luận văn Toxicity assessment of small molecules using the zebrafish as a model system

... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian L...

Ngày tải lên: 15/05/2015, 00:37

... ascertain the validity of the instrument in different diagnostic groups Finally, the use of DIF as a basis for analysing bias in cut points is recommended as a routine assessment where clinical cut ... passing a subtest was made through Differential Item Functioning analysis within the framework of the Rasch model [13] This analysis pooled th...

Ngày tải lên: 20/06/2014, 15:20

... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases...

Ngày tải lên: 08/03/2014, 01:20

... mM NADH, lgámL)1 of pyruvate kinase, and 2.5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured ... be con®rmed that the Na+/K+-ATPase activity, as determined by the coupled assay system, increased linearly with an increase in the incubation time and enzyme concentrati...

Ngày tải lên: 24/03/2014, 00:21

... database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared by ... spectrum/spectrum matching using very fast scans and most importantly by increasing the dynamic range of the mass spectrometer by separately accumulating highly abundant peptides and low...

Ngày tải lên: 14/08/2014, 16:21

... formal and standard English is in demands An analysis of errors in using prepositions of place AT, ON, IN is carried out to give the answer to the wondering question That whether the errors in using ... full analysis of errors in using prepositions of place at, on, in made by secondary school students The Error Analysis has proved...

Ngày tải lên: 20/12/2013, 18:17

... effect on the chaperone activity of aB-crystallin against the DTT-induced aggregation and precipitation of insulin B C Fig aB-crystallin protects against the DTT-induced aggregation of insulin, ... increased the chaperone activity of aB-crystallin (84 ± 4%) against this target protein The effect of Arg-HCl on the structure and assembly...

Ngày tải lên: 18/02/2014, 16:20

... L Shriberg, and J R Green, “Diagnostic assessment of childhood apraxia of speech using automatic speech recognition (ASR) methods,” Journal of Medical SpeechLanguage Pathology, vol 12, no 4, ... “Automatic scoring of the intelligibility in patients with cancer of the oral cavity,” in Proceedings of the 8th Annual Conference of the International Speech Communication A...

Ngày tải lên: 21/06/2014, 22:20

... above Fungi associated with Tomicus piniperda in Poland 803 Table I The results of the inoculation experiments with fungi associated with Tomicus piniperda on two-year-old plants Depth of sapwood ... associated with T piniperda was investigated by inoculating Scots pine seedlings MATERIALS AND METHODS In Mielec, 24 uninfested Scots pine trees we...

Ngày tải lên: 07/08/2014, 16:20

... IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY The DNA Base Excision Repair (BER) pathway repairs DNA damaged by endogenous and exogenous ... times and the long distances Thanks for always being there for me and for being my number #1 fan v ABSTRACT Aditi Ajit Bapat INHIBITION OF AP...

Ngày tải lên: 24/08/2014, 13:10

... in Xin Man Landcover in Xin Man Road system in Xin Man Landslide distribution in Xin Man district Landslide hazard zonation for buffer area in Xin Man Landslide hazard zonation for buffer area ... distance to road The hazard value ranges used for road buffer The hazard value ranges used for whole area % area for landslide hazard zone for...

Ngày tải lên: 03/10/2014, 13:14

Ngày tải lên: 23/10/2014, 19:15