [67] or hierarchical clustering A major finding of this study is the superior reliability of ef1α over -actin as a reference gene in toxicological applications and the need to re-validate consistency of other housekeeping genes in similar research EtOH and DMSO are among the most popular solvent carriers in toxicity testing of insoluble substances Results from our study showed that DMSO is 41 preferable in such tests due to its higher lethal and effective concentrations as well as its more consistent effects at different doses (Figure 3.2) Regarding their potential neurotoxicity and teratogenicity, care should be taken when interpreting toxicological results involving EtOH or DMSO as carrier, final concentrations for exposure should be kept below, respectively and 1.5 % for these solvents Our survival results showed that SB is a Cat aquatoxic compound (LC504d lies between 10-100 mg/L) with a neurotoxic effect, while there have been no other published data categorising SB as toxicant Regarding the extensive use of SB as preservative in food and cosmetic products, the safety of these products should be considered, especially for those being used during pregnancy and childhood Another major finding is the potential anti-angiogenic effect of TTZ, which needs to be verified by further investigation using convenient angiogenesis tests such as HUVEC culture or aortic ring assays [47] If the hypothesis is true, it may partially explain some symptoms occurring in people hypersensitive to TTZ and may as well lead to pharmaceutical applications for this common food colouring agent While being categorised as non-aquatoxic, QY was revealed as the most potent teratogenic compound (TI4d ~ 80), with an EC50 of 930 mg/L and a lowest effective concentration (LOEC) of 20 mg/L Additionally, it should be noted that “non-aquatoxic” does not legally nor scientifically guarantee safety to human health While no toxicity was previously described for QY when tested individually, QY- and MSG-containing mixtures were found to affect neural development [43] and child behaviour [51], probably through a synergistic effect Our subsequent study may involve testing whether similar mixtures could also affect zebrafish neural development and behaviour The obtained result may contribute to either raising concerns on, or confirming the safety of these controversial food additives 42 REFERENCES Aboel-Zahab H., el-Khyat Z., Sidhom G., Awadallah R., Abdel-al W., and Mahdy K (1997), “Physiological effects of some synthetic food colouring additives on rats”, Bollettino chimico farmaceutico, 136 (10), pp 615-627 Ali M.M., Bawari M., Misra U.K., and Babu G.N (2000), “Locomotor and learning deficits in adult rats exposed to monosodium-l-glutamate during early life”, Neuroscience Letters, 284 (1–2), pp 57-60 Ali S., Champagne D.L., Alia A., and Richardson M.K (2011), “Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience”, PLoS One, (5), pp e20037 Ali S., Champagne D.L., Spaink H.P., and Richardson M.K (2011), “Zebrafish embryos and larvae: a new generation of disease models and drug screens”, Birth defects research Part C, Embryo today: Reviews, 93 (2), pp 115-133 Anastasaki C., Rauen K.A., and Patton E.E (2012), “Continual low-level MEK inhibition ameliorates cardio-facio-cutaneous phenotypes in zebrafish”, Disease models & mechanisms, (4), pp 546-552 Arkhipova V., Wendik B., Devos N., Ek O., Peers B., and Meyer D (2012), “Characterization and regulation of the hb9/mnx1 beta-cell progenitor specific enhancer in zebrafish”, Developmental biology, 365 (1), pp 290302 Balbi H.J (2004), “Chloramphenicol: A review”, Pediatrics in Review, 25 (8), pp 284-288 Ballentine C (1981), “Taste of raspberries, taste of death: The 1937 elixir sulfanilamide incident”, FDA Consumer magazine, 15 (5) Bilotta J., Barnett J.A., Hancock L., and Saszik S (2004), “Ethanol exposure alters zebrafish development: A novel model of fetal alcohol syndrome”, Neurotoxicology and teratology, 26 (6), pp 737-743 10 Boris M and Mandel F.S (1994), “Foods and additives are common causes of the attention deficit hyperactive disorder in children”, Annals of allergy, 72 (5), pp 462-468 11 Boxall A.B., Rudd M.A., et al (2012), “Pharmaceuticals and personal care products in the environment: what are the big questions?”, Environmental health perspectives, 120 (9), pp 1221-1229 12 Brown W., Buist N.M., Cory Gipson H., Huston R., and Kennaway N (1982), “Fatal benzyl alcohol poisoning in a neonatal intensive care unit”, The Lancet, 319 (8283), pp 1250 43 13 Cavaletti G., Oggioni N., et al (2000), “Effect on the peripheral nervous system of systemically administered dimethylsulfoxide in the rat: a neurophysiological and pathological study”, Toxicology Letters, 118 (1–2), pp 103-107 14 Chen Q., Huang N.N., et al (2009), “Sodium benzoate exposure downregulates the expression of tyrosine hydroxylase and dopamine transporter in dopaminergic neurons in developing zebrafish”, Birth defects research Part B, Developmental and reproductive toxicology, 86 (2), pp 8591 15 Chen T.H., Wang Y.H., and Wu Y.H (2011), “Developmental exposures to ethanol or dimethylsulfoxide at low concentrations alter locomotor activity in larval zebrafish: implications for behavioral toxicity bioassays”, Aquatic toxicology, 102 (3-4), pp 162-166 16 Committee on Toxicity Testing and Assessment of Environmental Agents (2007), Toxicity testing in the 21st Century: A vision and a strategy, The National Academies Press 17 Criep L.H (1971), “Allergic vascular purpura”, Journal of Allergy and Clinical Immunology, 48 (1), pp 7-12 18 Dann A.B and Hontela A (2011), “Triclosan: environmental exposure, toxicity and mechanisms of action”, Journal of applied toxicology : JAT, 31 (4), pp 285-311 19 Daughton C.G and Ternes T.A (1999), “Pharmaceuticals and personal care products in the environment: Agents of subtle change?”, Environmental health perspectives, 107 Suppl 6, pp 907-938 20 de Jong E., Barenys M., et al (2011), “Comparison of the mouse Embryonic Stem cell Test, the rat Whole Embryo Culture and the Zebrafish Embryotoxicity Test as alternative methods for developmental toxicity testing of six 1,2,4-triazoles”, Toxicology and applied pharmacology, 253 (2), pp 103-111 21 Dipalma J.R (1990), “Tartrazine sensitivity”, American family physician, 42 (5), pp 1347-1350 22 Dodson R.E., Nishioka M., Standley L.J., Perovich L.J., Brody J.G., and Rudel R.A (2012), “Endocrine disruptors and asthma-associated chemicals in consumer products”, Environmental health perspectives, 120 (7), pp 935943 23 Ellis J.B (2006), “Pharmaceutical and personal care products (PPCPs) in urban receiving waters”, Environmental pollution, 144 (1), pp 184-189 44 24 Emran F., Rihel J., and Dowling J.E (2008), “A behavioral assay to measure responsiveness of zebrafish to changes in light intensities”, Journal of visualized experiments : JoVE, (20), pp e923 25 European Commission (2001), White Paper, Strategy for a Future Chemicals Policy, Office for Official Publications of the European Communities 26 European Council (1989), Directive 89/107/EEC of 21 December 1988 on the approximation of the laws of the Member States concerning food additives authorized for use in foodstuffs intended for human consumption 27 European Council (1992), Directive 92/32/EEC of 30 April 1992 amending for the seventh time Directive 67/548/EEC on the approximation of the laws, regulations and administrative provisions relating to the classification, packaging and labelling of dangerous substances 28 Gaj T., Gersbach C.A., and Barbas C.F., 3rd (2013), “ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering”, Trends in biotechnology, 31 (7), pp 397-405 29 Gultekin F and Doguc D.K (2013), “Allergic and immunologic reactions to food additives”, Clinical reviews in allergy & immunology, 45 (1), pp 6-29 30 Güngörmüş C and Klỗ A (2012), The safety assessment of food additives by reproductive and developmental toxicity studies”, in Food Additive, InTech, pp 31-48 31 Hill A., Mesens N., Steemans M., Xu J.J., and Aleo M.D (2012), “Comparisons between in vitro whole cell imaging and in vivo zebrafishbased approaches for identifying potential human hepatotoxicants earlier in pharmaceutical development”, Drug metabolism reviews, 44 (1), pp 127140 32 Hill A.J., Teraoka H., Heideman W., and Peterson R.E (2005), “Zebrafish as a model vertebrate for investigating chemical toxicity”, Toxicological sciences, 86 (1), pp 6-19 33 Howe K., Clark M.D., et al (2013), “The zebrafish reference genome sequence and its relationship to the human genome”, Nature, 496 (7446), pp 498-503 34 International Organization for Standardization, "ISO 15088:2007 Water quality-Determination of the Acute toxicity of Waste water to Zebrafish eggs (Danio rerio)", in ISO/TC 147 - Water quality 35 Irons T.D., MacPhail R.C., Hunter D.L., and Padilla S (2010), “Acute neuroactive drug exposures alter locomotor activity in larval zebrafish”, Neurotoxicology and Teratology, 32 (1), pp 84-90 45 36 Isogai S., Horiguchi M., and Weinstein B.M (2001), “The vascular anatomy of the developing zebrafish: an atlas of embryonic and early larval development”, Developmental biology, 230 (2), pp 278-301 37 Kanungo J., Lantz S., and Paule M.G (2011), “In vivo imaging and quantitative analysis of changes in axon length using transgenic zebrafish embryos”, Neurotoxicology and teratology, 33 (6), pp 618-623 38 Kim J.H and Scialli A.R (2011), “Thalidomide: the tragedy of birth defects and the effective treatment of disease”, Toxicological sciences, 122 (1), pp 1-6 39 Kimmel C.B., Ballard W.W., Kimmel S.R., Ullmann B., and Schilling T.F (1995), “Stages of embryonic development of the zebrafish”, Developmental Dynamics, 203 (3), pp 253-310 40 Lammer E., Carr G.J., Wendler K., Rawlings J.M., Belanger S.E., and Braunbeck T (2009), “Is the fish embryo toxicity test (FET) with the zebrafish (Danio rerio) a potential alternative for the fish acute toxicity test?”, Comparative biochemistry and physiology Toxicology & pharmacology : CBP, 149 (2), pp 196-209 41 Lammer E., Kamp H.G., et al (2009), “Development of a flow-through system for the fish embryo toxicity test (FET) with the zebrafish (Danio rerio)”, Toxicology in vitro, 23 (7), pp 1436-1442 42 Lange F.T., Scheurer M., and Brauch H.J (2012), “Artificial sweeteners a recently recognized class of emerging environmental contaminants: a review”, Analytical and bioanalytical chemistry, 403 (9), pp 2503-2518 43 Lau K., McLean W.G., Williams D.P., and Howard C.V (2006), “Synergistic interactions between commonly used food additives in a developmental neurotoxicity test”, Toxicological sciences, 90 (1), pp 178187 44 Lawson N.D and Weinstein B.M (2002), “In vivo imaging of embryonic vascular development using transgenic zebrafish”, Developmental Biology, 248 (2), pp 307-318 45 Lessman C.A (2011), “The developing zebrafish (Danio rerio): a vertebrate model for high-throughput screening of chemical libraries”, Birth defects research Part C, Embryo today: Reviews, 93 (3), pp 268-280 46 Lieschke G.J and Currie P.D (2007), “Animal models of human disease: Zebrafish swim into view”, Nature reviews Genetics, (5), pp 353-367 47 Lu X., Le Noble F., et al (2004), “The netrin receptor UNC5B mediates guidance events controlling morphogenesis of the vascular system”, Nature, 432 (7014), pp 179-186 46 48 MacPhail R.C., Brooks J., Hunter D.L., Padnos B., Irons T.D., and Padilla S (2009), “Locomotion in larval zebrafish: Influence of time of day, lighting and ethanol”, Neurotoxicology, 30 (1), pp 52-58 49 Maiolini E., Ferri E., et al (2014), “Bisphenol A determination in baby bottles by chemiluminescence enzyme-linked immunosorbent assay, lateral flow immunoassay and liquid chromatography tandem mass spectrometry”, The Analyst, 139 (1), pp 318-324 50 Marza E., Barthe C., Andre M., Villeneuve L., Helou C., and Babin P.J (2005), “Developmental expression and nutritional regulation of a zebrafish gene homologous to mammalian microsomal triglyceride transfer protein large subunit”, Developmental dynamics, 232 (2), pp 506-518 51 McCann D., Barrett A., et al (2007), “Food additives and hyperactive behaviour in 3-year-old and 8/9-year-old children in the community: A randomised, double-blinded, placebo-controlled trial”, The Lancet, 370 (9598), pp 1560-1567 52 McCurley A.T and Callard G.V (2008), “Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment”, BMC Molecular Biology, 9, pp 102 53 Miller K (1982), “Sensitivity to tartrazine”, British medical journal (Clinical research ed.), 285 (6355), pp 1597-1598 54 Murray K.E., Thomas S.M., and Bodour A.A (2010), “Prioritizing research for trace pollutants and emerging contaminants in the freshwater environment”, Environmental pollution, 158 (12), pp 3462-3471 55 Muth-Kohne E., Wichmann A., Delov V., and Fenske M (2012), “The classification of motor neuron defects in the zebrafish embryo toxicity test (ZFET) as an animal alternative approach to assess developmental neurotoxicity”, Neurotoxicology and teratology, 34 (4), pp 413-424 56 OECD (2002), Harmonised Integrated Classification System for Human Health and Environmental Hazards of Chemical Substances and Mixtures, OECD Series on Testing and Assessment No 33, OECD Publishing 57 OECD (2005), Guidance Document on the Validation and International Acceptance of New or Updated Test Methods for Hazard Assessment, OECD Series on Testing and Assessment No 34, OECD Publishing 58 OECD (2012), Validation Report (Phase 2) for the Zebrafish Embryo Toxicity Test: Part I and Part II (Annexes) OECD Series on Testing and Assessment No 179, OECD Publishing 59 OECD (2013), Test No 236: Fish Embryo Acute Toxicity (FET) Test, OECD Guidelines for the Testing of Chemicals, Section 2, OECD Publishing 47 60 Onesios K.M., Yu J.T., and Bouwer E.J (2009), “Biodegradation and removal of pharmaceuticals and personal care products in treatment systems: a review”, Biodegradation, 20 (4), pp 441-466 61 Parodi G., Parodi A., and Rebora A (1985), “Purpuric Vasculitis due to Tartrazine”, Dermatology, 171 (1), pp 62-63 62 Peterson R.T and Fishman M.C (2011), “Designing zebrafish chemical screens”, Methods in cell biology, 105, pp 525-541 63 Peterson R.T and Macrae C.A (2012), “Systematic approaches to toxicology in the zebrafish”, Annual review of pharmacology and toxicology, 52, pp 433-453 64 Pfaffl M.W (2001), “A new mathematical model for relative quantification in real-time RT–PCR”, Nucleic Acids Research, 29 (9), pp e45 65 Pichler F.B., Laurenson S., Williams L.C., Dodd A., Copp B.R., and Love D.R (2003), “Chemical discovery and global gene expression analysis in zebrafish”, Nature biotechnology, 21 (8), pp 879-883 66 Pruvot B., Jacquel A., et al (2011), “Leukemic cell xenograft in zebrafish embryo for investigating drug efficacy”, Haematologica, 96 (4), pp 612616 67 Pruvot B., Quiroz Y., et al (2012), “Zebrafish (Danio rerio) behavioral analysis: A new tool in toxicological assays”, Toxicology Letters, 211, Supplement (0), pp S153 68 Pruvot B., Quiroz Y., et al (2012), “A panel of biological tests reveals developmental effects of pharmaceutical pollutants on late stage zebrafish embryos”, Reproductive toxicology, 34 (4), pp 568-583 69 Quirce S and Barranco P (2010), “Cleaning agents and asthma”, Journal of investigational allergology & clinical immunology, 20 (7), pp 542-550 70 Quiroz Y., Lopez M., et al (2012), “The HMG-box transcription factor Sox4b is required for pituitary expression of gata2a and specification of thyrotrope and gonadotrope cells in zebrafish”, Molecular endocrinology, 26 (6), pp 1014-1027 71 Raldúa D., Barata C., et al (2012), “Zebrafish as a vertebrate model to assess sublethal effects and health risks of emerging pollutants”, in Emerging Organic Contaminants and Human Health, Springer Berlin Heidelberg, pp 395-414 72 Rihel J and Schier A.F (2012), “Behavioral screening for neuroactive drugs in zebrafish”, Developmental neurobiology, 72 (3), pp 373-385 48 73 Rinsky R.A., Smith A.B., et al (1989), “Benzene and leukemia: An epidemiologic risk assessment”, New England Journal of Medicine, 316 (17), pp 1044-1050 74 Rubinstein A.L (2006), “Zebrafish assays for drug toxicity screening”, Expert Opinion on Drug Metabolism & Toxicology, (2), pp 231-240 75 Scheil V., Kienle C., Osterauer R., Gerhardt A., and Kohler H.R (2009), “Effects of 3,4-dichloroaniline and diazinon on different biological organisation levels of zebrafish (Danio rerio) embryos and larvae”, Ecotoxicology, 18 (3), pp 355-363 76 Schena M., Shalon D., Davis R.W., and Brown P.O (1995), “Quantitative monitoring of gene expression patterns with a complementary DNA microarray”, Science, 270 (5235), pp 467-470 77 Simon R.A (2003), “Adverse reactions to food additives”, Current Allergy and Asthma Reports, (1), pp 62-66 78 Sipes N.S., Padilla S., and Knudsen T.B (2011), “Zebrafish-As an integrative model for twenty-first century toxicity testing”, Birth defects research Part C, Embryo today: Reviews, 93 (3), pp 256-267 79 Sylvain N.J., Brewster D.L., and Ali D.W (2010), “Zebrafish embryos exposed to alcohol undergo abnormal development of motor neurons and muscle fibers”, Neurotoxicology and Teratology, 32 (4), pp 472-480 80 Tan J.L and Zon L.I (2011), “Chemical screening in zebrafish for novel biological and therapeutic discovery”, Methods in cell biology, 105, pp 493516 81 Tang R., Dodd A., Lai D., McNabb W.C., and Love D.R (2007), “Validation of zebrafish (Danio rerio) reference genes for quantitative realtime RT-PCR normalization”, Acta Biochimica et Biophysica Sinica, 39 (5), pp 384-390 82 Tsay H.J., Wang Y.H., Chen W.L., Huang M.Y., and Chen Y.H (2007), “Treatment with sodium benzoate leads to malformation of zebrafish larvae”, Neurotoxicology and teratology, 29 (5), pp 562-569 83 Turusov V., Rakitsky V., and Tomatis L (2002), “Dichlorodiphenyltrichloroethane (DDT): Ubiquity, Persistence, and Risks”, Environmental Health Perspectives, 110 (2), pp 125-128 84 Voelker D., Vess C., et al (2007), “Differential gene expression as a toxicant-sensitive endpoint in zebrafish embryos and larvae”, Aquatic toxicology, 81 (4), pp 355-364 85 von Schirnding Y (2005), “The World Summit on Sustainable Development: Reaffirming the centrality of health”, Globalization and health, (1), pp 49 86 Voncken A., Piot A., et al (2010), "Zebrafish as model toxicology/pharmacology", in Biomedica 2010, Aachen, Germany 87 Wallace K.N and Pack M (2003), “Unique and conserved aspects of gut development in zebrafish”, Developmental Biology, 255 (1), pp 12-29 88 Westerhoff P., Yoon Y., Snyder S., and Wert E (2005), “Fate of endocrinedisruptor, pharmaceutical, and personal care product chemicals during simulated drinking water treatment processes”, Environmental Science & Technology, 39 (17), pp 6649-6663 89 Wittassek M., Koch H.M., Angerer J., and Bruning T (2011), “Assessing exposure to phthalates - the human biomonitoring approach”, Molecular nutrition & food research, 55 (1), pp 7-31 90 Yu L., Zhang Y., Ma R., Bao L., Fang J., and Yu T (2006), “Potent protection of ferulic acid against excitotoxic effects of maternal intragastric administration of monosodium glutamate at a late stage of pregnancy on developing mouse fetal brain”, European Neuropsychopharmacology, 16 (3), pp 170-177 91 Zhang X and Gong Z (2013), “Fluorescent transgenic zebrafish Tg(nkx2.2a:mEGFP) provides a highly sensitive monitoring tool for neurotoxins”, PLoS One, (2), pp e55474 92 Zurita J.L., Jos A., del Peso A., Salguero M., Lopez-Artiguez M., and Repetto G (2007), “Ecotoxicological effects of the antioxidant additive propyl gallate in five aquatic systems”, Water research, 41 (12), pp 25992611 50 in ... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction... contributed to the dramatic boost in the distance that larvae moved in the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their