a system for semantic analysis of chemical compound names

... Yinghua Wu, Anatoly Dryga, Nirav Malani, Frances Male, Shantan Reddy, Aubrey Bailey, Kyle Bittinger, John K Everett, Laure Caccavelli, Mary J Drake, Paul Bates, Salima Hacein-Bey-Abina, Marina Cavazzana, ... Dryga*1, Nirav Malani1, Frances Male1, Shantan Reddy1, Aubrey Bailey1, Kyle Bittinger1, John K Everett1, Laure Caccavelli4, Mary J Drake1, Paul Bates1, Salima Hacein-BeyAbina4, Marina Cavazzana4 and ... sequences, and characterize the consequences using synthetic and AC C experimental data In an accompanying paper, we describe an additional set of statistical tools for data analysis and visualization

Ngày tải lên: 04/12/2022, 14:52

... LabSolutions software All data analysis (e.g alignment, background correction, chromatogram reshaping and peak analysis) was performed in MATLAB R2021a, purchased from Mathworks (Natick, MA, USA) Results ... determine approximate critical conditions when narrow standards are not available, as is very often the case (e.g for copolymers) For all analytes the changes in peak width and shape as a function of ... utilized system is not indicated, system A was used 2.1 Laboratory A 2.1.1 Equipment and software System A, located in Germany, consisted of an Acquity Quaternary Solvent Manager, an Acquity Column

Ngày tải lên: 20/12/2022, 21:34

... Barley, oat, rice, rye, and Barley, rye, and wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat wheat Spiking ... the analysis are particularly considered It is estimated that 60–80% of the work activity and operational costs in analytical laboratories are spent preparing samples for analysis It is also ... of the matrix-matched calibration and the semi-procedural-standard calibration was less than 25% for almost all of the compounds Additionally, pesticide recovery was calculated at each of the

Ngày tải lên: 25/12/2022, 02:42

... practice, reference value is selected based on a simple analysis of the analyzed signal and the implementation system [10, 17]. It is defined as a few percent of the SPEC’s maximal value at a ... merous additional problems in practice. Some simple imple- mentations of the architectures for TF analysis are presented in [10, 13–19]. An architecture for VLSI design of systems for TF analysis and ... Distance[] Underflow Direction Overflow Not a2 [19 18] a2 [19 0] GND a2 [17 0] Datab[] Dataa[] Cin ParADD1 Cin Datab[] Cin Dataa[] q[] Cout SM[19 0] Output Cout Result[] LPM ADD SUB ParADD1 Datab[]

Ngày tải lên: 22/06/2014, 23:20

... well-targeted (pain) anamnesis [1-3]. Many years of practical experi- ence and the limited time allowed for occupational med- ical examinations speak for a systematic subdivision of the physical ... medial angle of the scapula (origin of the musculus leva- tor scapulae) and on the lateral upper margin of the scap- ula for the m. trapezius. The tests for compression and traction of the neck are ... is rather information about functional disorders and any impairment of performance or mobility which they can cause. The division of the physical examination into a rapid screening phase and a

Ngày tải lên: 20/06/2014, 00:20

... two alternative architectures of the single-core and multicore approach Also, the details for the data analysis of the microarray of a custom Lab-on-Chip are described 4.1 Microarray data analysis ... PROCESSING ALGORITHM Statistical analysis of microarray data can essentially process massive amounts of data and can also adjust for various sources of variability in order to identify the important ... evaluate and design a scalable architecture to elaborate large volume of DNA microarray data, we used field-programmable gate array (FPGA) technology The first target of evaluation is the use of

Ngày tải lên: 21/06/2014, 22:20

... Method for Nonlinear Semidefinite Programming Yun Wang, 1 Shaowu Zhang, 2 and Liwei Zhang 1 1 Department of Applied Mathematics, Dalian University of Technology, Dalian 116024, China 2 Department of ... et al. 20075 considered the rate of con- vergence of the classical augmented Lagrangian method and Noll 20076 investigated the convergence properties of a class of nonlinear Lagrangian ... augmented Lagrangian method for nonlinear semidefinite programming,” Mathematical Programming, 2008. 6 D. Noll, “Local convergence of an augmented Lagrangian method for matrix inequality constrained

Ngày tải lên: 22/06/2014, 18:20

... Other approaches are forced to use a smaller language model in the first pass and rescore with a larger language model R Amaral et al Table 2: APP impact on speech recognition Segment boundary Manual ... has a good real-time performance, although the results for European Portuguese are not yet at the level of the ones for languages like English, where much larger amounts of training data are available ... and S A Della Pietra, “A maximum entropy approach to natural language processing,” Computational Linguistics, vol 22, no 1, pp 39–71, 1996 [15] S Matsoukas, R Prasad, S Laxminarayan, B Xiang,

Ngày tải lên: 22/06/2014, 20:20

... 3.0 is regarded as satisfactory for screening (for example in plant breeding), values of 5 and upward are suitable for quality control analysis, and values of above 8 are excellent, and can be used ... three-quarters of the commer - cial height. 2.2. Sampling method Two sets of measurements were performed: (a) On each tree, a disk was taken for chemical analysis at half of the commercial height. A ... generalised Mahalanobis distance [33]. This parameter, calculated on the basis of a principal components matrix derived from a principal compo - nent analysis (PCA) of the spectral matrix, is a powerful

Ngày tải lên: 08/08/2014, 14:20

... Molecular de Plantas, Estación Experimental del Zaidín (CSIC), Profesor Albareda 1, 18008, Granada, Spain Full list of author information is available at the end of the article Zienkiewicz et al. ... matrix of the exudates (arrowheads). (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae ... signal was obtained exclusively in the range of 510-560 nm emis- sion wavelengths and was recorded in green. Ultrastructural localization of Ca 2+ Ca 2+ localization was cytochemically analyzed

Ngày tải lên: 11/08/2014, 11:21

... 3 phosphate dehy-drogenase (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGAT- GATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control. ... in activated cells of S phase was also included as test of more functional relevance. An important key regulator of the apoptotic pathway such as caspase-3 was also evaluated immunohistologically ... uptake as markers for proliferation and of cleaved (activated) effector caspase-3 as indicator of late phase apoptosis were assessed by immunohistochemistry. Transcription of caspase-3 was analyzed

Ngày tải lên: 12/08/2014, 15:20

... knowledge on the system. This analysis of data in the context of the available knowledge is often performed in an informal manner: The researcher sketches a diagram of a relevant subsystem according ... large-scale data- sets is a major challenge. A variety of computational modeling approaches have been developed for the analysis of such data- sets, such as clustering [1,2] and topological interaction ... Open Access 2008Ulitskyet al.Volume 9, Issue 1, Article R1 Software MetaReg: a platform for modeling, analysis and visualization of biological systems using large-scale experimental data Igor

Ngày tải lên: 14/08/2014, 08:20

... function of our average source model matches that from real-world traces and remains reasonably accurate even at high orders with deviations no more than 0.12. Since it also models the way packets are ... We assume that all packets passing through Channel A are of the same... a flow, or typically increase with small deltas between consecutive packets of a flow Header compression capitalizes ... bandwidth efficiency over bandwidth scarce channels and is especially attractive in the presence of small packet payloads, which is often the case in practice Interactive real-time applications

Ngày tải lên: 16/09/2015, 12:35

... being displaced, would leave gate marks and mean a large percentage of wasted material in the runner Internal gating would be a possibility with a threeplate mold and a break-away pinpoint gate However, ... remaining components, material no 1.2312 is employed because of its better machinability The mold clamping plates are made of material no 1.1730; the wear plates are made of material no 1.2162 and ... bottom surface of the bumper fascia are formed by core pins (18) They are operated by hydraulic wedge gate (19) located along the adaptor plate area of the mold Runner System/Gating The part is filled

Ngày tải lên: 29/04/2016, 13:51

... GC- and LC-based determinative analysis Quantification is performed using an internal standard, which is added to the extract after the initial addition of acetonitrile Samples with a low water ... Michelangelo Anastassiades, CVUA Stuttgart QuEChERS - Mini-Multiresidue Method for the Analysis of Pesticides Page of 12 Losses of certain compounds (of low polarity and planar structure) may also occur ... comminution cannot be achieved with the means available in the laboratory, the use of larger sample amounts for analysis (scaling up) and/or the use of Ultra-Turrax during the first extraction step may

Ngày tải lên: 06/10/2016, 09:38

... Scholar Analyse steps Title & Abstract screening, Number of citations potentially relevant (Y/N) Available (Y/N) Analysis of article content, for- / backward search  relevant (Y/N) Classification ... & separate phase Scant attention to the shaping of IT artefacts by the organizational context Fails that the artefacts emerges from interaction with the organization • • • Need for a research ... Architecture Management Enabler for Leading Industrial softwarE Objectives of AMELIE • • • • Guide architects to perform architecture management Ensure that software architecture, business strategy and

Ngày tải lên: 10/12/2016, 15:36

... example: what are the accountabilities, formal and informal, of a particular European agency? For this purpose we need to establish when a certain practice or arrangement qualifies as a 4 form ... relations, the forums are not principals of the actors, for example courts in case of legal accountability or professional associations in case of professional accountability The obligation that ... the quality of the provision of information by the actor, the quality of the procedure, and the quality of the forum’s judgement, afford a framework for a normative analysis of accountability

Ngày tải lên: 11/12/2016, 11:11

... tabular format Handbook of Chemical Compound Data for Process Safety (Product #5381) Carl L Yaws Comprehensive safety and health-related data for hydrocarbons and organic chemicals and selected data ... safety : comprehensive safety and health-related data for hydrocarbons and organic chemicals : selected data for inorganic chemicals Carl L Yaws p cm - (Library of physico-chemical property data) ... University, Beaumont, Texas NO FORMULA 1Ag AgCt Agl At AtB3H12 AIBr3 10 11 12 13 14 15 16 17 18 19 20 21 22 AtCt3 AtF3 AtI3 A[203 At2S3012 Ar As AsBr3 AsCt3 AsF3 AsF5 AsH3 AsI3 As203 At Au 23 B 24

Ngày tải lên: 01/06/2018, 14:26

... each company‟s official website The study aims at giving readers a brief description and analysis of advertising slogans and their accompanying images The analysis was based on a combined framework ... Essential supplementary medical insurance ESMI Russia Australia BUPA private health insurance 47 BUPA Feel better Prudential 48 (48a) Always listening (48b) Always understanding ALFA 49 ALFA Anyscale ... social and cultural context of the language Halliday also argued for three metafunctions of language: interpersonal metafunction – the interaction between speaker and addressee; ideational metafunction

Ngày tải lên: 13/10/2019, 23:42

... powered by tractor, power tiller, animal or human being With increase in mechanization level in India and non-availability of animal power, tractor and power tillers are gaining popularity as power ... Lan et al., 1999; Grift et al., 2001; Watabe et al., 2001; Karayel et al., 2006; Changqing, 2010; Navid et al., 2011; Wang and He, 2011; Yongfang et al., 2011 and Okopnik and Falate, 2014) Among ... receiving the radiation (Steffen, 1976; Bell, 1979; Friend, 1987; Watabe et al., 2001; Wang and He, 2011 and Okopnik and Falate, 2014) AlMallahi and Kataoka, 2013, used an off-theshelf digital fibre

Ngày tải lên: 09/01/2020, 19:02