a simple fast and accurate method of phylogenomic inference

Ngày tải lên: 14/08/2014, 21:20

... Brill and Moore (2000) proposed employing a generative model for candidate generation and a hierarchy of trie struc- tures for fast candidate retrieval. Our approach is a discriminative approach and ... develop a data structure and algorithm that can facilitate efficient retrieval of the top k candidates. In this paper, we propose a probabilistic approach to the task. Our approach is novel and unique ... challenging when the size of vocabulary is large, because there are a large number of potential candidates to be verified. In this paper, we propose a probabilistic approach to candidate generation,...

Ngày tải lên: 30/03/2014, 21:20

Ngày tải lên: 22/06/2014, 22:20

... Ogren, Wayne Ward, James H. Martin, Guergana Savova, and Martha Palmer. 2010. An architecture for complex clinical question answering. In Proceedings of the 1st ACM International Health Informatics ... of the Associa- tion for Computational Linguistics: Human Language Technologies, ACL’11, pages 48–52. Drahom ´ ıra ”johanka” Spoustov ´ a, Jan Haji ˇ c, Jan Raab, and Miroslav Spousta. 2009. Semi-supervised ... in at least 3 documents of the training data are used. For a domain-specific model, we use a threshold of 1. The generalized and domain-specific models are trained separately; their learning parameters...

Ngày tải lên: 19/02/2014, 19:20

... a- amylases. Materials and methods Materials Barley a- amylases, AMY1 and AMY2, were purified from green and kilned malt, respectively, according to Svensson et al. [33] and Ajandouz et al.[9].PurifiedAMY 1and AMY2 ... AMY1 and AMY2 were thousand-fold more active toward amylose than toward maltodextrin and a million-fold more active than toward maltoheptaose. AMY2 was slightly more active than AMY1. AMY1 and AMY2 ... hydrolase of family 13 acting on a- 1,4 internal glycoside linkages in starch and related sugars [1]. a- Amylases occur widely in higher plants, animals, bacteria and fungi and are applied in several important...

Ngày tải lên: 08/03/2014, 08:20

... acid (MMA) and dimethyl arsinic acid (DMA). MMA and DMA are primarily used as agricultural pesticides. Data about the toxicity of organic forms of arsenic are limited; however, based on available ... quality of data with respect to sample quantitation limits 4 Evaluate the quality of data with respect to qualifiers and codes 5 Evaluate the quality of data with respect to blanks 6 Evaluate ... use of commercially available fertilizers and the disposal of sewage sludges as soil amendments (Baker et al. 1979; Garcia et al. 1979; Kosla 1986; Peles et al. 1998; Gallardo-Lara et al. 1999)....

Ngày tải lên: 15/03/2014, 23:10

... Computational Linguistics FastSum: Fast and accurate query-based multi-document summarization Frank Schilder and Ravikumar Kondadadi Research & Development Thomson Corp. 610 Opperman Drive, Eagan, ... 2004. Rouge: a package for automatic evaluation of summaries. In Proceedings of the Workshop on Text Summarization Branches Out (WAS 2004). A. Nenkova and L. Vanderwende. 2005. The impact of frequency ... 2007), pages 757–766, Banff, Canada. B. Efron, T. Hastie, I.M. Johnstone, and R. Tibshirani. 2004. Least angle regression. Annals of Statistics, 32(2):407–499. S. Gupta, A. Nenkova, and D. Jurafsky....

Ngày tải lên: 17/03/2014, 02:20

... (POS) tagging has been one of the fundamental areas of research in natural language processing for many years. Most of the prior re- search has focussed on the task of labeling text with tags that ... Nat- ural Language Processing (Japan), 5:1. Ezra Black, Andrew Finch, and Hideki Kashioka. 1998. Trigger-pair predictors in parsing and tag- ging. In Proceedings, 36th Annual Meeting of the Association ... resampling. References E. Black and A. Finch. 2001. Developing and prov- ing effective broad-coverage semantic -and- syntactic tagsets for natural language: The atr approach. In Proceedings of ICCPOL-2001. E. Black,...

Ngày tải lên: 17/03/2014, 04:20

... the forward primer 5Â-GG AATTC CATATGCAACCCACTCATACGCTAACAAG-3Â (with the NdeI restriction recognition sequence underlined) and the reverse primer 5Â-CG GGATCCTTATTTTAATT TTACCTGATTGAAGGTTGAG-3Â ... recognition sequences for cloning into pG58 was: 5 Â-GCTACG TTTAAAGCGATGATGAGACCAGAACCCCCACATCA CG-3Â (forward primer with DraI site underlined) and 5Â-CG GAATTCTTAGTGACCGAGGCGGCCCCTGCC-3Â (reverse primer ... between Cys148 and Asp155 are somewhat disor- dered, particularly in the C and D chains, and conse- quently have increased B-values. Other methods CM was assayed by the method of Davidson & Hudson [34],...

Ngày tải lên: 17/03/2014, 17:20

... the case-fatality rate. For high-risk transplant candidates, isoniazid appears safe and is probably effective at reducing MTB reactivation. All liver transplant candidates should receive a tuberculin ... Sugawara Y, Nakajima J, Kishi Y, Niiya T, Kaneko J, Makuuchi M. Resection of a pulmonary lesion after liver transplantation: report of a case. Surg Today 2005;35:976-978. 37. Alothman A, Al Abdulkareem ... B, Zhang DY. Intracranial tuberculoma in a liver transplant patient: first reported case and review of the literature. Am J Transplant 2003;3:88-93. 43. Al-Moamary MS, Al-Baz S, Alothman A, Memish...

Ngày tải lên: 29/03/2014, 03:20

... mean only what may be termed passive adap- tation, i.e., adaptation within the fundamental data of the system. Ad- aptation may, however, consist in altering some of those data, and such creative ... Mar- shallian tradition and to make use of time in order to define another type of imperfection of equlibrium. What was meant above was the case of a system so circumstanced as never to reach ... ne- glected—fact about the capitalist machine. Third, we will assume that innovations are always associated with the rise to leadership of New Men, Again, there is no lack of realism about this assumption,...

Ngày tải lên: 29/03/2014, 19:20

... bacterial R NA polymerase.I.Taxonomy,isolation and characterization. J. Antibi ot. 57, 2 10–217. 20. Plevani, P., Albertini, A .M., Galizzi, A. , Adamoli, A. , M astromei, G., Riva, S. & Cassani, G. ... of ve subunits (a 2 bbÂx,witha combined molecular m ass of % 400 kDa) and is capable of elongation and termination. The initiation-competent Ôholo Õ RNAP is compo sed of the core enzyme and of ... central role i n DNA transcription, RNAP is an essential enzyme in bacterial cells and t he target of different natural antibiotics. Rifampicin, a potent and broad-spectrum anti-infective agent...

Ngày tải lên: 30/03/2014, 15:20

... cross-sec- tional and nonquantitative resistance and risk stud- ies,[9,12,18] and makes it clear that patients' sexual behavior is not static and changes over time. Some patients moved in and out of ... sexual behav- ior and events all vaginal, anal, and oral insertive sexual events, protected (condom used) and unprotected; and (3) unprotected sexual behavior and events: unprotected vaginal, anal, ... both behavioral and virologic data were available. Seventy- eight patients contributed 4 matched behavioral and resistance and viral load results obtained within the same time period, 99 patients had...

Ngày tải lên: 20/06/2014, 08:20

... each point a Î D and r <δ(D)/2 the equality  B (a, r) |du| p ≤ Cr n−p+ α Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page ... isoperimetric inequality (2.12) for the admissible pair (F, Ψ), we obtain that Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page ... Hölder inequality of weakly A- harmonic sensors and Hölder continuity of A- harmonic sensors. Journal of Inequalities and Applications 2011 2011:99. Submit your manuscript to a journal and benefi...

Ngày tải lên: 20/06/2014, 22:20

... ammonia-assisted hydrolysis process Akrajas Ali Umar 1* , Mohd Yusri Abd Rahman 2* , Rika Taslim 2 , Muhamad Mat Salleh 1 and Munetaka Oyama 3 Abstract A simple method for the synthesis of ZnO nanofilms ... Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor, Malaysia 2 College of Engineering, Universiti Tenaga Nasional, 43000, Kajang, Selangor, Malaysia Full list of author information is available at the ... SEM) machine model ZEISS SUPRA 55VP that was operated at an acceleration voltage of 3 kV. The struc- ture and phase purity of the as prepared and the annealed samples were characterised using a Bruker...

Ngày tải lên: 20/06/2014, 22:20

... during a 10-h annealing at the Figure 3 Composition analysis of a Bi 2 Te 3 nanowire (a) A HAADF image of the Bi 2 Te 3 nanowire. (b) EDS line scan profiles showing the distributions of Bi (cyan, ... Education, Science and Technology. Authors’ contributions J.K carried out this nanowire growth experiment and character analysis and drafted the manuscript. J-S.N participated in the design of the experiment and ... manuscript. These whole experiment, analysis, and manuscript are totally directed by Prof. W.L. All authors read and approved the final manuscript. Competing interests The authors declare that...

Ngày tải lên: 21/06/2014, 04:20

... for estimating the PQoS index in a fast and easy way. The proposed analytical model has an average pearson correlation coefficient of 0.986, as proof of its robustness and reliability in many network 0.35 0.45 0.55 0.65 0.75 0.85 0.95 1.05 1.15 1.25 1.35 Analytical ... considered also the data traffic generated from other mobile devices within the AP coverage area; this aggregated data traffic represents a set of different applications such as download of audiovideo ... with a handled device. (iii) We design an accurate analytical model for real-time estimation of the perceived quality according to the network and video parameters. Finally, we verify the quality...

Ngày tải lên: 21/06/2014, 22:20

Ngày tải lên: 07/08/2014, 08:22

Ngày tải lên: 07/08/2014, 10:21

Ngày tải lên: 09/08/2014, 01:21