Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents Takako Sasaki 1 , Karlheinz Mann 1 , Jeffrey H. Miner 2 , Nicolai Miosge 3 and Rupert Timpl 1 1 Max-Planck-Institut fu È r Biochemie, Martinsried, Germany; 2 Renal Division and Department of Cell Biology and Physiology, Washington University School of Medicine, St Louis, MO, USA; 3 Center of Anatomy, Department of Histology, University of Go È ttingen, Germany Domain IV, consisting of abo ut 230 residues, represents a particular protein module so far found only in l aminin b1 and b2 c hains. Both domains were obtained by r ecombi- nant production in mammalian cells. They showed a globular structure, as expected from electron microscopic examination of laminins. Fragment b1IV w as obtained as a monomer and a disul®de-bonded dimer, a nd both were modi®ed t o  50% b y a single chondroitin sulfate chain attached to Ser721 of an SGD consensus sequence. Dimerization is caused by an odd number of cysteines, with three of them having a par tial thiol character. Whether both modi®cations also occur in tissue forms of laminin remains to be established. Fragment b2IV was only obtained as a monomer, as it lacked one crucial cysteine and the SGD sequence. It required, however, the presence of two adjacent LE modules for p roper folding. Polyclonal antibodies raised against both fragments showed no cross-reaction with each other and allowed establishment of b chain-speci®c radioimmunoassays and light and electron microscopic immunostaining of t issues. This demonstrated a 5±25-fold lower content of b2com- pared with b1 chains in various tissue extracts of adult mice. Tissues derived from b2-de®cient mice failed to react with the b2-speci®c antibodies but showed a twofold higher content of b1 than heterozygotes. The antibodies to b2 showed broader tissue staining t han reported previously, including in particular a distinc t reaction with the extra- synaptic endomysium of skeletal muscle. Immunogold staining localized both b chains primarily to basement membranes of kidney, muscle and various other tissues. Keywords: basement membranes; chondroitin sulfate; laminin domain; radioimmunoassay; recombinant p ro- duction. Laminins represent a family of heterotrimeric proteins (abc) which are mainly localized in basement membranes and involved in cell±matrix and various other protein interac- tions. Fifteen different isoforms are so far known, laminin-1 to laminin-15, based on the assembly of different a1toa5, b1tob3andc1toc3 chains [1±3]. These chains share a 600- residue domain II,I which oligomerizes into a rod-like coiled-coil structure forming the long arm of laminins. The N-terminal short arms and C-terminal G domains, however, are composed of laminin-type LE, L4, LN and LG modules, which form rod-like or globular structures in various combinations [1,4]. Most of these modules are also shared by seve ral other extracellular proteins s uch as t he proteoglycans perlecan and agrin. A few other domains are so far unique to laminins and include domain IV of the b1 and b2 chain. Only b1IV h as so fa r been obt aine d as a proteolytic fragment [5]. Ten of the laminin isoforms contain either the b1or b2 chain in combination with c1 and one of the ®ve a chains [6±8]. These two b chains consis t o f about 1760 residues, have an identical modular structure, and show about 50% sequence identity [9,10]. Their mRNAs are expressed at different levels in a large number of tissues [10,11], produced by a variety of cultured cells, and, as shown by antibody staining, encode proteins found in various basement mem- branes [12±16]. Their distribution can change during embryonic development, particularly in aorta, kidney and skeletal mu scle. The b2 chain was actually discovered in a search for proteins that are speci®c for neuromuscular synapses [9] and this restriction has been con®rmed in subsequent studies of mouse [15] but not human tissues [17±19]. Little evidence is, however, available on potential func- tional differences between b1andb2 chains. Laminins containing either variant were shown to promote in an equivalent manner cell adhesion [6] and neurite outgrowth [7]. These activitie s are attributed to the shared a chains and apparently not modulated by different b chains. The analysis of chimeric b chains provided evidence that a 16-residue sequence close to the C-terminus of domain I is directing the synaptic localization of b2-containing laminins [20]. A Leu-Arg-Glu sequence in a similar region of b2 chain was also claimed to provide a speci®c stop signal for neurons [21]. This sequence seems, however, not to be active when installed in a native coiled-coil conformation [22]. A particular role for t he b2 chain was also emphasized Correspondence to R. Timpl, Max-Planck-Institut fu È rBiochemie, Am Klopferspitz 18A, D-82152 Martinsried, Germany. Fax: + 49 89 8578 2422, Tel.: + 49 89 8578 2440, E-mail: timpl@biochem.mpg.de (Received 8 august 2001, revised 31 October 2001, accepted 7 November 2001) Eur. J. Biochem. 269, 431±442 (2002) Ó FEBS 2002 by gene knock-out studies, which demonstrated in mice distinct de®ciences in neuromuscular synapses and glomer- ular ®ltration [23,24]. In this study, we have used recombinant production of domain IV in mammalian cells to explore further structural and tissue differences of the b1andb2 chain. This revealed glycosaminoglycan modi®cation a nd disul®de-dependent dimerization of b1IV but not of b2IV, which could be readily explained by sequence differences. This also allowed development of sensitive and speci®c immunological assays for both b chains that are useful for quantitative analyses and examination of their distrib ution in tissue s. MATERIALS AND METHODS Sources of proteins Laminin-1, in complex with nidogen-1 and its elastase fragment E10, were obtained from a mouse tumor basement membrane [5,25]. Other recombinant fragments of mouse laminins included a1IVa [26], b1VI//V and b3VI/V (unpub - lished) which were prepared by established procedures [27]. Construction of expression vectors and cell transfections The templates used were a complete mouse b1 cDNA (plasmid no. 1609) provided by Y. Yamada (NIDR, Bethseda, MD, USA), and for b2IV we used RNA from embryonic mouse endothelial cells provided by A. Hatzo- poulos (GSF, Munich, Germany). T he sense and antisense primers for b1 were GTCAGCTAGCTAACGAGGTGG AGTCCGGTTAC and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively. They were used for ampli®cation by PCR and RT-PCR, respectively. These primers introduced at the 5¢ end an NheIsiteandatthe3¢ end a stop codon followed by an XhoI site to allow insertion into the episomal expression vector pCEP-Pu containing the BM-40 signal peptide [28]. A Ser721Ala mutation was introduced into b1IV by fusion PCR [29].These vectors were used to t ransfect 293-EBNA cells, and serum-free medium was collected from these cells [28]. Puri®cation of recombinant proteins Conditioned medium was passed over a DEAE-cellulose column equilibrated in 0.05 M Tris/HCl, pH 8.6, and eluted with a line ar 0±0.6 M NaCl gradient. The ef¯uent was monitored at 280 nm an d by a carbazole assay [30]. Fragment b1IV was eluted at 0.2±0.3 M and 0.3±0.4 M NaCl, whereas most of fragment b2IV did not bind to the column. They were both puri®ed on a Superose 12 column (HR 16/50) equilibrated in 0.2 M ammonium acetate, pH 6 .8. Fragment b2IV was then bound to a Mono Q column in 0.02 M Tris/HCl, pH 8.0, and eluted with 0.03± 0.05 M NaCl. Characterization of protein structures Cleavage with CNBr was p erformed in 70% f ormic acid (24 h at 23 °C) in the dark under nitrogen. The fragments were separated by size-exclusion chromatography on a Superdex Peptide column (Amersham-Pharmacia; HR 10/ 30) in 0.1% tri¯uoroacetic acid/25% acetonitrile. Further cleavage at enzyme/substrate ratios of 1 : 100 with trypsin or endoproteinase Lys-C in 0 .2 M NH 4 HCO 3 or with pepsin in 0.1 M glycine/HCl, pH 1.9 (23 °C, 15 h) was followed by Superdex chromatography and/or HPLC on a C 18 column [31]. Differential alkylation with 4-vinylpyridine or iodoac- etate after partial and complete reduction with dithioth reitol in 0.05 M Tris/HCl, pH 8.5, and 6 M guanidinium hydro- chloride/0.05 M Tris/HCl, pH 8.5, respectively, followed a previously used procedure [32]. Digestion with chondroitin- ases ABC, AC or B (Sigma) followed a previous protocol [33]. Analytical methods Hydrolysis with 6 M or 3 M HCl (16 h, 110 °C) was used to determine protein and hexosamine contents on an LC3000 analyzer (Biotronic). E dman degradation was performed on Applied Biosystems sequencers 473 and 492 following the manufacturer's instructions. The recovery of pyridylethylcy- steines and carboxymethylcysteines was e stimated from the height of the respective phenylthiohydanto in derivatives in the corresponding sequencer runs. Electron microscopy of rotary shadowed proteins [34], CD, and matrix-assisted laser desorption ionization MS [35] followed standard protocols. Immunological methods Generation of rabbit antisera, af®nity puri®cation of antibodies, ELISA titration, and radioimmunoassays fol- lowed established protocols [36]. A radioimmuno-inhibition assay speci®c for recombinant mouse laminin fragment c1III3-5 using antiserum against laminin fragment P1 has been described [37]. Immunoblotting using ECL Western- blotting reagents followed a previous procedure [38]. Mouse Engelbreth-Holm-Swarm (EHS) tumor and tissues from adult mice and 18-day-old pups heterozygous for (b2+/±) or lacking (b2 ±/±) the laminin b2 chain gene [23] were extracted with EDTA-containing buffers and then deter- gents; this was followed by digestion with bacterial colla- genase [39]. These extracts were then used at dilutions o f 1 : 10 and higher for radioimmuno-inhibition assays. Immuno¯uorescence staining of frozen tissue sections folllowed previously used procedures [8,15]. Gold p articles (16 n m) were used to label af®nity-puri®ed rabbit antibodies as described [40]. Tissue s ections on nickel grids w ere incubated for 15 min with NaCl/P i ,pH7.2,andthen labeled gold diluted 1 : 200 for 16 h at room temperature. Sections were rinsed with water, stained with uranyl acetate (15 m in) and lead citrate (5 min), and examined with a Zeiss EM 109 electron microscope. Controls included colloidal gold alone or samples coated with goat anti-(rabbit Ig) IgG or anti-(rat Ig) IgG and were all negative. RESULTS Expression and puri®cation of recombinant domain IV from mouse laminin b1 and b2 chain Domain IV of t he b1 (position 541±771) and b2 (position 556±782) chains correspond to the central globular domain 432 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002 in the short arm of these laminin chains [2] (Fig. 1B). They are of similar size and share 41% identical residues including four out of ®ve cysteines and 2 9% conservative replace- ments (Fig. 1A). Features unique to b1IV are single potential acceptor sites for N-glycosylation and glycosami- noglycan attachment, respectively. Episomal expression vectors were prepared for both domains in order to obtain them as recombinant fragments from serum-free culture medium of transfected human kidney 293-EBNA cells. Production and secretion of fragment b1IV occurred at h igh rates (150±170 lgámL )1 áday )1 ) as shown by radioimmuno- assay (see below), whereas no protein could be detected after transfection with the b2IV expression vector corresponding to the sequence shown in Fig. 1 A. This indicated a protein- folding p roblem, which was overcome b y adding two laminin-type epidermal g rowth factor-like (LE) modules to the N-treminus and C-terminus of b2IV (LE5, position 523± 555; LE6, position 783±831, see Fig. 1B), allowing produc- tion of this longer fragment at a moderate level (5 lgámL )1 á day )1 ). This fragment will be referred to as b2IV. The initial puri®cation of fragment b1IV on DEAE- cellulose showed it to be present in about equal proportions in two pools e luted at 0.2±0.3 M NaCl (pool 1) and 0.3± 0.4 M NaCl (pool 2). Pool 1 consisted mainly of a 34-kDa band, as expected for a b1IV monomer, and about equal amounts of a disul®de-bonded b1IV dimer (66 kDa), which could be separated by molecular sieve chromatography as shown by e lectrophoresis (Fig. 2, lanes 1 and 3). P ool 2 coincided with a strong carbazole reaction for uronic acids, Fig. 1. Sequence alignment of domain I V (A) from mouse laminin b1 (top) and b2 (bottom) chains and domain structure of the laminin b1 and b2 chains (B). (A) Both sequences show 41% identity (bars) and 29% conservative changes (dots). Cysteines are numbered 1±5 in b1 and 1±4 in b2, and carbohydrate attachment motifs (SGD, N YT) are high- lighted in bold. Asterisks mark corrections to the pub lished genomic sequence of mouse b2 [43]. An arrowhead indicates the start of frag- ment E10 [5]. The numbering includes the signal peptides. (B) Laminin b1andb2 chains have the same domain structures consisting of LN and LE (circles) modules, domain IV, and a coiled-coil (cc) domain II,I. Fig. 2. SDS/PAGE of puri®ed recombinant fragments c ontaining domain IV of b1orb2 chain under nonreducing (A) and reducing (B) conditions. Lanes were loaded with equal amounts of b1IV monomer (1), b2IV (2), b1IV dimer (3), b1IV substituted with chondroitin sulfate before (4) and after (5) digestion with chondroitinase ABC, and b1IV mutant S721A monomer form (6). Positions of calibrating proteins are showninkDaontheleft. Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 433 indicating the presence of a proteoglycan. The correspond- ing b1IV fragment was eluted in front of the b1IV dimer from a molecular sieve and showed a broad electrophoretic band mainly in the range 70±110 kDa, which could be converted into the monomer and dimer bands after treatment with chondroitinase ABC (Fig. 2, lanes 4 and 5). Recombinant fragment b2IV did not bind to DEAE- cellulose and s howed, after molecular s ieve chromatogra- phy, a single band of 33 kDa (Fig. 2, lanes 2), indicating its monomeric nature and lack of glycosaminoglycan mod i®- cation. Edman degradation of the puri®ed recombinant fragments showed a major single N-terminal sequence, which was APLANEVESG for the b1 variants and APLARPXD for b2IV, as expected from the vector constructs. The ®rst four residues, respectively, were derived from the foreign signal peptides introduced to allow secretion of the proteins. Structural characterization of the fragments The proper folding of the recombinant fragments was examined by several methods. Rotary shadowing followed by electron microscopy showed small compact globular shapes for b1IV monomers and dimers (not shown) and b2IV (Fig. 3B). The same globule was also observed f or the proteoglycan form of b1IV, but with some of the particles being connected to a long faint thread-like structure (Fig. 3 A). As t hese threads were not observed for b1 monomers and dimers, they probably represent the g lyco- saminoglycan side chain. Proteolysis studies of b1IV monomer showed no signi®cant change after trypsin treatment (1±24 h), while elastase caused degradation to a 22-kDa fragment similar to the E10 fragment obtained from elastase digests of laminin-1 [5]. Fragment b2IV, however, was readily cleaved within 1±4 h by trypsin into fragments smaller t han 20 kDa but was resistant to endoproteinase Glu-C (data not shown). CD spectra of the b1IV monomer showed a strong negative ellipticity at 209±220 nm, indicat- ing about 30% a helix and only a small amount of b structure (Fig. 4). The b2IV structure had only half the a-helic al content, which may have become obscured through the presence of two additional LE modules, which, as shown previously, have only a small amount of secondary structure [41]. Hexosamine analysis of b1IV monomer and dimer showed 5±6 residues of glucosamine and less than one galactosamine. That Edman degradation of various prote- olytic peptides (see below) failed to identify Asn677, indicating full occupation of the single N-linked a cceptor site. The proteoglycan form of b1IV showed the same glucosamine content, b ut a large increase in galactosamine content (48 residues), which corresponds to about 19 kDa of a glycosaminoglycan chain. Furthermore, digestion with chondroitinases ABC (Fig. 2) and A,C but not by ch on- droitinase B or heparitinase ( not shown) yielded t he b1IV monomer and dimer bands, demonstrating the exclusive substitution by chondroitin sulfate. The mean (SD) length of the side chain was estimated from electron micrographs of 30 particles to be 40 ( 10 nm), which is in good agreement w ith a molecular m ass o f 20 k Da. M utation of Ser721 to Ala did not interfere with recombinant produc- tion of b1IV monomers (Fig. 2, lane 6) and dimers but prevented completely the modi®cation by glycosaminogly- cans, consistent with the a bsence of any oth er strong acceptor site w ithin the b1IV sequence (Fig. 1). Fragment b2IV lacked any of thes e substantial post-tr anslational modi®cations, as d etermined b y M S, which yielded a molecular m ass of 34 369 Da, in g ood agreement with a mass of 34 357 calculated from the sequence. The odd number of cysteines in b1IV indicated the presence of a free thiol group, which is probably responsible for dimerization. The native b1IV dimer was therefore ®rst modi®ed b y partial reduction and p yridylethylation to protect the thiol followed by complete reduction under denaturing conditions and carboxymethylation. Peptides were then generated by cleavage with endoproteinase Lys-C followed by cleavage with some other proteases and determination of the sequence around the ®ve cysteines Fig. 3. Rotary shadowing electron microscopy of chondroitin sulfate- substituted fragment b1IV (A) and fragment b2IV (B). Bar: 100 nm. Fig. 4. CD spectra of recombinant domain IV from laminin b1 (full line) and b2 (dashed line) chain. 434 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002 (C1 to C5, Fig. 1A) by Edman degradation. The data obtained showed complete carboxymethylation for C1 a nd C2, while for C3, C4 and C5 there was also 20±25% pyridylethylation. Dimeric b1IV was also cleaved w ith CNBr giving rise to three single-chain peptides starting at the N-terminus and positions 609 and 677, respectively. This indicated C1±C2 connectivity, which was con®rmed by Edman degradation of smaller pepsin fragments. The fourth CNBr peptide showed two sequences starting as expected in front of C3 and C5 and should also contain C4 (Fig. 1A). A smaller pepsin fragment showed a c onnection between C3 and C5. Yet b ecause of the variable thiol content of C3 to C5 (see above), we cannot exclude the possibility that the disul®de connectivity is ¯exible, and we suggest that partial formation of C3±C4 and C4±C5 bridges occur as well. Immunochemical assays for domains b1IV and b2IV and their application to the analysis of tissues Many previous studies based mainly on immunohistology have shown a complex and in part overlapping expression pattern of laminin b1andb2 chains in adult tissues, during embryonic development and in cultured cells (reviewed in [2,16]). Several of the monoclonal antibodies against b2chainweregeneratedinmiceandfailedtoreactwith the corresponding mouse antigens [9]. To circumvent these limitations and to allow quantitative assays, we generated rabbit antisera against recombinant mouse b1IV and b2IV. These antisera had high titers (half-maximal binding) at dilutions of 1 : 4000 (anti- b1) and 1 : 20 000 (anti-b2) in ELISA and radioimmunoassays and did not cross-react (titer less than 1 : 100) with the homologous (b2orb1IV) antigen or recombinant N-terminal fragments b1VI/V and b3VI/V of mouse l aminin. T hey were also c learly distin- guishable in immunoblots of several biological samples, with anti-b1 reacting mainly with a 220-kDa band and anti- b2 with a 190-kDa band after electrophoresis under reducing conditions (data not shown). The antisera allowed the development of speci®c and sensitive radioimmuno-inhibition assays, with half-maximal inhibition being achieved at 0.1±0.2 n M b1IV and b2IV, respectively (Fig. 5). The b1IV assay was inhibited in nearly identical manner by m onomeric and dimeric b1IV and the proteoglycan form and by laminin-1 (a1b1c1) derived from the mouse EHS tumor (Fig. 5A). Laminin-1 fragment E10 showed a less steep and incomplete i nhibition pro®le, indicating the loss of some antigenic epitopes. A more t han 1000-fold excess of b2IV showed no inhibition (Fig. 5A), and the same was found for recombinant laminin fragments b1VI/V, b3VI/V and a1IVa (data not shown). Similarly, the assay for b2IV could not be inhibited by a large excess of b1IV (Fig. 5B). Both assays could, however, be inhibited by tissue extracts, a s shown for m ouse heart and k idney (Fig. 5), with inhibition curves similar in slope to that of the reference inhibitors b1IV a nd b2IV, respectively. Together the data showed that these assays were highly speci®c and suitable for the quantitation of b1andb2 c hain epitopes in biological samples. The extracellular matrix of m ouse EHS t umor has previously been shown to c onsist exclusively of basement membrane, and its major component, laminin-1, could be solubilized in decent amounts (5 mgág )1 wet tissue) by extraction with EDTA and 6 M guanidine [25]. W e now used this tumor and also mouse kidney and muscle for successive extraction with EDTA and detergents followed by digestion with chondroitinase/heparitinase and bacterial collagenase, which solubilized nearly all of the tissue. The extracts were analysed by the b1IV and b2IV assay and also by an assay speci®c for the laminin c1 chain [37]. This demonstrated that 71±93% of the extractable laminin c1, b1 and b2 chain were already s olubilized by EDT A and detergent. Furthermore, the content of extractable lami- nin-1 was calculated based on the c1andb1chainassayto be 5.5±5.8 mgág )1 EHS tumor, in agreement with previous data. A larger number of a dult mouse tissues were then extracted w ith EDTA a nd detergent only and examined by these three assays (Table 1). A variable content of laminin b1 chain [17±422 pmolá(g wet tissue) )1 ] and lower amounts of b2 chain (4±20% of b1) were found. As expected, the highest amounts of b1 chain were found in the EHS tumor, while t he content of b2 chain did not exceed 0.2%. T he amounts of c1 c hain were within the u sual range of Fig. 5. Radioimmuno-inhibition assays speci®c for laminin b1 (A) and b2 (B) chains. The assay consisted of 1 ng 125 I-labeled fragment b1IV monomer or b2IV and ®xed amounts of the corresponding antiserum. Inhibitors used were b1IV monomer (n), chondroitin sulfate-sub sti- tuted b1IV (,), b2IV ( m), mouse laminin-1 (s) and its E10 fragment (h) at the concentrations shown at the bottom. E DTA extracts of mouse heart (d) and kidney (j) were used at the dilutions shown at the top. Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 435 analytical error ( 20%) of such inhibition assays [36], in most cases in good agreement with the sum of b1and b2 chains. It served therefore as an internal control for the quality of t he data. Tissue extracts of mice being de®cient in the laminin b2 chain [23,24] were used as further controls and failed to inhibit the b2 assay (content less than 0.5 p molág )1 ). Interestingly, these extracts s howed a twofold increase in the b1 chain content when compared with heterozygous (b2 +/±) controls (Table 1), indicating a signi®cant increase in biosynthesis or mRNA stability. Immunolocalization in tissues The antiserum against recombinant mouse b2IV was tested in immunohistochemical assays on a panel of mouse tissues using indirect immuno¯uorescence (Fig. 6). The antiserum revealed a more widespread distribution of laminin b2than has previously been reported. In the k idney, it was previously shown to be con®ned to glomerular and vascular smooth m uscle basement membranes [9,12]. Here, it was detected in these b asement membranes, but also i n most intertubular capillaries and segmentally in some tubular basement membranes ( Fig. 6A). In skeletal muscle ®bers, it was concentrated at synapses but was also found extrasy- naptically. In peripheral nerve, it was found in the perineurium, as previously reported [9,12], but also in the endoneurium. Blood vessels throughout skeletal muscle also contained the b2 chain (Fig. 6B). In the small intestine, b2 was detected in smooth muscle and blood vessels and at a low level in the epithelial basement membrane of the crypts (Fig. 6C). In lung, it was present in basement membranes associated w ith bronchial epithelium, bronchial smooth m uscle, and alveoli through- out the p arenchyma (Fig. 6D). In the retina, b2was detected in the inner limiting membrane, Bruch's mem- brane, and in c apillary basement membranes, but was n ot detected in the interphotoreceptor matrix or in other layers of the retina (Fig. E). In h eart, b2 was found in cardio- myocyte and vascular b asement membranes throughout (Fig. 6 F). One r eason f or the discrepancies between published reports showing a restricted distribution of b2 and our results showing a more widespread distribution could be that the antiserum used here cross-reacts with another laminin chain in immunohistochemical assays. To investi- gate this possibility, we immunostained tissues from Lamb2 mutantmice(Fig.7).Thesemicehaveamutationthathas been shown to prevent any accumulation of laminin b2in basement membranes [23,24]. No signi®cant ¯uorescence was f ound on staining mutant tissues with the a nti-b2IV serum, whereas tissues from a littermate c ontrol w ere w ell stained. This demonstrates that the antiserum reacts with laminin b2 but with no other laminin chain and no other basement membrane component. Results from immunohistochemical assays using anti-b1 serum (data not shown) were mostly consistent with previously published reports showing a widespread (although not ubiquitou s) expression pattern for laminin b1. For example, in skeletal muscle, b1 was detected in the extrasynaptic muscle ®be r basement m embranes and in endoneurial basement membranes. It was not observed at synapses or in the perineurium, sites where b2 is known to be concentrated [12]. In kidney, b1 was detected in all tubular basement membranes and in the glomerular mesangium. In addition, it was detected at a low level in the glomerular basement membrane, a s ite where b2is concentrated (Fig. 6). Together with ou r b2 immunohisto- chemical results, these data suggest that many basement membranes contain both laminin b1andb2chains.How- ever, in most cases one appears to be much more prevalent than the other. Af®nity-puri®ed antibodies speci®c for b1IV or b2IV were also used for ultrastructural localization of both b chains in adult mouse tissues by immunogold staining (Figs 8 and 9). This demonstrated for tubular and glomer- ular basement membranes of kidney a distinct reaction with both antibodies of about equal intensity (Fig. 8A±D) and of basement membranes of c ollecting ducts, blood vessels and Bowman's capsule. In the heart, some weaker staining was observed in basement membranes adjacent to cardiomyo- cytes and endothelial cells (Fig. 8E,F) and also in basement membranes of t he endocardium and pericardium. Staining of skeletal muscle identi®ed both b chains in endothelial and muscle cell basement m embranes, whereas the adjacent interstitial region did not react (Fig. 9A,B). A distinctly stronger reaction for b2 was observed in the synaptic clefts of neuromuscular junctions compared with extrasynaptic regions (Fig. 9 C,D) and at myotendineous junctions. Other basement membranes containing both b chains included the dermal±epidermal junction and testis, whereas the dermal connective tissue could not be stained. DISCUSSION Domain I V of lamin in b1andb2 represents a globular structure in the central portion of the short arm region [1,2] and h as not yet b een c haracterized at the structural and functional level. We have now obtained these domains as recombinant products from mammalian cells and demon- strated t heir proper folding by electron microscopy, CD, protease resistance, and immunochemical a nalysis. The data also show that domain b1IV r epresents an autono- mous folding unit and was produced at high rate. This was Table 1. Contents [pmolá(g wet tissue) )1 ] of laminin c1, b1 and b2chains in tissue extracts from normal adult and mutant (b2+/±;b2±/±)miceas determined by radioimmuno-inhibition assays. Tissues were extracted with EDTA-contain ing bu er and detergent and analyzed by assays speci®c for recombin ant frag ments c1III3-5, b1IV and b2IV. Tissue c1 b1 b2 EHS tumor 6935 6647 14 Placenta 510 422 14 Heart 567 343 35 Skeletal muscle 133 117 23 Intestine 97 104 4 Stomach 143 125 20 Thymus 44 66 6 Skin 16 17 3 Lung 225 176 12 Lung, b2 +/± 169 153 11 Lung, b2 ±/± 313 348 < 0.5 Kidney 84 106 8 Kidney, b2 +/± 101 140 9 Kidney, b2 ±/± 205 244 < 0.4 436 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002 surprisingly not the case f or b2IV which needed two additional LE modules for reasonable expression and secretion. Similar observations have been reported for the N-terminal globular LN module (domain VI) of the laminin a1 chain, which could o nly be produced in mammalian cells after it had been joined to a tandem of four LE modules. The latter, however, folded properly o n its own [27]. Another interesting observation is the relatively high content o f a helix in b1IV and probably b2IV. A high helix content has s o far only been demon- strated for the coiled-coil domains I and II of laminins [1,2], whereas o ther domains, such a s those composed of Fig. 6. Immunohistochemical localization of laminin b2 chain in basement membranes of adult mouse tissues by antibodies against b2IV. (A) In kidney, b2 is detected in basement membranes of glomerulus (g), large blood vessels (v), and most intertubular capillaries (arrows). Some segments of tubular basement membran es are also stained. (B) In skeletal muscle, b2 is detected in basement membranes all around the muscle ®ber (f) as well as the neurom uscular junction (arrowhead). In peripheral nerve (n), b2 is detected in both perineurial and e ndoneu rial basement membranes. (C) In small intestine, b2 is detected primarily in basement membranes of s mooth muscle ( sm), large blood vessels ( v), and capillaries (arrows). Low levels of b2 are detectable in basement membranes associated with crypts (c). (D) In lung, b2 is d etected in basement membran es of the bronchial epithelium (e), bronchial smooth muscle (sm), and alveolar epithelium throughout the p arenchyma (p). (E) In retina, b2isdetectedintheinner limiting membrane (ilm), Bruch's membrane (bm), and in capillaries (arrows). (F) In 3-w eek-old heart, b2 is detected in basement membranes surrounding all cardiomyocytes, large vessels (v), and capillaries (arrows). Bar, 100 lmforA±C,F;50lmforD;75lmforE. Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 437 LE or LG modules, essentially lack helical segments, as shown by c rystallographic analyses [41,42]. T his suggests novel folding f or do main IV, which can now be investi- gated by X-r ay analysis of recombinant b1IV monomers and dimers. Additional differences between domain IV of b1and b2 chains are related t o single amino-acid substitutions. A single serine within an SGDG consensus sequence was shown by site-directed mutagenesis (S721A) to be partially substituted by a 20-kDa chondroitin sulfate chain i n both the b1IV monomers and dimers. This sequence is changed in b2IV of rat, mouse and hum an [9,43] to SGGD and preceded by a four-residue gap (Fig. 1), w hich may explain the failure to detect any glycosaminoglycan substitution in recombinant b2IV. Yet an SGG site in perlecan domain V [44] and three SGD sites in domain I [33,45] can serve as acceptor sites for heparan sulfate/chondroitin sulfate, and more remote sequences may regulate their complete or partial occupation [45]. Special features of such regulations may now be unravelled by site-directed mutagenesis of the corresponding regions in b1IV and b2IV domains. O ur data also indicate that tissue laminins containing b1chainsmay Fig. 7 . Antiserum to laminin b2IV does not react with basement membranes in Lamb2 mutant tissues. Kidney (A and B) and skeletal muscle (C and D) from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum. In the control, basement membranes throughout the kidney and skeletal muscle were stained. Basement membranes at neuromuscular junctions (arrows in C) were more immunoreactive than were extrasynaptic basement membranes. No immunoreactivity was detected in mutant tissues, demonstrating the speci®city of the antiserum. Neuromuscular junctions were iden ti®ed by do uble lab eling with rho damine- a-bungarotoxin (C¢ and D¢). Bar, 100 lm. 438 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002 be, at l east in part, converted i nto proteoglycans. This is underscored by conservation of the SGD sequence in the human laminin b1 chain [46], whereas the laminin b chains of Drosophila [47] and Caenrhabditis elegans (accession no. AAB 94193) lack this sequence and also differ in cysteine patterns. Preliminary unpublished studies to identify such forms in t issue extracts h ave, however, f ailed so f ar and indicated only a low level of substitution or a speci®c restriction to a few tissue sites. Yet we do not think that the partial modi®cation of b1IV is an a rtefact o f r ecombinant production because a similar low rate of substitution of recombinant perlecan domain V correlated well with a comparable low rate of modi®cation of two tissue forms of perlecan [44]. An extra cysteine (C3 at position 710) in domain b1IV not conserved i n b2IV w as a candidate to explain the substantial d imerization o f recombinant b1IV. We there- fore used stepwise reduction under nondenaturing and denaturing conditions as previously used to identify a single cysteine responsible for ®bulin-2 dimerization [32]. This provided clear evidence for a C1±C2 connectivity within b1IV but failed to identify unequivocally C3, C4 or C5 as being responsible for dimerization. This could indicate the existence of various disul®de isomers, but we Fig. 8. Immunogold staining of laminin b1 (A,C,E) and b2 (B,D,F) chain in basement membranes of kidney and heart of adult mice. Both antibodies reacted equally well with the basement membrane of a proximal tubule (A,B; arrows) and with the glomerular basement membrane (C,D; asterisks). In the heart (E,F) both chains could be detected in the basement membranes of cardiomyocytes (arrows) as well as of endothelial cells of an adjacent capillary (asterisks). The capillary lumen (l) and the interstitial tissue between both basement membranes showed insigni®cant staining. Bars, 0.25 lm. Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 439 cannot exclude the possibility that they represent artefacts of the treatments used. Nevertheless, we also cannot dismiss the possibility of t he disul®de -dependent dimeriza- tion of laminins in which domain b1IV participates. Such complexes between laminin-5 (a3b3c2) and laminin-6 (a3b1c1) are known to exist in certain basement mem- branes [48] or may be generated upon self-assembly of laminins into networks, which occurs through their N-terminal regions including the b1 chain [49]. Laminin b1andb2 chains have been localized by immunohistology a t the light microscopy level to a large variety of tissues, but not necessarily to the same subana- tomical regions, which has generated several controversial observations (reviewed in [16]). We have now prepared potent polyvalent antisera against the natively folded fragments b1IV and b2IV in order to re-examine s ome of the previous data and to e stablish more qu antitative and sensitive assays. The rabbit antisera obtained showed a high speci®city for b1andb2 chains, respectively, as demon- strated by ELISA, radioimmunoassay, and immunoblot. This was underscored by the failure to show any reactivity of antibodies to b2 with tissues d erived from b2-de®cient mice. Speci®c radioimmuno-inhibition assays of high sen- sitivity (IC 50  0.1±0.2 n M ) were developed and showed both b chains and equivalent levels of laminin c1chainsin EDTA/detergent extracts of various mouse tissues. The content of b1 chains in these extracts exceeded the conten t of b2 by a factor of 5±20. The relative amounts of b2were particularly high in skeletal muscle, consistent, a s shown here and previously, f or developing and adult human muscle [17], by distinct staining of extrasynaptic areas of muscle basement membranes. The radioimmunoassay data are also inconsistent with restriction to synapses, as shown in rats by monoclonal antibodies [9,15], considering the low density of s ynaptic junction s (usually accoun ting for less than 0.1% of the total basement membranes). The radio- immunoassays also indicated a twofold higher content of b1 chain in lung and kidney of b2-de®cient mice compared with littermate controls. Such upregulation was previously predicted from immunostaining of kidneys, but it did not lead to functional compensation [24]. This is the ®rst extensive examination of b2 distribu- tion in mouse tissues, most other studies having utilized rat, rabbit and human tissues. Thus, there could be differences in b2 distribution among species. However, restricted distribu tion of b2 in mouse kidney and skeletal muscle has been reported [ 15,23,24], and we have observed widespread expression of b2inratmuscle using anti-b2IV serum (data not shown). One possible explanation is that many laminin b2 monoclonal anti- bodies that have been produced may r ecognize a speci®c form of b2 found primarily in glomerular, synaptic, perineural, and smooth muscle basement membranes. This could result f rom selective glycosylation, con forma- tional alteration, or association with a speci®c a chain. Indeed, laminin a5 is also found in these basement Fig. 9. Immunogold staining of laminin b1(A)andb2 (B±D) in extrasynaptic and synaptic regions of skeletal muscle from adult mice. Both antibodies (A,B) stained the basement membrane around myocytes (arrows) and the endothelium of a capillary (asterisks). The arrowhead indicates some staining close to a pericyte. l, C apillary lumen. (C,D) shows some stronger staining for b2 of the synaptic cleft (asterisks) than for the extrasynaptic part (arrowheads). Bars, 0.25 lm. 440 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002 [...]... the interphotoreceptor matrix and in the outer plexiform layer [3,51] As these layers do not contain basement membranes, it is possible that our anti-b 2IV serum did not recognize b2 in these layers because of a speci®c supramolecular organization which may mask most of the antigenic epitopes of domain b 2IV We have also extended the tissue localization of laminin b1 and b2 chains to the ultrastructural... laminin- nidogen complex and their anity in ligand binding assays Eur J Biochem 178, 71±80 Brown, J.C., Wiedemann, H & Timpl, R (1994) Protein binding and cell adhesion properties of two laminin isoforms (AmB1eB2e, AmB1sB2e) from human placenta J Cell Sci 107, 329±338 Brandenberger, R & Chiquet, M (1995) Distinct heparin-binding and neurite-promoting properties of laminin isoforms isolated from chick... (1996) È Structural and functional analysis of the globular domain IVa of the laminin a1 chain and its impact on an adjacent RGD site Biochem J 314, 847±851 27 Ettner, N., Gohring, W., Sasaki, T., Mann, K & Timpl, R (1998) È The N-terminal globular domain of the laminin a1 chain binds to a 1b1 and a 2b1 integrins and the heparan sulfate-containing domains of perlecan FEBS Lett 430, 217±221 28 Kohfeldt,... localization, and expression in carcinomas Genomics 24, 243±252 Sanes, J.R., Engvall, E., Butkowski, R & Hunter, D.D (1990) Molecular heterogeneity of basal laminae: isoforms of laminin and collagen IV at the neuromuscular junction and elsewhere J Cell Biol 111, 1685±1699 Wewer, U.M., Engvall, E., Paulsson, M., Yamada, Y & Albrechtsen, R (1992) Laminin A, B1, B2, S and M subunits in the postnatal rat liver... W.D., Jenkins, N.A., Copeland, N.G & Sanes, J.R (1997) The laminin a chains: expression, developmental transitions, and chromosomal locations of a1±5, identi®cation of heterotrimeric laminins 8±11 and cloning of a novel a3 isoforms J Cell Biol 137, 685±701 Hunter, D.D., Shah, V., Merlie, J.P & Sanes, J.R (1989) A laminin- like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction... 229±234 Iivanainen, A., Vuolteenaho, R., Saino, K., Eddy, R., Shows, T.B., Sariola, H & Tryggvason, K (1994) The human laminin b2 chain (s -laminin) : structure, expression in fetal tissues and chromosomal assignment of the LAMB2 gene Matrix Biol 14, 489±497 Wewer, U.M., Gerecke, D.R., Durkin, M.E., Kurtz, K.S., Mattei, M.-G., Champliaud, M.F., Burgeson, R.E & Albrechtsen, R (1994) Human b2 chain of laminin. .. and is thought to be associated with b2 in the laminin- 11 trimer Alternatively, these antibodies may only recognize the highest concentrations of b2 Consistent with this, anti-b 2IV serum stains basement membranes recognized by the other antibodies more intensely than it stains other basement membranes Our results agree with those of Wewer and colleagues [17], who found extrasynaptic deposition of b2. .. immunogold staining for the laminin a2 chain in muscle and capillary basement membranes, whereas most of the laminin a4 chain was localized to adjacent interstitial regions of the endomysium [52] A similar restriction to basement membranes of muscle and capillaries was here found for the b1 and b2 chain Comparable staining for both b chains was also found for tubular, glomerular, and some other renal basement... Extracellular Matrix, Anchor and Adhesion Proteins (Kreis T & Vale R., eds), 2nd edn, pp 434±443 Oxford University Press, Oxford 2 Colognato, H & Yurchenco, P.D (2000) Form and function: the laminin family of heterotrimers Dev Dyn 218, 213±234 3 Libby, R.T., Champliaud, M.-F., Claudepierre, T., Koch, M., Burgeson, R.E., Hunter, D.D & Brunken, W.J (2000) Laminin Laminin b1 and b2 chains (Eur J Biochem 269)... Structure of the C-terminal LG domain pair of the laminin a2 chain harbouring binding sites for a-dystroglycan and heparin EMBO J 19, 1432±1440 43 Durkin, M.E., Gantam, M., Loechel, F., Sanes, J.R., Merlie, J.P., Albrechtsen, R & Wewer, U.M (1996) Structural organization of the human and mouse laminin b2 chain genes, and alternative splicing at the 5¢ end of the human transcript J Biol Chem 271, 13407±13416 . Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents Takako. Sequence alignment of domain I V (A) from mouse laminin b1 (top) and b2 (bottom) chains and domain structure of the laminin b1 and b2 chains (B). (A) Both