... discussed in [384] DS determination for a number of cellulose derivatives, including tosyl cellulose and cellulose phthalate, has been carried out after calibration with standard samples of defined ... ppm, and the 3-(2-furyl)-acrylic acid esters with additional peaks at 7.82, 7 .50 , 6.87, 6 .57 and 6.23 ppm as well as alicyclic esters of cellulose, e.g the ester of the adamantane carboxylic acid, ... determination of polysaccharide esters [3 85] UV/Vis spectroscopy is usually applied after ester hydrolysis For calibration, standard mixtures of the polysaccharide and the acid are prepared and measurements...
... with a calculated molecular mass of 49 180 Da and has apparent identity with the FAD and NADH domains of BenC, which is the reductase component of benzoate dioxygenase reductase The crystal structure ... riboavin are reported as 2 .5 lm and 52 .4 s)1 with NADPH as the electron donor and 1.3 lm and 30.6 s)1 with NADH [13] For FMN, Km and kcat values of E coli Fre were calculated as 2.67 lm and 0.724 ... reductase and avin reductase activities of recombinant avoredoxin and related proteins Flavoredoxin uses both NADH and NADPH as electron donors to reduce Fe3+EDTA and FMN; however, we found that...
... the adjacent Cys4±Cys19 disul®de, a number of NOE peaks are observed, e.g betweenVal2 and Lys24, Ser 25 and Ala26, Cys4 and Lys24, Pro6 and Gly23 in SGCI, Glu3 and Gly23, Cys4 and Gly23, Thr5 and ... 1.8±3 .5 and 1.8 5. 0 A, respecÊ tively The 1.8 -A value was chosen asa good approximation of the sum of the Van der Waals radii of two adjacent but nonoverlapping hydrogen atoms Structure calculations ... Hungarian Scienti®c Research Foundation (OTKA T032486 and T030841) are acknowledged The authors also thank Antal Lopata, Chemicro Ltd and Tripos, Inc for their valuable help with obtaining and...
... pellet was discarded anda sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... potentials of the ion trap were set at 1 .5 V and the duration of the electron pulse was 100 ms Data acquisition and handling Primary data analysis was performed on a workstation running the XMASSTM ... XMASSTM software (Bruker Daltonics) In the direct infusion experiment, a spectrum of 200 scans, 51 2 K data points was collected The spectrum was calibrated using a dataset ofa sample of standard peptides...
... Japan), a CCD, anda camera This machine was operated at an accelerating voltage of 300 kV The GIF was used to determine the elemental maps and electron energy loss spectra of the samples, and the dynamic ... wire is heated Tungsten oxide has a hardness of between and GPa at around 800°C [10], but the layer is fractured and thin and it is expected that cracks formed in the oxide layer Asa result, the ... sample preparation KS performed the heater calibration and maintained the environmental TEM KK participated in the study design TY coordinated this work All authors read and approved final manuscript...
... CCTCAGTGCCTCAGTTCTGG GTGACCACGTAGGCAAACAC Mobp CACGGATGAAAACCCAGTGAG TCACGCTTGGAGTTGAGGAAG Mog GAATCTCCATCGGACTTTTGA GGTCCAAGAACAGGCACAAT Nnat AGTAGACCTCGGCGAACCCT CCCAGTAAATGCAGCATTCCA Plp1 TGCGCTGATGCCAGAATGTA ... Ensembl gene IDs were retrieved from Ensembl Additional data files The following additional data are available with the online version of this paper Additional data file provides a table listing genes ... samples Upregulation of immature neural cell markers and downregulation of mature neural cell markers in 16-day-old Nfia-/- brains suggest that removal of NFI -A causes a delay in early postnatal...
... stereochemical information is taken as rigid and only dihedral angles can be varied and restrained refinement in which the stereochemical parameters are allowed to vary harmonically around a standard value ... consider an X-ray beam that is incident on a pair of parallel planes P1 and P2 with interplanar spacing d The parallel incident rays and make an angle θ with these planes Electrons located at O and ... Separation of normal and any anomalous scattering ofa structure was first examined by Mitchell [Mitchell, 1 957 ] anda detailed theory was later presented by Karle [Karle, 1980] Friedel’s law does...
... Functionalists, on the other hand, hold the belief that “Grammar should be seen as facilitating communication in all modes, not as an isolated area of study” (G Lock, 1996) As having the experience of ... crucial matters of FG Analysis which is used for studying the speech 1 .5 Data Collection A various number of examples and illustrations have been extracted from functional grammar works by well ... systemic functional grammar analysis based on Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study In carrying out the research, the writer aims to: Illustrate the key...
... 1998 Microbial evolution, diversity, and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms Microbiol Ecol 35: 1-21 Hovanec, T A. , L T Taylar, A Blakis, and E F Delong 1998 ... bacterial populations Therefore, an analytical method at a single-cell level that allows us to more directly correlate the identity (16S rRNA-based phylogeny) and specific metabolic activity of ... ADL Akkermans, J D van Elsas, and F J de Bruijn (ed.), Molecular microbial ecology manual, vol 3.4.4 Kluwer, Dordrecht, The Netherlands Muyzer G., A Teske, C O Wirsen, and H W Jannasch 1995...
... for a day (L/ all households/day) AWUd,w: seasonal water use w in all households of size d for a day in spring and fall (L/ all households/day) Nd: number of households of size d (number) NSd: number ... macro-scale water balance modeling based on the structure of municipal water demand MATERIALSAND METHODS Macro-scale water balance estimation for Beijing City We constructed a macro-scale water balance ... the calculated average, we can assume that the data for one- and two-person households are similar The annual per capita water use in Beijing is 22 0L 53 L, 6 3L, and 51 L in spring and fall, summer,...
... stealing profits • Financial Intermediation – e.g venture capital firms • Debt Contracts have smaller moral hazard issues Tools to Solve Moral Hazard Problem: Debt Markets • Net worth and collateral ... for illegal activities, and – faster public disclosure Control Attestation in Canada II • In February 20 05, the Canadian Securities Administrators proposed the Internal Control Instrument and the ... United States • Similar to Sarbanes-Oxley Act • Bill made several reforms to security laws including: – CEO and CFO accountability for financial reporting; – auditor independence; – enhanced penalties...
... the reader has an understanding of statics, mechanics of solids, and elementary structural analysis The level of knowledge expected is equal to that of an individual with an undergraduate degree ... with a set of internal virtual displacements, d , and boundary conditions are applied after the application of the real loads and displacements, the external virtual work is equal to the internal ... acknowledged Ashraf Habibullah, Iqbal Suharwardy, Robert Morris, Syed Hasanain, Dolly Gurrola, Marilyn Wilkes and Randy Corson of Computers and Structures, Inc., deserve special recognition In addition,...
... earlier study, a yeast whole cell lysate was proteolytically digested with trypsin, and phosphopeptides were enriched from the sample using immobilized metal affinity chromatography and analyzed ... 75) Observed fragment ions of type c¢ and z¢Æ are shown with right-angle arrows above and below the sequence, respectively Singly and multiply charged ions are indicated by solid and dashed lines, ... amino acid The resulting radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of type c¢ and z¢Æ Subtraction of...
... EA values for control thylakoids and lm dPQ-treated thylakoids are shown in Fig EA was unaffected by the addition of dPQ: all data remained in the error bar range for control and dPQ-treated ... Waltham, MD, USA) was placed in the center of the Peltier plate and was covered by a thin copper plate A 10-mm-thick heat-resistant plastic plate with a cylindrical hole 25 mm in diameter was ... numerical data also demonstrated that this decrease was compensated for by an increase in the JI phase We also observed that half-times at 15 C were always higher than at 25 C for all steps in all experiments,...
... polyacrylamide gels (B) Phosphorimager scans of Fe2+-EDTA cleavage of InDGb RNA with and 25 mM Mg2+ The RNA was probed as in (A) and the samples resolved on a 12% polyacrylamide gel, which was phosphorimaged ... and separated on a series of denaturing polyacrylamide (51 2%) gels, powered at approximately 50 W (50 55 C); the gels were imaged and quantied as above The data were corrected for background hydrolysis, ... However, P5, P6 and minor parts of P 5a and P 6a are protected Also, J4 is weakly protected, but J5 is weakly cleaved Of particular signicance is the observed cleavage of J6 and the neutrality of J3...
... statistical data analysis based on a partition ofa set of objects into groups or clusters (Manning and Schütze, 1999) Multidimensional scaling is data analysis technique that provides a spatial ... Manning and Hinrich Schütze 1999 Foundations of Statistical Natural Language Processing MIT Press Cambridge, MA I Dan Melamed 2000 Models of translational equivalence among words Computational ... Southeastern Bulgaria Publishing House of Bulgarian Academy of Science, volume I, So a, Bulgaria Stojko Stojkov, Kiril Mirchev, Ivan Kochev, and Maksim Mladenov 1974 Atlas of Bulgarian Dialects:...
... chymotrypsinogen ( 25 kDa) and ribonuclease (13.7 kDa) Di-BSA (134 kDa) present in the BSA standard was also used as marker Chemical deglycosylation DM64 was chemically deglycosylated with anhydrous trifluoromethanesulfonic ... (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc All other chemicals were of analytical grade or higher quality Animals, venoms, and toxins D marsupialis ... concentration of LDH released by damaged cells was determined in 100 lL aliquots of the culture supernatants Full cytotoxic activity (100%) was defined as the amount of LDH released upon lysis of monolayer...
... chondroitinase/heparitinase and bacterial collagenase, which solubilized nearly all of the tissue The extracts were analysed by the b1IV and b2IV assay and also by an assay speci®c for the laminin c1 chain [37] This demonstrated ... was observed in basement membranes adjacent to cardiomyocytes and endothelial cells (Fig 8E,F) and also in basement membranes of the endocardium and pericardium Staining of skeletal muscle identi®ed ... demonstrated that 71±93% of the extractable laminin c1, b1 and b2 chain were already solubilized by EDTA and detergent Furthermore, the content of extractable laminin-1 was calculated based on the...
... 40 Gaussian shaped pulses of 50 ms length, each separated by a ms delay, leading to a total saturation time of 2.04 s The pulse scheme is as follows: relaxation delay, presaturation pulse train, ... calculation basically followed the same scheme presented above for the peptide As the program DYANA cannot handle glycopeptides it was substituted by the DG algorithm of the SYBYL software package ... actual epitope SM3 was developed The antibody binds more strongly to a MUC-1 that has only part of its carbohydrate chains removed [10] It was later shown on a molecular level that a small oligosaccharide...
... domain V of molecules Aand B form an extended b-sheet, and helix AV packs in an antiparallel fashion to the equivalent helix in molecule B Residues 2–38, 64–441 and 4 45 692 in molecule Aand ... A first 2.1 A resolution apo dataset was collected at the PXII beamline, Swiss Light source (Villigen, Switzerland), ˚ with a Pilatus detector Later, a 1.9 A resolution dataset was collected at ... sequence Helices are alphabetically ordered within each domain, and labeled with the domain subscript b-Strands are numbered within each domain, and labeled with the domain subscript A, mutations...