557 using a 74x541 as a microprocessor input port
Using eliciting question as a technique to teach english to 11th form pupils
... their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and practice using the language better 1.3 Summary This chapter has been concerned ... understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story ... the material which you consider important rather than trivial Students will study and learn based on the questions you ask Do not mislead them by emphasizing less important material Phrase your...
- 42
- 641
- 0
Tài liệu Using a Web Service as a Data Source pdf
... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable);...
- 4
- 369
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students...
- 39
- 1,125
- 3
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... ME7410 transducer only produced MHz ultrasound Treatment apparatus A Plexiglas cylinder was used as the ultrasound chamber (70 mm diameter, 25 mm tall) The bottom of this chamber was a single layer ... diseases [1], it is not always accepted as a family planning method for committed, monogamous couples [1,2] Ultrasound’s potential as a male contraceptive was first reported by Fahim et al [3]...
- 15
- 967
- 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... relations, 12 classes: evaluation on Levi-214 dataset Shown are micro-averaged accuracy and coverage in %s, followed by average number of features (ANF) and average sum of feature frequencies (ASF) ... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve...
- 9
- 390
- 0
Fabrication of a porous polyimide membrane using a silicon nanowire array as a template
... expected to increase the ranges of the pore diameters and densities formed Conclusions Our studies indicate that silicon nanowires can be used as sacrificial templates for the fabrication of porous ... appreciably damaging the supporting polyimide An SEM image of the exposed portion is shown in Fig 1c Having exposed the nanowires, the Au nanoparticles at the nanowire tips were removed using ... substrates Final membrane thickness can be adjusted by simply altering the amount of solution applied About 5–10 μl of polyimide solution was found to be appropriate for a silicon substrate of...
- 4
- 349
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured ... cells SA has a potent anti-inflammatory effect mediated by suppression of the production of inflammatory mediators by inhibition of cyclooxygenase and nuclear factor-kappa B activation [9,10] In addition...
- 8
- 470
- 0
Báo cáo khoa học: "Hybrid Parsing: Using Probabilistic Models as Predictors for a Symbolic Parser" docx
... the easier attachment task and therefore provided the gold standard POS tag as part of the input data, whereas in our case pure word form sequences are analysed and POS disambiguation is part ... with an educated guess about the optimal tree and use constraint failures as cues where to change labels, subordinations, or lexical readings As an example we show intermediate and final analyses ... German to 91.1%, a level which is as least as good as the results reported for alternative approaches to parsing German The result we obtained also challenges the common perception that rule-based...
- 8
- 271
- 0
UNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 2. USING A DATABASE FOR DOCUMENT RETRIEVALNOTE pot
... dynamic taxonomies Using metadata HTML and PDF formats, with open standard graphics Click on your answers Database management systems - Using a database for document retrieval - page Using a database ... implemented? Table Table Text Documents metadata Database Document Text Documents Document Meta Data Database metadata Document Document Text Documents Database Click on your answer Database management systems ... these: Metadata are in the tables of a relational database and link to document text held either on the file system or in other tables Table Table Text Documents metadata Database Metadata are represented...
- 17
- 320
- 0
UNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 3. USING A DATABASE FOR DOCUMENT MANAGEMENTNOTE pptx
... Meta Data Database File System Users Management 2) managing document content and metadata inside the same database System Document Meta Data Document Documents Database Using a database for management ... page Using a database for management There are advantages to using systems that manage both document content and metadata in the same database: Users Management System Document Document Meta ... when stored in the database, rather than the file system Database Using a database for management Databases are used in document management systems and in web content management systems The choice...
- 16
- 280
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 541
- 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 401
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... draft training program was revised and finalised accordingly GAP Workshop in Binh Thuan (21-22/7/2008) Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...
- 10
- 551
- 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained ... that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried...
- 12
- 531
- 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... holders, having about of orchards with an average tree age ranging from years (from grafted materials) to 12 years (from seeds) Cashew apples were generally not used Cashew nut yield was about 1400...
- 7
- 400
- 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... was obtained from our baseline survey in eight main cashew growing provinces (see our baseline survey report for detail), the inappropriate use of agricultural chemicals has already caused health...
- 24
- 453
- 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much ... ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but we did not bait ... orchard Fig Average abundance of weaver ants in the IPM plot at Hong Loc Centre, Dong Nai province, Vietnam % weaverv ant abundance Fig shows that weaver ant abundance was over 60%, and the ant...
- 26
- 491
- 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers never knew about their ... examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing provinces (Table ... Cashew pest control and production Mr LP Lan IAS Plant protection X X Mr NT Binh IAS Cashew breeding X X and cultivation Mr DV Tu IAS Cashew cultivation X X Mr DD Hien IAS Fertilizer application...
- 10
- 302
- 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... lphlan@yahoo.com 2 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, ... of using weaver ants to manage the main pest assemblage and the importance of keeping weaver ant populations high and stable • Part describes the basic bio-ecology of weaver ants and provides a ... has showed that using weaver ants as a major component to manage cashew insect pests is effective and profitable Most FFS farmers commented that this IPM program would achieve sustainable cashew...
- 37
- 394
- 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... enemies and cashew orchard management skills are ready for the preparation of cashew IPM posters In our field surveys, we found that cashew trees with abundant crematogaster ants were much less damaged ... Data analyses and writing up Cashew trees have been either in dormancy or in monsoon leaf flush since the project started Baseline data of the insect pest assemblage and their damage were obtained ... weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect of these two species of ants on cashew flushing shoots damaged by the three major pests is shown in Table...
- 10
- 327
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008