Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin Fang Peng 1 , Xian-Chun Zeng 1 , Xiao-Hua He 1 , Jun Pu 2 , Wen-Xin Li 1 , Zhi-Hui Zhu 2 and Hui Liu 1 1 Department of Biotechnology, College of Life Sciences, Wuhan University, China; 2 Department of Cardiology, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, China From a cDNA library of Chinese scorpion Buthus martensii Karsch, full-length cDNAs of 351 nucleotides encoding precursors (named BmKIM) that contain signal peptides of 21 amino acid residues, a mature toxin of 61 residues with four disulfide bridges, and an extra Gly-Lys-Lys tail, were isolated. The genomic sequence of BmKIM was cloned and sequenced; it consisted of two exons disrupted by an intron of 1622 bp, the largest known in scorpion toxin genomes, inserted in the region encoding the signal peptide. The cDNA was expressed in Escherichia coli.Therecombinant BmKIM was toxic to both mammal and insects. This is the first report that a toxin with such high sequence homology with an insect-specific depressant toxin group exhibits toxi- city to mammals. Using whole cell patch-clamp recording, it was discovered that the recombinant BmKIM inhibited the sodium current in rat dorsal root ganglion neurons and ventricular myocytes and protected against aconitine- induced cardiac arrhythmia. Keywords: sodium current; ventricular myocyte; rat dorsal root ganglion; BmKIM; patch-clamp. Scorpion venom is a rich resource for various bioactive peptides. Accumulated data have demonstrated that scor- pion neurotoxins affect the ion permeability of excitable cells by specific interaction with Na + ,K + ,Ca 2+ or Cl – channels [1–3]. Scorpion toxins that interact with sodium channels are composed of 60–70 amino acid residues, which can be divided into a or b mammal neurotoxins and classified as excitatory or depressant insect-selective neuro- toxins according to biological specificity in vivo, pharmaco- logical and electrophysiological activity [4,5]. The a-toxins bind to mammalian Na + channels on site 3 in a voltage- dependent manner and slow their inactivation by modula- ting their voltage dependence. Unlike scorpion a-toxins, b-toxins bind in a voltage-independent manner to site 4 on the mammalian Na + channels and shift the activation voltage to more negative potentials [6,7]. Scorpion insect toxins are selectively active on lepidopterous and dipterous insects [8]. The excitatory toxins cause a fast excitatory paralysis in animals and induce repetitive firing in insect nerves; in contrast, the depressant toxins cause a slow depressor flaccidity due to depolarization of the nerve membrane and blockage of the sodium conductance in axons [9,10]. Although some toxins act specifically on mammals and insects, others additionally affect both groups and crustaceans [11–13]. Thus far, hundreds of distinct peptides specific for Na + channels have been purified from 20 to 30 different species of scorpions; at least 120 complete primary structures have been identified [14,15]. Most of the effects of these peptides have been demonstrated in nerve and skeletal muscle and with lower frequency in cardiac muscle even though the incidence of cardio-pulmonary abnormalities induced by the scorpion sting is well documented [16,17]. In fact, the concept of toxicity should include not only neurotoxins but also other toxins. The Asian scorpion Buthus martensi Karsch (BmK) is not dangerously venomous for mammals; in fact, its components have demonstrated antihyperalgesic and antiepileptic effect [18,19]. In traditional Chinese medicine, BmK has been used for its reversal effects on circulation failure. However, the cardiovascular effects of BmK venom have not been systematically studied and the mechanism underlying the alterations in cardiovascular function remains unclear [20]. In our present work, we describe the cloning of the gene sequence of BmKIM, the functional expression of the recombinant toxin in Escheri- chia coli and its effect on the sodium channels of neurons and ventricular myocytes. EXPERIMENTAL PROCEDURES Materials Buthus martensi Karsch scorpion were collected from farm areas in Hubei province in China. Sarcophaga falculata blowfly larvae, Sprague–Dawley (SD) rats, and albino Kunming mice were bred in the laboratory. E. coli strains BL21 and vector pGEX-5x-1 were used for expression. Corrspondence to W X. Li, Department of Biotechnology, College of Life Sciences, Wuhan University, Wuhan 430072, China. Fax: + 86 27 87883833, Tel.: + 86 27 87682831, E-mail: wxli@whu.edu.cn, zhrpeng@whu.edu.cn Abbreviations:IPTG,isopropylthio-b- D -galactoside; GSH, glutathi- one; GST, glutathione S-transferase; DRG, dorsal root ganglia; PVC, premature ventricular complex; VT, ventricular tachycardia; VF, ventricular fibrillation. Note: The nucleotide sequences reported in this paper have been submitted to the GenBank with accession numbers AF459791 and AF459792. (Received 6 May 2002, revised 16 July 2002, accepted 25 July 2002) Eur. J. Biochem. 269, 4468–4475 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03136.x Synthesis of oligonucleotide probe The oligonucleotide probe used to screen the venom gland cDNA library, constructed as described previously [21], was designed according to the conserved region of the amino acid sequence of insect-specific depressant toxins (G39–D49). The sequence of the probe was 5¢-GGACTTGCATGCTGGTGTGAAGGCCTTCCTG AT-3¢. The probe was 32 P-end-labelled using T4 polynucleo- tide kinase. Screening of the venom gland cDNA library Ten thousand clones from the venom gland cDNA library were analyzed by the 32 P-end-labelled oligonucleotide probe. High and low density screenings of bacterial colonies for recombinant plasmids were performed on nylon filters as described previously [22]. Amplification of genomic DNA of BmKIM The oligonucleotides used for PCR were the following: forward primer A1, 5¢-GCC GGATCCTGATTGCCTA GAAGATGA-3¢; reverse primer A2, 5¢-GCC CTCGAG TCAACCGCATGTATTACTTTCAG-3¢.Theforward and reverse primers were preceded by BamHI and XhoI sites (underlined), respectively, to allow ligation into pBluescript. PCR was used to amplify the genomic DNA encoding the conserved region of BmKIM precur- sors. The scorpion BmK genomic DNA was purified from the muscle tissue of scorpions as previously des- cribed [23] and used as the template for PCR. The product was reamplified by a second PCR reaction with a nested gene-specific primer, 5¢-GCCCTCGAGCACCG AAGCCTTTGCATTC-3¢ corresponding to the amino acid sequence K25–Y32 and the same forward primer as the first PCR. DNA sequence analysis Nucleotide sequence was determined using PE Biosystem Model 377 DNA sequence with universal T7 promoter primers according to the method of Sanger. Construction of expression vector pGEX-5x-1-BmKIM The template used for PCR was the double strand cDNA of BmKIM inserted into pSPORT I. The primers A3 were as follows: 5¢-GCC GGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corres- ponding to five codons encoding an enterokinase cleavage site and positions 64–79 of the BmKIM cDNA, i.e. NH 2 -terminal residues 1–5 of BmKIM. The reverse primer A2, that carried a XhoI restriction enzyme site and stop codon, corresponded to positions 227–246 of BmKIM cDNA. PCR was performed and the PCR product was cloned into pGEX-5X-1 after digestion with BamHIand XhoI and purification. The in-frame fusion was confirmed by the dideoxynucleotide sequencing method with univer- sal pGEX primers. E. coli BL21 was used for plasmid propagation. Cleavage of fusion protein and purification by affinity chromatography E. coli strain BL21 carrying the pGEX-BmKIM was grown at 37 °C in Luria–Bertani broth containing 50 lgÆmL )1 ampicillin. When the cell density had reached D 600 ¼ 0.6, induction was initiated by the addition of 1.0 m M isopropyl thio-b- D -galactoside (IPTG). Cells were harvested 4 h after addition of IPTG by centrifugation and resuspension in 1.0 mL water per 50 mL of culture. The supernatant from the bacterial cell lysate obtained by sonication was added to prepacked glutathione (GSH) Sepharose 4B and washed in 50 m M Tris/HCl and 10 m M EDTA buffer, adjusted to pH 8.0. After elution of the unbound proteins, the bound GSH binding protein termed fusion protein glutathione S-transferase-BmKIM (GST-BmKIM) was eluted from the GSH agarose in the same buffer containing 20 m M GSH or cleaved directly by enterokinase. The buffer 50 m M Tris/ HCl, 5 m M CaCl 2 ,40m M dithiothreitol, and 14 m M EDTA, adjusted to pH 8.0 containing enterokinase was added to the column which bind the fusion protein GST- BmKIM at 26 °C. The eluate containing enterokinase was added again to the column. The operation was repeated three times which took about 10 min. The cleavage yield was eluted from the GSH gel in the water. The recombinant toxin was then purified and desalted using Sephadex G-50 column (100 mL). Fractions were collected and analyzed by SDS/PAGE; the fractions containing the recombinant BmKIM protein were then lyophilized. Amino acid composition analysis and N-terminal sequencing Amino acid analysis was carried out essentially as described by Liu & Chang [24]. The sample was hydrolyzed by 2% (v/v) tryptamine/4 M -toluene-p-sulfonic acid at 110 °Cfor 24 h. Analysis of this preparation was completed using a 121-MB Beckman amino acid analyzer. An Applied Bio- systems 476A sequencer was used for automated Edman degradation. The phenylthiohydantoin derivatives of the amino acids were identified using an Applied Biosystems Model 120A PTH-Analyzer. Circular dichroism spectroscopy CD spectra were obtained between 250 and 180 nm on a Jasco-715 spectropolarimeter using a quartz cell of 2 mm path length with a sample concentration of 0.24 mgÆmL )1 . Spectra were measured at 2 nm intervals with a time constant of 1 s at 25 °C. Data were collected from 10 separate recordings and averaged by using a microcompu- ter. Data were expressed as the variation of molar amino acid residue absorption coefficient (De). The secondary structure content was determined according to the method of Hennessey and Johnson [25]. Toxicity tests Toxicity was tested by ventral injection of 2 lL aqueous samples into 100 ± 2 mg, 5–6 day old Sarcophaga falculata blowfly larvae and by tail vein injection of 200 lL, subcutaneous injection of 2 mL, or intracerebroventricular Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4469 injection of 2 lL aqueous samples into 20 ± 2 g albino Kunming mice. Each sample was tested in six larvae or three mice. The development of toxic effects was then monitored over the next 2 days. Similar buffers or saline were used as negative controls. The FPU 50 (flaccid paralysis unit), LD 50 (lethal dose) values were calculated according to the methodology of Behrens & Karber [26]. Preparation of adult rabbit ventricular myocyte The rabbit ventricular myocyte were prepared by an improved enzymatic dissociation method [27]. The heart were perfused through the aorta with Ca 2+ -free Tyrode’s solution at 37 °C, followed by the Ca 2+ -free Tyrode’s solution with added amounts of 0.2 m M Ca 2+ and 0.04% collagenase I over an 8-min period. After perfusion, the resected ventricles were minced into small pieces, incubated in fresh Tyrode’s solution for 5–10 min. The isolated cells were resuspended in the Tyrode’s solution containing 0.05% BSA, and the Ca 2+ concentration was gradually increased to 1.0 m M .TheCa 2+ -free Tyrode’s solution contained (m M ): NaCl 135, KCl 5.4, MgCl 2 1.0, NaH 2 PO 4 0.33, Hepes 10, glucose 10, adjusted to pH 7.25 with 1.0 M NaOH. Preparation of albino rats dorsal root ganglia neurons Dorsal root ganglia (DRG) neurons were obtained from the lumbar region of albino rats, and neurons were isolated by the method described previously [28]. Ganglia were digested with 0.2% collagenase II in a Hanks’ solution for 90 min and then 0.1% trypsin for 10 min. After the treatment with enzymes, the digested DRGs were triturated and washed with Hanks’ solution three times. After resuspension in Dulbecco’s minimum essential medium/F12 solution sup- plemented with 10% fetal bovine serum, neurons were plated on to polyornithine-coated coverslips. Isolated neu- rons were incubated in 95% air plus 5% CO 2 for 2–7 h prior to the experiment. Whole-cell patch-clamp recording The sodium current (I Na ) of single cells was recorded using the whole cell voltage clamp technique. The chamber was continuously perfused at a temperature of 15 °Cinexternal solution (m M ): (NaCl 30, choline chloride 110, KCl 5.4, CaCl 2 0.1, MgCl 2 1.0, NaH 2 PO 4 0.33, and Hepes 10 titrated to pH of 7.3 with 1 M NaOH). The solution inside the suction pipette contained (m M ): CsCl 120, CaCl 2 1.0, MgCl 2 5.0, Na 2 ATP 5.0, EGTA 11, Hepes 10, and glucose 11, titrated to pH of 7.3 with 1 m M CsOH. Using this solution allowed an effective isolation of I Na from other ionic currents. A holding potential of )80 mV was chosen. The pipette had a tip resistance of less than 1.0 M W, while the input resistance of the cells was about 1.0 GW. Membrane currents were measured with pipettes pulled from glass capillary tubes and connected to an EPC-9 amplifier operating PULSE / PULSEFIT Software (HEKA Elektronik, Germany). Aconitine-induced arrythmia model Sprague–Dawley (SD) rats, weighing 230 ± 20 g, were anesthetized with sodium pentobarbital (50 mgÆkg )1 , i.p). The experiments were carried out in accordance with the guidelines laid down by the National Institutes of Health in the USA regarding the care and use of experimental animals and committee giving approval for the experiments. The right jugular vein was cannulated for drug administration. The lead II ECG maintained continuous readings using a polygraph system. One hour after the intravenous admini- stration of BmKIM (dissolved in distilled water and administered in a volume of 0.5 mL per 250 g body wt), aconitine was infused intravenously at a dose of 4 lgÆmin )1 . The times at which PVC (premature ventricular com- plex), VT (ventricular tachycardia), and VF (ventricular fibrillation) appeared were noted and recoded; the cumu- lative aconitine dosage to induce PVC, VT, VF was calculated. Data are expressed as mean ± SEM. Differences between control and treatment groups were analyzed by Dunnett’s test, paired t-test. Difference at a P-value < 0.05 was considered to be statistically significant. RESULTS Isolation and sequencing of BmKIM cDNA The yield from the initial screening of the cDNA library with the 32 P-labeled cDNA probe was about 260 positive clones. On the final screening, 25 clones were selected on the basis of the strength of the autoradiographic signal. Restriction analysis revealed size variation of the insert between 380 and 530 bp. The seven longest inserts were subjected to sequence analysis. The nucleotide sequence obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM. The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively. A single AATAAA polyadenylation signal was found 11 nt upstream of the poly (A) tail. There was only one stop codon (TAA) at the 3¢ terminus of the ORF. The cDNA sequence has been submitted to GenBank under accession number AF45972. A search for deduced amino acid sequence homology revealed that the precursor of BmKIM showed 89, 82, 82, 79, 75, and 69% sequence identity with that of BmKAEP [29], BaIT 2 [30], LqqIT 2 [31], LqhIT 2 [32], BmKIT 2 [33], and BjIT 2 [34], respectively (BmKAEP and BmKIT 2 are derived from Buthus martensii Karsch; BaIT 2 from Buthacus arenicola; LqqIT 2 from Leiurus quinquestriatus quinquestri- atus; LqhIT 2 from Leiurus quinquestriatus hebraeus;BjIT 2 from Buthotus judaicus). This suggested that the signal peptide cleavage occurred at the nucleotide 1702. Moreover, the mature toxin should be composed of 61 amino acid residues, which would be expected to lose three carboxy- terminal amino acids (Gly-Lys-Lys) during post-transla- tional processing according to a variety of rules applicable to processing of neuroactive peptides [35]. BmKIM dis- played high sequence homology with depressant insect- selective toxins (BmKAEP, BaIT 2 , LqqIT 2 , LqhIT 2 , BmKIT 2 and BjIT 2 ). However, in comparison with these toxins, BmKIM was not homologous at several positions: Ile12, Trp16, Gly27, Phe28, and Tyr31; all other group toxins contain Ser at position 31. Both this group and most sodium-channel-binding scorpion toxin peptides have a conserved Ser (or Ala or Asp) residue before the fifth Cys residue, i.e. a small molecular residue rather than an aromatic residue, such as Tyr. Also interesting is the fact that Gly6 and Ser57 are highly conserved in depressant 4470 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 insect-select toxins from BmK (BmKIM, BmKAEP and BmKIT 2 ), but Arg6 or Lys6 and Thr57 are conserved in other scorpion species. Cloning and analysis of genomic sequence of BmKIM We have isolated, cloned and sequenced the genomic regions encoding BmKIM toxin. The genomic amplification of BmKIM by nested PCR yielded a major band of about 1900 bp. The sequence has been submitted to GenBank under accession number AF45971. Sequence analysis of this fragment confirmed that the genomic gene of BmKIM consisted of two exons disrupted by an intron of 1622 bp. This intron is in the sequence encoding the signal peptide, after the first base (G) of an Asp codon at position 63, beginning with GT and ending with AG, consistent with previously reported intron junctions. The sequence of the 5¢ splice donor was 5¢-G/gtaag and that of the 3¢ splice acceptor was 5¢-ag/C; these sequences are consistent with the consensus found in other scorpion toxins [14]. Using A3 and A2. corresponding to the mature toxin region as primers, and the BmKIM genomic DNA as template for PCR, the nucleotide sequence obtained was the same as the cDNA. Therefore, there is only one intron in the sequence encoding the signal peptide. The position and structure of BmKIM intron are quite similar to that of other scorpion sodium toxins, but so far it is the longest among known scorpion toxin introns. Construction of expression vectors and expression of the fusion proteins The cDNA encoding BmKIM was amplified by PCR with forward and reverse primers. The noncoding regions, the signal peptide and the three carboxy-terminal residues (Gly- Lys-Lys) of the toxin were removed from the cDNA and specific restriction enzyme sites were added to facilitate insertion into the pGEX-5X-1 expression vector, such that a gene fusion (GST-BmKIM) could be constructed. In the construction, five codons encoding an enterokinase cleavage site (encoding DDDDK) were added at the BmKIM restriction site 5¢ to the factor Xa sequence such that the linkage between GST and BmKIM in the fusion was IEGRGIPDDDDK. These constructs were used to trans- form E.coli and were expressed upon IPTG induction. Optimal expression was achieved after 3 h of induction with 1.0 m M IPTG at 28 °C, adjusted to pH 8.0 with 10 M NaOH, which formed the GST derivatives as a soluble protein but not inclusion bodies. Periplasmic extracts (before and after induction) of the transformants were subjected to SDS/PAGE (Fig. 1). GST-BmKIM was then purified from these extracts on an GSH affinity column as exhibited in Fig. 1; intense bands corresponding to the molecular masses of the expected proteins were obtained: 26 kDa for GST and 33 kDa for GST-BmKIM. The yields of affinity-purified proteins were 10 mgÆL )1 of culture, estimated by Bradford means [36]. Enzymatic cleavage of fusion protein and purification of the recombinant BmKIM The fusion protein was cleaved completely with an entero- kinase/substrate ratio of 50% at 26 °C for 10 min on the GSH gel (Fig. 1). The recombinant BmKIM (rBmKIM) was eluted from the GSH gel, purified and desalted using Sephadex G-50 column (100 mL). The purified rBmKIM migrated as a 6.7 kDa protein in a SDS/PAGE (Fig. 1). The final yield of recombinant BmKIM was approximately 1–2 mgÆL )1 of culture. The amino acid composition of rBmKIM and the N-terminal sequence obtained from sequencing DGYIRGSNGC were identical with the pre- dicted protein. This clearly indicated that the expressed rBmKIM fused with GST protein was processed correctly by the enterokinase. Circular dichroism spectrum The CD spectrum of rBmKIM between 180 and 250 nm was similar to those of other scorpion toxins (AaHIT2 [37], CssII [38]; AaHIT2 is anti-insect toxin purified from the venom of the Scorpion Androctonus australis Hector; CssII, b-type antimammal toxin from Centruroides suffuses suffu- ses). They were characterized by minima at 207 nm and by a maximum at 190 nm. The negative band at 207 nm had a lower intensity in the case of rBmKIM in comparison with that in the spectra of AaHIT2 (a-toxin) and CssII (b-toxin). Moreover, a weak negative band at 227 nm, present in the CD spectrum of rBmKIM, was not observed in the CD spectra of AaHIT2 or CssII; this could be related to n À p* transition characteristic of b-turn structures(Fig. 2). By use of CD data, the secondary structure content of rBmKIM (Table 1) was calculated according to the method of Hennessey & Johnson [25]. The sum of all the secondary structures obtained by CD analysis fell between 0.90 and 1.10, and the values for contents in secondary structures were either positive or never below )0.05 (Table 1). As shown in Table 1, the CD data analysis of BmKIM was Fig. 1. Expression and cleavage of gene GST-BmKIM fusion protein. GST-BmKIM was expressed in E.coli BL21 by IPTG induction. The fusion protein was purified with GSH agarose system and G-50 col- umn chromatography. BmKIM was liberated from the fusion protein by enterokinase. Coomassie-strained gel of Laemmli 15% poly- acrylamide gel of uninduced cell-free extract of E.coli carrying pGEX- 5x-1-BmKIM (lane 1); total cell-free extract induced with IPTG for 3 h (lane 2); molecular mass markers indicated at 31, 20, 16, 14, 6.3 and 3.5 kDa (lane 3); purified fusion protein by GSH agarose system (lane 4); purified GST (26 kDa) by GSH agarose system (lane 5); cleavaged fusion protein by enterokinase (lane 6); and purified recombinant BmKIM (lane 7). Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4471 compared to the CD data analyses of other scorpion toxins and displayed the similar secondary structure. Therefore, the rBmKIM was a correctly refolded recombinant toxin. Effect of rBmKIM on sodium currents in DRG neurons and ventricular myocytes The membrane potential of DRG neurons and ventricular myocytes was held at )80 mV, close to the resting membrane potential. Whole cell path-clamp recording revealed that rBmKIM could inhibit the total sodium currents both in DRG neurons and ventricular myocyte (Fig. 3A). The effect of BmKIM on current–voltage (I–V) relationship was examined between )70 and +30 mV in 10 mV steps. As shown in Fig. 3B, there was no shift of either the threshold, peak or equilibrium potential of I Na under control conditions, in the presence of rBmKIM. This was identical with the predicted function (a depressant toxins, which inhibited the sodium current) based on its high sequence homology with depressant toxins. Moreover, the effect on DRG neurons and ventricular myocyte were both dose-dependent. At higher concentration, rBmKIM inhi- bited the sodium currents completely, at low concentration, just half or less. The relative changes in the peak I Na were plotted as a function of toxin concentration (Fig. 4). The continuous line was drawn according to the equation: the percentage decrease in I Na ¼ (IC 50 /[C] + 1) )1 where [C] is the toxin concentration, and IC 50 is the dose for 50% block. As shown in Fig. 4, there was difference in the effect of rBmKIM on the DRG neurons and ventricular myocyte. The response of DRG neurons to rBmKIM (IC ¼ 0.498 l M ) was shifted to a substantially lower concentration than the response of ventricular myocytes to rBmKIM Table 1. Secondary structure analyses. H, a-helix; A, antiparallel b-sheet;P,parallelb-sheet; T, b-turn; O, other structures. tot, total. The secondary structures from analysis by the method of Hennessey and Johnson [25]. Protein H A P T O tot AaHIT2 0.24 0.34 )0.02 0.25 0.29 1.10 CssII 0.16 0.35 )0.01 0.26 0.24 1.01 BmKIM 0.18 0.30 0 0.28 0.22 0.98 Fig. 2. Circular dichroism spectra of AaHIT2, CssII and BmKIM from 180 to 250 nm De corresponds to the variation of molar amino acid residue absorption coefficient expressed in M )1 Æcm )1 . Fig. 3. The inhibitory effects of BmKIM on cardiac peak sodium currents (I Na ). (A) Effect of BmKIM under whole cell patch-clamp recording. Control of sodium currents recor- ded by stepping up the membrane from )80 to +30 mv in 10 mV increments from the hold- ing potential of )80 mv on ventricular myo- cyte and DRG neuron. A decrease in the peak sodium currents is caused by BmKIM. (B) Relationship of voltage and sodium cur- rents in the presence and absence of BmKIM. 4472 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 (IC ¼ 3.662 l M ). This suggested rBmKIM interacts with DRG neuron sodium channels with higher affinity than the ventricular myocyte sodium channels. Unlike Ts À c and CnII-10 (Ts À c is from Brazilian scorpion Tityus serrula- tus; CnII-10 is from Mexican scorpion Centruroides noxius), they are equally potent for cardiac and neuronal Na + channels [39]. Pharmacological activity of recombinant BmKIM Injected into larvae, rBmKIM caused a slow, progressive depressant flaccid paralysis. The FPU 50 was 2.4 lgper 100 mg. The toxic effect on mice was not achieved by subcutaneous or intracerebroventricular injection, but only by intravenous injection of purified rBmKIM. The LD 50 was about 0.8 mgÆkg )1 . These data indicated that rBmKIM had toxicity to both mammals and insects, though the toxicity was at a lower level. Assay of antiarrhythmia activity Table 2 illustrates the effects of rBmKIM on aconitine- induced arrhythmias. Using the model of aconitine-induced arrhymia in rats and compared with distilled water, pretreatment of rBmKIM at 50 lgÆkg )1 significantly increased the dosage of aconitine required to induced PVC, VT, and VF. To some extent, these results indicated that rBmKIM produced antiarrhythmia activity in rat. DISCUSSION Toxicity tests in vivo showed that the recombinant toxin had toxic effect not only on insects but also on mammals, though the gene of the toxin displayed high sequence homology with that of insect-specific depressant toxins. This is first report of such insect-specific toxin had toxic effect on mammals. Because the toxic effect on the mice was not found for subcutaneous and intracerebroventricular injec- tion but only for intravenous injection, it is possible that the toxic effect of rBmKIM on mammals is relation to the cardio toxicity. In fact, various scorpion venoms have been known to have direct myocardial action and manifest with cardio- pulmonary abnormalities including cardiac arrhythmias, arteria hypertension, pulmonary edema and circulatory failure[16].BmKscorpionvenomhasbeenusedin traditional Chinese medicine for its reversal effect on circulation failure. However, the cardiovascular effects of BmK venom have not been systematically studied and a regimen for effective treatments has not been established. The mechanisms underlying these alterations in cardiovas- cular function remain unclear. It has been suggested that the cardiovascular effects of scorpion venom are dependent upon the venom stimulation of the sympathetic and parasympathetic nervous system [40]. Recently, an increas- ing number of studies suggest that several scorpion venoms and some of their purified toxins could directly affect the functional status of cardiac myocytes [41,42]. Using whole cell patch-clamp recording, it was determined that BmKIM inhibited total sodium currents of ventricular myocyte and protected against aconitine-induced cardiac arrhythmias. Although the rBmKIM also produced effects on DRG neurons, the BmKIT 2 (75% sequence identity with BmKIM) has the same effects on DRG neurons [43] but has no toxicity to mammals. It suggested that the effect on DRG neurons wasn’t sufficient to kill mice, and the ventricular myocyte may be the direct target of the rBmKIM by intravenous injection. Knowing that rBmKIM can affect sodium channels of DRG neurons and that ventricular myocytes possess different affinity and induce different functions provides valuable information for the study of nerve and cardiac Na + channels. No doubt, functional expression of BmKIM would make it possible to further study the biological mechanisms of cardiovascular effects and its structure. BmKIM displayed high sequence homology with that of depressant insect-selective group. It would be of interest to determine the rationale for the toxicity of BmKIM in mammals, when other members of the depressant insect- selective group do not possess this trait. Comparing amino acid sequences, Tyr31 may be important because it was Ser is usually found at this position in most of the sequences of the depressant insect-selective group. In fact, Ser31 was very conserved in most Na + channel-specific scorpion toxin peptides. It was located at the third or fourth position before the fifth Cys. Sometimes, Ser31 is substituted by small residues such as A (Ala) or D (Asp). Only AaHIT 4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position. AaHIT 4 ,the unique anti-insect toxin also has a toxic effect on mammals and can acts on the a-andb-sites of the mammalian sodium channel [44]. Therefore, whether Tyr31 is related Table 2. The amounts of aconitine required to induce arrhythmia in untreated rats and rats given 50 lgÆkg )1 of BmKIM. *P <0.05vs. control. Dose of aconitine to produce l )1 gkg )1 Drug PVC VT VF Control 38 ± 467± 590± 10 BmKIM 75 ± 5* 100 ± 8* 148 ± 14* Fig. 4. Concentration–response curve of BmKIM for peak Na current (I Na ) at a holding potential of )80mv. The line is a fit of the function (IC 50 /[C] + 1) )1 ,withIC 50 ¼ 4.25 · 10 )6 M . Points represent mean value for six cells. Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4473 to the recognition of different sodium channel needs to be determined. Scorpion toxic peptides have a highly conserved, dense core formed by an a-helix and two to three strands of b-sheet structural motifs, maintained by disulfide bridges [11]. Therefore, their species specificity is probably mediated by rather subtle changes in amino acid residues in selected positions of the primary structure. It has been suggested that the net charge of the toxins is important to define the degree of toxicity of the peptides. Apparently, the positively charged toxins have lower LD 50 values, in other words, are more toxic [45]. The aromatic residues may play a major role in toxin-channel recognition because they not only affect the binding to Na + channels but also alter the conformation of the receptor by the p electron cloud. So, aromatic resides might be related to affecting different Na + channel, and the residues with positive charged might be related to the efficiency. This was supported by modification of the LqhaIT, whose mutations at three sites, Tyr49-Ile, Ala50-Lys and Asn54-Lys, resulted in a marked decrease in antimammalian toxicity (6.4-fold) but little change in its biological activity against insects [46]. We assume that Tyr31 may determine whether BmKIM acts specifically towards mammals or arthropods. Additionally, BmKIM does not have a strong positive potential, which accounts for its low toxicity to both mammals and insects. Further modifications of residues that belong to the aromatic cluster and positive charges may be useful for final determination of the toxic site and for clarification of the molecular basis for the wide toxic range of BmKIM. ACKNOWLEDGEMENTS We thank Wang Teng and Dr Wang Xi for providing the coordinates for the electrophysiology of BmKIM; Prof Ma Hui-wen for his kindness in offering us the plasmid pGEX and GST Gel. Professor Yi Qing-min for uses his lyophile apparatus and his helpful discussions. This work was sponsored by the National Natural Science Foundation of China (No. 39970897). REFERENCES 1. Catterall, W.A. (1980) Neurotoxins that act on voltage sensitive sodium channel in excitable membranes. Annu. Rev. Pharmacol. Toxicol. 20, 15–43. 2. Catterall, W.A. (1988) Structure and function of voltage-sensitive ion channels. Science 242, 50–61. 3. Martin-Euclaire, M.F. & Couraud, F. (1995) Scorpion neuro- toxins: effects and mechanisms. In Handbook of Neurotoxicity (Chang, L.W. & Dyer, R., eds), pp. 683–716. Marcel Decker Press, New York. 4. Gordon, D., Savarin, P., Gurevitz, M. & Zinn-Justin, S. (1998) Functional anatomy of scorpion toxins affecting sodium channels. J. Toxicol. Toxin Rev. 17, 131–159. 5. Gordon, D. (1997) Sodium channels as targets for neurotoxins. In Toxins and Signal Transduction (Gutman,Y.&Lazarowici,P., eds), pp. 119–149. Harwood Academic Publishers, the Nether- lands. 6. Couraud, F., Jover, E. & Dubois, J.M. (1982) Two types of scorpion toxin receptor sites, one related to the activation, the other to the inactivation of the action potential sodium channel. Toxicon 20, 9–16. 7. Stickhartz, G., Rando, T. & Wang, G.K. (1987) An integrated view of the molecular toxinology of sodium channel gating in excitable cells. Annu. Rev. Neurosici. 10, 237–267. 8. Xiong, Y.M., Ling, M.H. & Chi, C.W. (1999) The cDNA sequence of an excitatory insect selective neurotoxin from the scorpion Buthus martensi Karsch. Toxicon 37, 335–341. 9. Pelhate, M. & Zlotkin, E. (1982) Actions of insect toxins and other toxins derivated from the venom of the Scorpion Androctonus australis on isolated giant axons of the cockroach (Periplameta americana). J. Exp. Biol. 97, 67–77. 10. Zlotkin, E., Kadouri, D. & Gordon, D. (1985) An excitatory and a depressant insect toxin from scorpion venom both affect sodium conductance and possess a common binding site. Arch. Biochem. Biophys. 240, 877–887. 11. Possani, L.D. (1984) Structure of scorpion toxins. In Handbook of Natural Toxins (Tu, A.T., ed.), pp. 513–550. Marcel Decker Press, New York. 12. Loret, E.P., Martin-Eauclaire, M.F., Mansuelle, P. & Sampieri, F. (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian sodium channel: sequence and circular dichroism study. Biochemistry 30, 633–640. 13. Lebreton, F., Delepierre, M., Ramirez, A.N., Balderas, C. & Possani, L.D. (1994) Primary and NMR three-dimensional struc- ture determination of a novel crustacean toxin from the scorpion Centruroides limpidus Karsch. Biochemistry 149, 135–146. 14. Possani, L.D., Becerril, B., Delepierre, M. & Tytgat, J. (1999) Scorpion toxins specific for Na + -channels. Eur. J. Biochem. 264, 287–300. 15. Possanin,L.D.,Merino,E.,Corona,M.,Bolivar,F.&Becerril,B. (2000) Peptides and genes coding for scorpion toxins that affect ion-channels. Biochimie 82, 861–868. 16. Ismal, M. (1995) The scorpion envenoming syndrome. Toxicon 33, 825–858. 17. Tarasiuk, A., Khvatskin, S. & Sofer, S. (1998) Effects of antivenom serotherapy on Hemodynamic Pathophysiology in Dogs injected with L. quinquestriatus scorpion venom. Toxicon 36, 963–971. 18. Wang, C.Y., Tan, Z.Y. & Ji, Y.H. (2000) Antihyperalgesia effect of BmKIT2, a depressant insect-selective scorpion toxin in rat by peripheral administration. Brain Res. Bull. 53, 335–338. 19. Zhou, X.H., Yang, D., Zhang, J.H., Liu, C.M. & Lei, K.J. (1989) Purification and N-terminal partial sequence of anti-epilepsy peptide from venom of the scorpion Buthus martensi Karsch. Biochem. J. 257, 509–517. 20. Wang, R., Moreau, P. & Deschamps, A. (1994) Cardiovascular effects of Buthus Martensii Karsch Scorpion venom. Toxicon 32, 191–200. 21. Zeng, X.C., Li, W.X. & Zhu, S.Y. (2000) Cloning and char- acterization of the cDNA sequences of venom peptides from Chinese scorpion Buthus martensii Karsch. Toxicon 38, 893–899. 22. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecullar Choning: a Laboratory Manual, 2nd edn. Cold Spring Harbor- Laboratory, Cold Spring Harbor, NY. 23. Gendeh, G.S., Chung, M.C. & Jeyaseelan, K. (1997) Genomic structure of a potassium channel toxin from Heteractis magnifica. FEB Lett. 418, 183–188. 24. Liu, Y.Y. & Chang, Y.H. (1971) Hydrolysis of proteins with p-toluenesulfonic acid determination of tryptophan. J. Biol. Chem. 246, 2842–8848. 25. Hennessey, J.P. & Johnson, W.C. (1981) Information content in the circular dichroism of protein. Biochemistry 20, 1085–1094. 26. Behrens, B. & Karber, C. (1935) Wie sind Reihenversuche fur biologische Auswertungen amzweckmabigsten anzuorden. Arch. Exp. Pathol. Phanmakol. 177, 379–388. 27. Mitra, T. & Morad, M. (1985) A uniform enzymatic method for dissociate of myocytes from hearts and stomachs in vertebrates. Am. J. Phsiol. 249, H1056. 28. Sango, K., Horie, H., Takano, M., Inoue, S. & Takenaka, T. (1994) Diabetes-induced reduction of neuronal survival in hypo- tonic environments in culture. Brain Res. Bull. 4, 364–368. 4474 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 29.Wang,C.G.,He,X.L.,Shao,F.,Liu,W.,Ling,M.H.,Wang, D.C. & Chi, C.W. (2001) Molecular characterization of an anti- epilepsy peptide from the scorpion Buthus martensi Karsch. Eur. J. Biochem. 268, 2480–2485. 30. Cestele, S., Kopeyan, C., Oughideni, R., Mansuelle, P., Granier, C. & Rochat, H. (1997) Biochemical and pharmacological char- acterization of a depressant insect toxin from the venom of the scorpion Buthacus arenicola. Eur. J. Biochem. 243, 93–99. 31. Kopeyan, C., Mansuelle, P., Sampieri, F., Brando, T., Bahraoui, E.M., Rochat, H. & Granier, C. (1990) Primary structure of scorpion anti-insect toxins isolated from the venom of Leiurus quinquestriatus quinquestriatus. FEBS Lett. 261, 423–426. 32. Zilberberg, N., Zlotkin, E. & Gurevitz, M. (1992) Molecular analysis of cDNA and the transcript encoding the depressant insect selective neurotoxin of the scorpion Leiurus quinquestriatus hebraeus. Insect Biochem. Mol Biol. 22, 199–203. 33. Ji, Y.H., Terakawa, S. & Xu, K. (1994) Primary structure of depressant insect-selective neurotoxin from venom of scorpion Buthus martensi Karsch. Chinese Sci. Bull. 39, 945–949. 34. Zilberberg, N., Zlotkin, E. & Gurevitz, M. (1991) The cDNA sequence of a depressant insect selective neurotoxin from the scorpion Buthotus judaicus. Toxicon 29, 115–1158. 35. Mains, R.E., Dickerson, I.M., May, V., Stoffers, D.A., Perkins, S.N.,Ouagik,L.,Husten,E.J.&Eiper,B.A.(1990)Cellularand molecular aspects of peptide hormone biosynthesis. In Frontiers in Neuroendocrinology (Martini, L. & Ganong, M.F., eds), pp. 52–59. Raven Press, New York. 36. Bradfond, M.M. (1976) A rapid sensitive method for the quanti- tation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 37. Loret, E.P., Mansuelle, P. & Rochat, H. (1990) Neurotoxins Active on insects: amine acid sequences, chemical modification, and secondary structure estimation by circular dichroism of toxins from the scorpion Androctonus australis Hector. Biochemistry 29, 1492–1501. 38. Martin-Eauclaire, M.F., Garcia, Y., Perez, L.G., Ayeb, M., Kopeyan, C., Bechis, G., Jover, E. & Rochat, H. (1987) Puri- fication and chemical and biological characterizations of seven toxins from the Mexican scorpion, Centruroides suffuses suffuses. J. Biol. Chem. 262, 4452–4459. 39.Yatani,A.,Kirsch,G.E.,Possani,L.D.&Brown,A.M. (1988) Effects of New world scorpion toxins on single-channel and whole cell cardiac sodium currents. Am.J.Physiol.254, H443–H451. 40. Kumar, E.B., Soomro, R.S. & Hamdani (1991) Scorpion venom cardiomyopathy. Am. Heart J. 123, 725–729. 41. Silveira, N.P., Moraes-Santos, T., Azevedo, A.D. & Freire-maia, L. (1991) Effects of Tityus serrulatus scorpion venom and one of its purified toxin on isolated guinea-pig heart. Comp. Biochem. Physiol. 98c, 329–336. 42. Teixeira, A.L., Fontoura, B.F., Freyve-Maia, L., Machado, C.R., Camargos, E.R. & Teixeira, M.M. (2001) Evidence for a direct action of Tityus serrulatus scorpion venom on the cardiac muscle. Toxicon 39, 703–709. 43. Li, Y.J., Tan, Z.Y. & Ji, Y.H. (2000) The binding of BmKIT2, a depressant insect-selective scorpion toxin on mammal and insect sodium channels. Neuroscience Res. 38, 257–264. 44. Loret, E.P., Martin-Eauclaire, M.F., Mansuelle, P., Sampieri, F. & Granier, C. (1991) An anti-insect toxin purified from the scor- pion Androctonus australis Hector also acts on the a-andb-sites of the mammalian sodium channel: sequence and circular dichroism study. Biochemistry 30, 633–640. 45. Becerril, B., Corna, M., Coronas, F.I., Zamudio, F. & Possani, L.D. (1996) Toxic peptides and genes encoding toxin c of the Brazilian scorpions Tityus bahiensis and Tityus stigmurus. Bio- chem. J. 313, 753–760. 56. Zilberberg,N.,Gordon,D.,Pelhate,M.,Adams,M.E.,Norris, T.M. & Zlotkin, E. (1996) Function expression and genetic alteration of an alpha scorpion neurotoxin. Biochemistry 35, 10215–10222. Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4475 . Sampieri, F. (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian sodium channel: sequence and circular dichroism study mammals and can acts on the a- andb-sites of the mammalian sodium channel [44]. Therefore, whether Tyr31 is related Table 2. The amounts of aconitine required to induce arrhythmia in untreated rats. Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin Fang Peng 1 , Xian-Chun Zeng 1 , Xiao-Hua He 1 , Jun Pu 2 ,