... the forward primer 5¢-GG
AATTC
CATATGCAACCCACTCATACGCTAACAAG-3¢
(with the NdeI restriction recognition sequence underlined)
and the reverse primer 5¢-CG
GGATCCTTATTTTAATT
TTACCTGATTGAAGGTTGAG-3¢ ... recognition
sequences for cloning into pG58 was: 5 ¢-GCTACG
TTTAAAGCGATGATGAGACCAGAACCCCCACATCA
CG-3¢ (forward primer with DraI site underlined) and
5¢-CG
GAATTCTTAGTGACCGAGGCGGCCCCTGCC-3¢
(reverse primer ... crystallographic two-fold. The data and refinement
statistics are shown in Table 2. The Ramachandran plot
has 96.9% of the residues in the most favored region
and 3.1% in the additional allowed...
... behalf of the American Association for the Study of Liver Diseases
ORIGINAL ARTICLE
Tuberculosis in Liver Transplant Recipients: A
Systematic Review and Meta -Analysis of
Individual Patient Data
Jon-Erik ... the case-fatality rate. For high-risk transplant candidates, isoniazid appears safe and is
probably effective at reducing MTB reactivation. All liver transplant candidates should receive a tuberculin ... Sugawara Y, Nakajima J, Kishi Y, Niiya T,
Kaneko J, Makuuchi M. Resection ofa pulmonary lesion
after liver transplantation: report ofa case. Surg Today
2005;35:976-978.
37. Alothman A, Al Abdulkareem...
...
process a practical certainty. But actually they do not speak with a
certain voice—especially because prima-facie adequate external fac-
tors are always with us and however we may treat them ... i.e., adaptation within the fundamental data of the system. Ad-
aptation may, however, consist in altering some of those data, and
such creative response belongs to the class of internal change. ... Mar-
shallian tradition and to make use of time in order to define another
type of imperfection of equlibrium. What was meant above was the
case ofa system so circumstanced as never to reach...
... Free ligands
were adsorbed on charcoal, and the absorbance spectra
were recorded. Concentration of appearing IF–CNCbl was
calculated by comparison with the standards IF–H
2
OCbl
and IF–CNCbl according ... and
fixation of the ligands by IF. Dissociation of IF–CBC was biphasic, and
existence of multiple protein–analogue complexes with normal and partially
corrupted structure may explain this behaviour. ... adenosylcobalamin in
patients diagnosed with various malignancies. Mayo
Clin Proc 75, 568–580.
4 Bagnato JD, Eilers AL, Horton RA & Grissom CB
(2004) Synthesis and characterization ofa cobalamin-
colchicine...
... of documents and vocabulary size are much
larger than the size of latent semantic class variables.
Thus, latent semantic class variables function as bot-
tleneck variables to constrain word occurrences ... 39th Annual Conference on Association
of Computational Linguistics (ACL), 124-131.
E. Charniak, K. Knight and K. Yamada. 2003. Syntax-
based language models for statistical machine transla-
tion. ... standard MapReduce paradigm (Dean and
Ghemawat, 2004): the corpus is first divided and
loaded into a number of clients, and n-gram counts
are collected at each client, then the n-gram counts
mapped and...
... study are shown in Fig. 2.
Asp140, Asp142, Glu144 and Asp215 were mutated indi-
vidually to asparagine and alanine, Tyr10 and Tyr214 were
replaced by Phe, and Ser93 was replaced by alanine. All
clones ... The
pK
a
of Asp140 is much lower than that of Asp142 and
Glu144 in all situations where all three residues are present
and the one proton shared by Asp140 and Asp142 appears
to remain on Asp142 ... glycosyl-
transferase elucidate catalysis in the alpha-amylase family. Nat.
Struct. Biol. 6, 432–436.
16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai,
A. , Henrissat, B. & Dijkstra,...
... engaged in a strategy that places the company
as major player in the regional mobile market place. With recent expansion into Nigeria, Rwanda,
Swaziland, Cameroon and Uganda, the MTN brand ... (FMO of the Netherlands, Development Bank of
Southern Africa and DEG of Germany) and US$120-million of senior debt from commercial
banks (Barclays Bank plc and the Standard Bank Group). EAIF has ... technical and financial
assistance directed towards national and regional capacity building, technology transfer on
mutually agreed terms, cooperation in R&D programmes and exchange of know-how.”...
... (Stratagene, La Jolla, CA,
USA). The primers used were: 5¢-TATATCATTCA
GGATTATTTG
TATCTTTTAGAATACGCTAAGGTG-3
¢ (forward, the mutagenesis codon underlined) and 5¢-TT
AGCGTATTCTAAAAG
ATACAAATAATCCTGAATGA
TATAAAAAC-3¢ ... enzyme assay for transglutaminase
activity. Anal Biochem 274, 141–144.
25 Gasteiger E, Hoogland C, Gattiker A, Duvaud S,
Wilkins MR, Appel RD & Bairoch A (2005) Protein
Identification andAnalysis ... of degradative enzymes,
such as the alkaline protease aprE, at the tran-
scriptional level [6] and, for that reason, TenA is often
classified as ‘putative transcriptional regulator’ (http://
au.expasy.org/).
A...
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R,
5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT-
cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC
CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT
CCAAGTGC-3¢ for GT-cDNA2 (3043 bp).
Construction and ... A, 5¢-TGTC
AGTCCTGTACAAAGAC-3¢ and Primer B, 5¢-CAT
CAGGCTTCCCCATA-3¢. Gene-specific nested primers
for 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCAT
CATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAA
GTCATTATGGCGCAAA-3¢. ... introns, and an
open reading frame (ORF) of 1599 bp encoding a poly-
peptide of 533 amino acids, with a predicted molecular mass
of 57 kDa anda pI of 8.34.
BLASTX
analysis showed that
the ORF shared...
... evidence against a
verb-raising analysis for German. Processing considera-
tions also speak against this approach: we would have to
postulate that German speakers can either use the German
center-embedding ... this approach to the extraposition cases,
I will recast it in terms ofa closely related automaton, the
Bottom-up EPDA (BEPDA) ~. The BEPDA consists ofa
finite-state control andofa stack of ... of stacks. There are two
types of moves: either an input is read and pushed onto a
new stack on top of the stack of stacks, or a fixed num-
ber of stacks below and above a designated stack...
... CCT were quantitated by the use ofa phosphori-
mager and expressed as a fraction of the maximum amount of bound
labeled tubulin and plotted as a function of the ratio of labeled : un-
labeled tubulin.
Ó ... probably accumulated in order to allow microtubules
polymerization and stability at the low temperature of the
Antarctic sea water ([6], S. Pucciarelli and C. Miceli,
unpublished results). An analysis ... determined by Incla
`
n and Nogales [47]. Arrows and rectangles indicate b-sheets and a- helices, respectively. The labels ÔLÕ and ÔMÕ
indicate residues involved in longitudinal and lateral contacts between...