725 internal and functional behavior of a master slave s r flip flop

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20

... cell survival Caspases, a family of cysteine acid proteases, are central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation ... Isoform Size (kb) Primer sequence VBARP-L 1.9 VBARP -S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA ... CA) and used in real-time PCR analysis for various VBARP isoforms Two-step RT-PCR was performed as follows: RNA (0.2–0.5 lg) was reverse transcribed using Taqman reverse transcription reagents...

12
561
0

Báo cáo khoa học: Identiﬁcation and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Ngày tải lên : 08/03/2014, 08:20

... were probed according to the manufacturer s instructions and analysed by radio-imaging Sialyltransferase assays Sialyltransferase assays were performed as described previously [30,35–36] In brief, ... cells transfected with pFlag-sST6Gal II or control plasmid were collected after days of transfection and assayed for sialyltransferase activity, using various acceptor substrates (Table 1) We also ... hippocampus, and fetal tissues (brain, kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed...

12
584
0

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

Ngày tải lên : 16/03/2014, 05:20

... the surface plasmon resonance (SPR) measurement The proteins showed rapid adsorption to the sensor surfaces that corresponded to sharp increases in the SPR shift Upon washing, the response units ... glass, plastic, wood, and rock Naturally occurring surfaces such as rock are not microscopically homogeneous, and have a patchwork of different surface characteristics The cement is therefore required ... River (Osaka) and Shimizu Bay (Shizuoka, Japan), respectively RNA and DNA manipulation was generally performed as described previously [9] Total RNA was extracted from basal tissue of the barnacle...

11
488
0

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Ngày tải lên : 24/03/2014, 03:21

... molecular-mass marker proteins (kDa) are indicated by arrows Fig Chemical cross-linking of smelt AFP Smelt AFP (33 lM) was cross-linked using BS3 as described in Materials and methods After the h incubation, ... a larger protein form With increasing concentrations of BS3, the disappearance of the monomer band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent ... thermal hysteresis of a solution of N-glycosidase F was measured in 25 mM Hepes, pH 7.8 Results were expressed as mean ± SE Photographs of ice crystals viewed during these measurements were taken...

8
518
0

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Ngày tải lên : 31/03/2014, 09:20

... Cys residue, i.e a small molecular residue rather than an aromatic residue, such as Tyr Also interesting is the fact that Gly6 and Ser57 are highly conserved in depressant Ó FEBS 2002 Molecular ... currents in DRG neurons and ventricular myocytes Fig Circular dichroism spectra of AaHIT2, CssII and BmKIM from 180 to 250 nm De corresponds to the variation of molar amino acid residue absorption ... inserted into pSPORT I The primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding to...

8
473
0

Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

Ngày tải lên : 09/08/2014, 20:21

... turquoise arrows on forward and reverse strands, respectively Outer circles represent the EPODs (domains greater than kb with high protein occupancy) reported by Vora et al [3] EPODs were clustered ... transcriptional regulators such as CRP (cAMP receptor protein), Fis, H-NS, IHF and Lrp (leucine-responsive protein), and for some local regulators, such as MelR (melibiose metabolism regulator) and LexA ... growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able to obtain a dynamic picture of protein occupancy...

4
307
0

báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx

Ngày tải lên : 12/08/2014, 05:20

... synthesis of CGA and related esters In a recent report [25], caffeoyl-CoA has been firmly established as a major substrate for the acylation of quinic acid and the synthesis of CGA in Solanaceous ... HPLC 's All authors read and approved the final manuscript Acknowledgements We thank Prof G Mauromicale and Dr R Mauro of the University of Catania for providing plant material We are particularly ... Kristensen BK, Rasmussen SK: A New Class of NHydroxycinnamoyltransferases Purification, cloning, and expression of a barley agmatine coumaroyltransferase (ec 2.3.1.64) The journal of biological...

14
535
0

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Ngày tải lên : 12/09/2015, 08:20

... primarily serves as a modulator of receptor activity by integrating various intracellular signaling pathways through post-translational modifications such as phosphorylation Several PPARα and PPARγ AF-2 ... acid reverse transcriptase-polymerase chain reaction retinoid X receptor standard error of mean short hairpin short hairpin sequences complementary to NCoR short hairpin sequences complementary ... clinical data on the use of PPARγ agonists for the treatment of diabetes and the use of PPARα agonists for the treatment of dyslipidemia and coronary heart disease makes it likely that dual PPARα and...

263
267
0

Genomic organization and functional characterization of a novel cancer associated gene u0 44

Ngày tải lên : 14/09/2015, 21:59

... the structural role played by the ZP domain Owing to its transmembrane nature, ZP proteins may also serve as receptors or mechanotransducers Its is clear that ZP proteins is a large and important ... 2003) Steriodal estrogens are often referred to as human carcinogens based on the causal associations between exposure to steroidal estrogens and human cancers (Henderson et al., 1988; Preston-Martin ... Reverse Transcription-Polymerase Chain Reaction SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis xiii SIDs SRCR interspersed domains siRNAs Short Interfering RNAs SP Signal Peptide...

198
331
0

Characterization of diffusion behavior of a novel extra cellular sphingolipid associated peptide probe by fluorescence correlation spectroscopy and imaging total internal reflection fluorescence correlation spectroscopy

Ngày tải lên : 12/09/2015, 09:55

... distances of the confocal volume xiv List of Publications Sarita Hebbar, Esther Lee, Manoj Manna, Steffen Steinert, Goparaju Sravan Kumar, Markus Wenk, Thorsten Wohland and Rachel Kraut A fluorescent ... 71], and are sometimes referred to as Detergent Resistant Membrane fractions (DRMs) On sucrose density gradients, the rafts can be readily purified as DRMs by ultracentrifugation in the form of ... construction of signaling units and sorting platforms is the structural basis of rafts [1] Quantitative spectroscopic microscopy techniques such as fluorescence resonance energy transfer, fluorescence...

177
361
0

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Ngày tải lên : 18/02/2014, 16:20

... listed above the alignments Completely conserved residues are colored in red and similar residues in yellow primary sequence and crystal structures of E coli UMPK and the archaea P furiosus and S solfataricus ... N-terminus was responsible for the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that ... in archaea, and was referred to as the archaea-speciﬁc loop (Fig 1) Another difference that was detected was in the loop between a3 and a4 , which was absent in archaea, and is therefore referred...

12
656
0

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

Ngày tải lên : 21/02/2014, 03:20

... (LSR, Cambridge UK) to a monochromator (Spectramaster) and a 12/14 bit frame transfert rate digital camera (Astrocam) MERLIN software was also used to calculate the 340/380 ﬂuorescence ratio (Rf) ... xTRHR1 and xTRHR2 subtypes were ampliﬁed as described above using partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense ... cells expressing xTRHR2 and xTRHR1 cDNAs Distribution of xTRHRs The distributions of xTRHRs in the brain, liver, testis, urinary bladder, stomach, ventral and dorsal skin, lung, heart and intestine...

11
506
0

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21

... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram ... 4501 FnBPA and FnBPB from S aureus G Provenza et al (BioRad, Hercules, CA, USA) For the western blot assay, FnBRA, FnBRB and the corresponding single repeats were separated by SDS ⁄ PAGE, and then ... dihydrochloride and measuring the resulting absorbance at 490 nm in a microplate reader SPR analysis SPR analysis of NTD binding to repeats was performed with the BIAcore X100 system (GE Healthcare)...

16
560
0

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20

... (oocytes), and from various stages of embryonic and larval development (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing ... larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts were ubiquitously expressed at reasonable levels in all adult tissues, interestingly Cg-BMPR1 transcripts were always ... manner (Figs 4B and 8A) Expression of tbx6 was dramatically repressed, even if in some cases its expression at the margin of the blastoderm was expanded (Fig 9A1 ,A2 ) Expression of gsc was clearly...

17
508
0

Báo cáo khoa học: Functional ﬁne-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Ngày tải lên : 08/03/2014, 08:20

... phosphatase substrate (SIGMA 104Ò, Sigma-Aldrich, Bornem, Belgium) solution was added and the absorbance was measured after 30 and 60 at 405 nm on a SPECTRAmax PLUS384 microplate reader system ... of an individual mouse, horizontal bars represent the mean crossreactivity ± SD, anti-(diphtheria toxoid) sera was used as negative control and corresponds the net background arbitrary fluorescence ... immobilized reporter peptide was recorded by sensorgrams allowing an association time of 300 s and a dissociation of 180 s under a constant flow rate of 20 lLÆmin)1 at 25 °C The sensorgram profile of each...

13
492
0

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

Ngày tải lên : 16/03/2014, 23:20

... total surface Voltage electrodes had resistances of 0.2–0.5 MW Custommade software and hardware were used for acquisition and analysis of data Leakage and linear capacity currents were subtracted ... the surrounding capsule cells (small arrowheads) (D) b1B was present in ﬁbers (arrowheads) of the spinal nerve (E) b1B was present in cortical neurons (large arrowheads) and their processes (small ... immunolabeling was also observed in human dorsal root ganglion (DRG) (Fig 3C), in ﬁbers (arrowheads) of the spinal nerve (Fig 3D) and in cortical neurons (large arrowheads) and their processes (small...

9
415
0

Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf

Ngày tải lên : 30/03/2014, 04:20

... AspATs from A thaliana (Atasp1, Atasp3 and Atasp5) are stereospecific for l-Asp, and therefore AspATs are presumably not involved in the metabolism of d-Asp in plants A thaliana BCAT (Atbcat2 and Atbcat4) ... those used in the case of AspAT purification Kitasato University Research Grant for Researchers (M Sekine and M Katane) Enzyme assays References The standard reaction mixture (200 lL) for AspAT activity ... ATs (AspATs), branched chain amino acid ATs (BCATs) and a putative d-AAT Their substrate specificities, particularly for d-amino acids, were characterized 1192 BCATs and d-AATs of bacterial origin...

13
401
0

Báo cáo hóa học: " Dynamic behavior of a nonlinear rational difference equation and generalization" ppt

Ngày tải lên : 20/06/2014, 22:20

... generalized rational difference equations and present our conjectures for similar equations Preliminaries In this section, we introduce some basic but important preliminary lemmas and notation ... comments; The authors wish to express their deep gratitude to Professor C.Y Wang for his valuable advice and constant encouragement for this work supported in part by Natural Science Foundation for ... this paper, QX and GY corrected the main theorems XL participated in the design and coordination All authors read and approved the final manuscript Competing interests The authors declare that...

8
283
0

báo cáo hóa học:" Global existence and asymptotic behavior of smooth solutions for a bipolar Euler-Poisson system in the quarter plane" doc

Ngày tải lên : 21/06/2014, 20:20

... Global existence and asymptotic behavior of smooth solutions for a bipolar Euler–Poisson system in the quarter plane Yeping Li Department of Mathematics, Shanghai Normal University, Shanghai 200234, ... analysis As far as we know, this is the first result about the optimal convergence rates of the solutions of the bipolar Euler–Poisson system with boundary effects towards the nonlinear diffusion ... Acknowledgements The author is grateful to the anonymous referees for careful reading and valuable comments which led to an important improvement of my original manuscript The research is partially supported...

22
366
0

Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Afﬁne Projection Algorithm" docx

Ngày tải lên : 22/06/2014, 22:20

... noise signals propagate through secondary paths, which are characterized by the transfer functions sk, j (z) We assume there is no feedback between loudspeakers and reference sensors The primary ... vector and it provides diﬀerent values of the steadystate mean-square error and the mean-square deviation If the input signals are stationary and if the recursion in (15) is convergent for every ... sk, j (z) of the secondary Matrix constituted by the last L ﬁltered-x vectors uk (n) kth error signal Vector of L past errors on kth primary path Full vector of errors paths As we already observed...

15
311
0

725 internal and functional behavior of a master slave s r flip flop

725 internal and functional behavior of a master slave s r flip flop