Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Eur J Biochem 270, 950–961 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03458.x Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II ´ ` Marie-Ange Krzewinski-Recchi1, Sylvain Julien1, Sylvie Juliant2, Melanie Teintenier-Lelievre1, ´ ´ Benedicte Samyn-Petit1, Maria-Dolores Montiel1, Anne-Marie Mir1, Martine Cerutti2, Anne Harduin-Lepers1 and Philippe Delannoy1 Unite´ de Glycobiologie Structurale et Fonctionnelle, UMR CNRS – USTL 8576, Universite´ des Sciences et Technologies de Lille, F-59655 Villeneuve d’Ascq, France; 2Station de Recherche de Pathologie Compare´e, UMR CNRS – INRA 5087, F-30380 Saint Christol-lez-Ale`s, France analysis of the human and mouse genome sequence databases using the sequence of the human CMP-sialic acid:b-galactoside a-2,6-sialyltransferase cDNA (hST6Gal I, EC2.4.99.1) as a probe allowed us to identify a putative sialyltransferase gene on chromosome The sequence of the corresponding cDNA was also found as an expressed sequence tag of human brain This gene contained a 1590 bp open reading frame divided in five exons and the deduced amino-acid sequence didn’t correspond to any sialyltransferase already known in other species Multiple sequence alignment and subsequent phylogenic analysis showed that this new enzyme belonged to the ST6Gal subfamily and shared 48% identity with hST6Gal-I Consequently, we named this new sialyltransferase ST6Gal II A construction in pFlag vector transfected in BLAST Sialylated sugar chains are present at the cell surface of various animal species Due to their position, they are thought to serve important roles in a large variety of biological functions such as cell–cell and cell–substrate interactions, bacterial and virus adhesion, and protein targeting [1,2] Sialylated glycoconjugates exhibit remarkably diverse structures [3–5] and their expression has been shown to change during development [6], differentiation, disease and oncogenic transformation [7] In mammals, sialic acids are found at the nonreducing terminal position of glycoconjugates sugar chains, a2,3- or a2,6-linked to a ´ Correspondence to M.-A Krzewinski-Recchi, Unite de Glycobiologie Structurale et Fonctionnelle, UMR CNRS no 8576, Laboratoire de ´ Chimie Biologique, Universite des Sciences et Technologies de Lille, F-59655 Villeneuve d’Ascq, France Fax: + 33 320 43 65 55, Tel.: + 33 320 43 69 23, E-mail: Marie-Ange.Recchi@univ-lille1.fr Abbreviations: EST, expressed sequence tag; Gal, b-D-galactopyranosyl residue; GalNAc, b-D-N-acetylgalactosaminyl; N-CAM, neural cell adhesion molecule; EGT, ecdysone-S-glycosyltransferase Enzyme: CMP-sialic acid:b-galactoside a-2,6-sialyltransferase cDNA (hST6Gal I, EC2.4.99.1) Note: nucleotide sequence data are available in the DDBJ/EMBL/ GenBank databases under the accession number AJ512141 (Received November 2002, revised January 2003, accepted 10 January 2003) COS-7 cells gave raise to a soluble active form of ST6Gal II Enzymatic assays indicate that the best acceptor substrate of ST6Gal II was the free disaccharide Galb1–4GlcNAc structure whereas ST6Gal I preferred Galb1–4GlcNAc-R disaccharide sequence linked to a protein The a2,6-linkage was confirmed by the increase of Sambucus nigra agglutininlectin binding to the cell surface of CHO transfected with the cDNA encoding ST6Gal II and by specific sialidases treatment In addition, the ST6Gal II gene showed a very tissue specific pattern of expression because it was found essentially in brain whereas ST6Gal I gene is ubiquitously expressed Keywords: human; b-galactoside a2,6-sialyltransferase; molecular cloning b-D-galactopyranosyl (Gal) residue, or a2,6-linked to a b-D-N-acetylgalactosaminyl (GalNAc) or a b-D-N-acetylglucosaminyl (GlcNAc) residue Sialic acids are also found a2,8-linked to sialic acid residues in gangliosides and in polysialic acid, a linear a2,8-homopolymer observed on several glycoproteins including the neural cell adhesion molecule N-CAM [8] In addition, a2,6-linked sialic acid is also present in free oligosaccharides such as 6¢-sialyllactose from human milk [9], monosialylganglioside of the human meconium [10]; Neu5Aca2–6GalNAcb1–4GlcNAc-R sequence has been described as a terminal sequence of the N-glycans of pituitary hormones [11] The biosynthesis of sialylated oligosaccharides is catalysed by a family of enzymes named sialyltransferases [3,12] These enzymes are a subset of the glycosyltransferases family (family 29 in the CAZy database [13]) that use CMPNeu5Ac as the activated sugar donor to catalyse the transfer of sialic acid residues to the terminal position of oligosaccharide chains of glycolipids and glycoproteins Sialyltransferases are a family of type II membrane-bound glycoproteins with a short NH2-terminal cytoplasmic tail, a 16–20 amino acid signal anchor domain that is involved with retention of the protein in the Golgi apparatus, a stem region, highly variable in length (from 20 amino acids to 200 amino acids), ending with a large COOH-terminal catalytic domain that resides in the Golgi lumen [14] The catalytic domain contains three highly conserved amino-acid sequences termed sialylmotifs L (large), S (small), and VS (very small) Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 951 Sialylmotifs L and S are involved in the binding of donor and acceptor substrates, respectively [15,16], whereas the sialylmotif VS is involved in the catalytic process [17] To date, 19 different sialyltransferases have been identified in mouse and humans but only one of these enzymes, ST6Gal I (CMP-sialic acid:b-galactoside a2,6-sialyltransferase, EC 2.4.99.1) is known to mediate the transfer of a sialic acid residue in a2,6-linkage to the galactose residue of the type disaccharide (Galb1–4GlcNAc) found as a free disaccharide or as a terminal N-acetyllactosamine unit of N- and O-glycans However, as reviewed previously [3], ST6Gal I has been shown in in vitro assays to have a low activity for transferring sialic acid onto other oligosaccharide structures, such as lactose (Galb1–4Glc), type disaccharide structure (Galb1–3GlcNAc) [18] or type structure GalNAcb1–4GlcNAc [19,20] but not onto type structure (Galb1–3GalNAc) ST6Gal I has been purified to homogeneity from animal livers and hepatoma cells (reviewed in [3]) and cDNA has been cloned from rat liver [21], human placenta [22], mouse liver [23], bovine tissues [20] and chick embryo [24] Several mRNA isoforms are generated from a unique gene encoding ST6Gal I through the use of physically distinct promoters These transcripts differ only in their 5¢-untranslated region and share an identical ST6Gal I coding region These transcripts are expressed in a tissue-specific manner and contribute to the regulation of a2,6-sialylation in tissue and cells during cell differentiation [25,26], inflammation [27] and oncogenic transformation [28,29] BLAST analysis of the mouse and human genome databases allowed us to identify an unknown sialyltransferase gene encoding a second Galb1–4GlcNAc a2,6sialyltranferase that has been named hST6Gal II In this report, we describe the functional analysis of a recombinant human ST6Gal II, which shows slightly different substrate specificity than ST6Gal I The expression pattern of the gene was also examined in various human tissues and found to be very restricted, mainly to brain and fetal tissues Materials and methods Materials CMP-[14C]Neu5Ac (10.7 GBqỈmmol)1), Redivue stabilized [a-32P]dCTP (110 TBqỈmmol)1) and Rediprime II DNA labelling system were from Amersham Pharmacia Biotech (Little Chalfont, UK) The DyNazyme EXT DNA polymerase was from Ozyme (Saint Quentin en Yvelines, France) Oligonucleotides were synthesized by Eurogentec (Seraing, Belgium) Dulbecco’s modified Eagle’s medium (DMEM) containing 4.5 gỈL)1 glucose and lacking glutamine was from BioWhittaker Europe Alpha Eagle’s minimal essential medium (aMEM), OPTIMEM, L-glutamine and antibiotics used in cell culture were from Gibco BRL (Cergy-Pontoise, France) Fetal bovine serum was from D Dustscher (Issy-les-Moulineaux, France) LipofectAMINE PLUS Reagent was from Invitrogen The blocking reagent and fluorescein labelled anti-digoxigenin Fab fragments and DOTAP transfection reagent were from Roche (Meylan, France) a1-Acid glycoprotein, fetuin, Gala-O-pNp, GalNAca-O-pNp, GlcNAca-O-pNp, Galb1–3GalNAca-O-benzyl, Galb1–3GlcNAc, Galb1– 4GlcNAc, the expression vector pFlag-CMV-1, the monoclonal antibody (mAb) anti-Flag BioM2, alkaline phosphatase conjugated goat anti-[mouse IgG (Fab specific)] Ig and CMP-Agarose beads were from Sigma (St Louis, MO, USA) Lacto-N-neotetraose and Lacto-N-tetraose were the generous gift of G Strecker and F Chirat (UMR CNRS 8576, Villeneuve d’Ascq, France) Galb1–3GlcNAcb-Ooctyl and Galb1–4GlcNAcb-O-octyl were the generous gift ´ of C Auge (URA CNRS 462, Orsay, France) MTNTM multiple tissue Northern blot and MTETM multiple tissue expression arrays were from Clontech (Palo Alto, CA, USA) Sialic Acid Linkage Analysis Kit was from Glyko Inc (Novato, CA, USA) The expressed sequence tag (EST) clone (GenBank/EBI accession number AB058780) was a generous gift from T Nagase, KAZUSA DNA Research Institute, Chiba, Japan Preparation of asialo-glycoproteins Fetuin and a1-acid glycoprotein (10 mgỈmL)1) were incubated for h in 0.05 M sulfuric acid at 80 °C The asialoproducts were then neutralized, dialyzed and lyophilized prior to use The carbohydrate content of asialo-glycoproteins was analysed by GC-MS [30] Construction of expression vectors of hST6Gal II and transfections A truncated form of hST6Gal II lacking the first 33 amino acids of the open reading frame, was generated by PCR amplification using a 5¢ primer containing an EcoRI site, 5¢-CCGACAGGAATTCCGCTGAGCCTGTACCCAGC TCCC-3¢ (nucleotides 91–127, Fig 1A) and 3¢ primer containing a BamHI site, 5¢-ACATTGGATCCCAAG AAACCCTTTTTAAGAGTGTGG-3¢ (nucleotides 1577– 1614, Fig 1A) A full-length open reading frame of ST6Gal II was also prepared by PCR amplification using a 5¢ primer containing an EcoRI site, 5¢-CCCTCTGA ATTCAGACACAAGGTGCTGACCGCAGAG-3¢ (nucleotide 1–35, Fig 1A) and the 3¢ primer described above The 25 lL of PCR mixture consisted of unit of DyNazyme EXT, 0.3 lM of each primer, 0.2 mM dNTP and 1.5 ng of plasmid DNA Reactions were run using the following conditions: at 96 °C, at 72 °C for 40 cycles Two amplification fragments of 1656 bp and 1522 bp, respectively, were obtained and subcloned in the Topo TA cloning vector (Invitrogen, USA) The inserted fragments were cut out by digestion with BamHI and EcoRI and inserted into BamHI and EcoRI sites of the pFlagCMV-1 expression vector, which contains the preprotrypsin leader sequence Restriction enzymes digestions and DNA sequencing by Genoscreen (Lille, France) confirmed the cDNA sequence and the insert junctions The resulting plasmids encoded a soluble fusion protein consisting of the Flag sequence and a truncated form of ST6Gal II (pFlagsST6Gal-II) or the whole coding region of ST6Gal II (pFlag-wST6Gal-II) COS-7 cells were grown in DMEM with 4.5 gỈL)1 glucose without glutamine supplemented with 10% fetal bovine serum, L-glutamine 20 mM, penicillin, streptomycin at 37 °C under 5% CO2 Twelve micrograms of Qiagen-purified pFlag-sST6Gal-II or pFlag plasmids were transiently transfected into COS-7 952 M.-A Krzewinski-Recchi et al (Eur J Biochem 270) Ó FEBS 2003 Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 953 Fig Nucleotide and predicted amino acid sequence (A) and hydropathy profile (B) of human ST6Gal II, and (C) comparison of the sialylmotifs L, S and VS of hST6Gal II with those of previously cloned sialyltransferases (A) Numbering of the cDNA begins with the initiation codon The amino-acid sequence is shown in single letter code The putative N-terminal transmembrane domain is boxed Putative N-glycosylation site (N-X-S/T) are marked with asterisks (*) and O-glycosylation sites (NetOGlyc 2.0) with back dots (d) Sialylmotifs L, S and VS are underlined (B) The prediction of transmembrane region has been determined by the Dense Alignment Surface method according to Cserzo et al (1997) [49] The portions (positive numbers) above the horizontal dotted line correspond to hydrophobic regions (C) The sialyltransferases protein sequences were aligned using the CLUSTAL W algorithm Amino acid identities are marked with asterisks and dots indicate a position that is well conserved cells in a 100-mm diameter dish using LipofectAMINE PLUS reagent, following the manufacturer’s instructions The medium was harvested 48 h after transfection The enzymatic protein expressed in the medium was used as the enzyme source Western blot analysis of a soluble ST6Gal II Nine milliliters of media from COS-7 cells transfected with the expression plasmid pFlag-sST6Gal II and from mocktransfected cells were concentrated into mL on Macrosep 30K and 1.5 mL of this preparation were incubated with 150 lL of CMP-Agarose beads (2.8 lmolỈmL)1 CMP) After washing, the supernatants were discarded and beads were boiled for in 100 lL SDS/PAGE loading buffer, centrifuged and loaded on a 4–20% gradient polyacrylamide gel under reducing conditions After Western blotting, the nitrocellulose membrane was incubated with 10 lgỈmL)1 anti-Flag BioM2 mAb Alkaline phosphatase-labelled goat anti-(mouse IgG) Ig was used as the second antibody and revealed by Nitro Blue tetrazolium/5-bromo-4-chloro3-indolyl-phosphate and X-phosphate staining Confocal microscopy CHO cells were grown in aMEM with glutamax, supplemented with 10% fetal bovine serum, penicillin and streptomycin at 34 °C under 5% CO2 CHO and COS-7 cells were transiently transfected with the pFlag plasmid or pFlag plasmid containing the full-length ST6Gal II cDNA (pFlag-wST6Gal-II) Briefly, 15 000 cells were seeded on eight chamber slides (LAB-TEK Nalgen Nunc International) and cultured in standard conditions until midconfluence Then cells were transfected with 0.25 lg of purified plasmid per well in 200 lL OPTIMEM, using the Lipofectamine Reagent Plus kit After transfection, cells were cultured for 24 h in fresh medium containing fetal bovine serum Cells were then fixed for 30 at °C with 4% paraformaldehyde and quenched 30 with 50 mM NH4Cl in phosphate buffered saline (NaCl/Pi) Cells were then saturated for 30 at °C with 2% polyvinylpyrolidone in Tris buffered saline (NaCl/Tris) and incubated with digoxigenin-labeled Sambucus nigra agglutinin (10 lgỈmL)1) After washing with NaCl/Tris, the cells were further saturated for 30 with the blocking reagent S nigra agglutinin-DIG was revealed using anti-digoxigenin-fluorescein Fab fragments diluted : 100 in NaCl/Tris, 1% BSA Laser confocal microscopy analysis was performed using a Zeiss-instrument (Model LSM 510) Construction of recombinant baculoviruses and production of soluble ST6Gal I and ST3Gal III in Sf9 In order to express soluble and His6-tagged enzymatic forms of human ST6Gal I (GenBank accession number X17247) and rat ST3Gal III (clone ST3N-1 [31]), the 5¢ end of these genes were modified The cytoplasmic tail and the transmembrane domain were deleted and the signal peptide sequence of a viral gene ecdysone-S-glycosyltransferase (EGT) was inserted [32] For this purpose, a 247 bp PCR fragment corresponding to the hST6Gal I amino acids 52–122 was amplified using a pflag/hST6Gal I plasmid, generated by PCR from HepG2 cDNA library (C Baisez and A Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further sequencing (Eurogentec, Belgium) This plasmid was then digested with AvrII and BamHI and ligated to the remaining 909 bp AvrII– BamHI fragment containing the 3¢ end of the gene purified from the original construct pflag/hST6Gal I This construction named pUC 6hisST6Gal I contained an additional HpaI site, the last codon of the EGT signal peptide sequence and six histidine codons The modified hST6Gal I sequence was then excised as an 1104 bp HpaI–BamHI fragment and inserted into the HpaI–BglII sites of pUC-PSEGT The pUC-PSEGT plasmid was generated by inserting a 78 bp fragment encoding the signal peptide sequence of EGT gene [32] This 78 bp fragment was obtained after the annealing of the two following synthetic oligonucleotides For EGT 5¢GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢ (In order to avoid homologous recombination between the two EGT sequences, codons were degenerate.) For rST3Gal III, a 108 bp DNA fragment containing a HpaI site, the last codon of the EGT signal peptide sequence, six histidine codons and 19 codons corresponding to amino-acid residues 34–52 was reconstituted using a set of nine overlapping synthetic oligonucleotides and four unique restriction sites AvrII, MunI, HindIII and SacI The DNA fragment was subcloned in a pUC plasmid and sequenced The reconstituted fragment was HpaI–SacI cut and cloned in HpaI–SacI sites of the pUC-PSEGT plasmid described above The resulting construct was digest with AvrII–MunI to receive the 1900 bp AvrII–EcoRI fragment prepared from pBS SK ST3Gal III (clone ST3N-1 [31]) The plasmid pUC PS6HisST3Gal III was obtained The full length modified hST6Gal I gene was then excised after digestion with BamHI and HindIII and inserted at the BglII–HindIII sites of the p119 transfer vector designed for recombination into the p10 locus of the baculovirus giving rise to the p119PS ST6Gal I construct [33] The full-length modified Ó FEBS 2003 954 M.-A Krzewinski-Recchi et al (Eur J Biochem 270) rST3Gal III gene was excised with BamHI and HindIII and inserted at the BglII–HindIII site of the p119 transfer vector giving the p119-PS ST3Gal III construct Sf9 cells (ATCC CRL1711) were cotransfected by lipofection [34] using DOTAP with the transfer vectors and purified viral DNA The recombinant baculoviruses were plaque purified and viral clones were tested for sialyltransferase activity as described below Multiple tissue expression array and northern analysis An EcoRI–BamHI 1.6 kb fragment of the human ST6Gal II cDNA and a 1.8 kb human b-actin cDNA (Clontech) used as a positive control for Northern were labelled with [a-32P]dCTP by random priming using the Rediprime II DNA labelling system The human multiple tissues array membrane and Northern blot were probed according to the manufacturer’s instructions and analysed by radio-imaging Sialyltransferase assays Sialyltransferase assays were performed as described previously [30,35–36] In brief, enzyme activity was measured in 0.1 M cacodylate buffer pH 6.2, 10 mM MnCl2, 0.2% Triton CF-54, 50 lM CMP-[14C]Neu5Ac (1.85 KBq), with one of the acceptor substrate (2 mgỈmL)1 for glycoprotein or mM for arylglycosides and oligosaccharides) and 23 lL of the enzyme source in a final volume of 50 lL The reactions were performed at 37 °C for h Reaction products were separated from CMP-[14C]Neu5Ac depending on the acceptor substrate For glycoproteins, the reaction was terminated either by precipitation and filtration as previously described [35] or by SDS/PAGE After Western blotting, the radioactive products were detected and quantified by radio-imaging using a Personal Molecular Imager FX (Bio-Rad, France) Quantification was performed within the linear range of standard radioactivity For arylglycosides, the reaction was stopped with the addition of mL H2O and products were isolated by hydrophobic chromatography on C18 SepPak cartridges (Millipore Corp., Milford, MA, USA) For free oligosaccharides, the reaction mixture was heated at 100 °C for min, centrifuged and subjected to a paper descending chromatography (Whatman 3) in the following solvent: pyridine/ethyl acetate/acetic acid/H2O (5 : : : 3, v/v/v/v) and the radioactive products were detected and quantified by radio-imaging Under these conditions, the product formation from the individual acceptor substrates was linear up to h For kinetic analysis, incubations were performed as described above using various concentrations of acceptor substrates: 0–500 lM of CMP-Neu5Ac, 0–500 lM of Galb1–4GlcNAcb-O-octyl, or 0–5 mgỈmL)1 of asialo-a1acid glycoprotein Kinetic parameters were determined by Lineweaver–Burk plots and the Km for asialo-a1-acid glycoprotein is expressed in mM relative to the 18 mol terminal Gal residues per mol of human of asialo-a1-acid glycoprotein [37] Linkage analysis by sialidase digestion For linkage analysis, asialo-a1-acid glycoprotein sialylated either with the soluble ST6Gal II or, for the control, with soluble ST6Gal I and ST3Gal III, was precipitated with ethanol and air dried, dissolved in water and then digested with specific sialidase (sialic acid linkage analysis kit, Glyco Inc., USA): NANase I (specific for a2,3-linked sialic acid, 0.5 mlL)1), NANase II (specific for a2,3 and a2,6-linked sialic acid, mlL)1), or NANase III (specific for a2,3, a2,6 and a2,8/9-linked sialic acid, 0.5 mlL)1) at 37 °C for h Digested materials were then analysed by SDS/PAGE and the radioactive products were analysed by radio-imaging Results Identification and isolation of human ST6Gal II cDNA Similarity searches using the tBLASTn algorithm in the human expressed sequence tag (EST), high throughput genomic sequences (HTGs) and human genomic sequences divisions of the GenBankTM/EBI databases at the National Center for Biotechnology Information allowed us to identify nucleotide sequences with significant similarities to hST6Gal I (X17247 [22]) These sequences (GenBank accession numbers AB058780, BC008660, AA385852; EST clones and AC108049, AC016994, AC005040 and NT_005429; genomic clones) were subsequently used to reconstitute a nucleotide sequence potentially encoding a sialyltransferase as yet not described Clone AB058780 represented a full-length cDNA sequence already cloned from hippocampus [38] whereas EST clones BC008660 and AA385852, found in ovary adenocarcinoma and in thyroid, respectively, represented truncated nucleotide sequences Oligonucleotides were designed and partial cDNA sequence (nucleotides 940–1629) was obtained by RT-PCR using neuroblastoma cells NSK total RNAs as template (data not shown) This nucleotide sequence (GenBank accession number AJ512141) was subcloned and sequenced and found to be 100% identical to the AB058780 corresponding sequence However, we failed to amplify the corresponding full-length open reading frame as one fragment and thus we further worked with the clone AB058780 kindly provided by T Nagase, Kazusa DNA Research Institute (Kisarazu, Chiba, Japan) As shown in Fig 1A, the nucleotide sequence contains an open reading frame of 1586 bp encoding a putative 529 amino-acid polypeptide with three putative N-glycosylation sites and two putative O-glycosylation sites Hydropathy profile analysis of the predicted protein (Fig 1B) suggests that it has the structural organization of a membrane-bound type II glycoprotein, which is commonly described for Golgi glycosyltransferases This polypeptide shows a short cytosolic region of 11 aminoacid residues, a single hydrophobic segment of 20 aminoacid residues and a large luminal catalytic domain (498 amino-acid residues) Comparison of the primary structure of this new sialyltransferase with that of the 18 other cloned human sialyltransferases indicates that there are significant similarities in the three sialyltransferases conserved regions named sialylmotifs L, S and VS (Fig 1C) In particular, this protein shares with hST6Gal I a common motif YEXXP in the sialylmotif S where the glutamic acid residue (E) is present only in these two proteins This analysis strongly suggests that this protein represents a new sialyltransferase and since this polypep- Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 955 Fig Comparison of the genomic structure the human ST6Gal I and ST6Gal II genes (A) Exon structure of hST6Gal I and hST6Gal II genes are represented by boxes and are denoted E1 to E5 Darkened boxes with their size (in bp) indicated above, represent the protein coding sequences and opened boxes represent untranslated sequences Solid lines between the exons represent the intron sequences (not drawn to scale); their sizes are indicated below (B) Comparison of the deduced amino acid sequence of the hST6Gal II gene with those of the hST6Gal I gene tide shows 48% overall identity with the human ST6Gal I, we have named it hST6Gal II The gene organization of hST6Gal II was reconstituted from the genomic clones previously identified and found to localize on human chromosome (2q11.2-q12.1) As presented in Fig 2A, in a similar manner to the hST6Gal I gene found on human chromosome (3q27-q28), hST6Gal II gene divides into five exons and spans over 38 kb of human genomic sequence Sequence comparison of each exon shows that these two genes share high similarities in E2, E3, E4, E5 (Fig 2B) This analysis, as well as the dendrogram of the cloned human sialyltransferases (Fig 3), suggests a common ancestral gene for the two ST6Gal genes that have evolved independently ST6Gal-II gene expression In order to determine the expression pattern and the size of hST6Gal II mRNA, Northern blotting was performed using Fig Dendrogram of the cloned human sialyltransferases The deduced amino-acid sequences of the catalytic domain (starting 10 amino-acids upstream of the sialylmotif L) of the cloned human sialyltransferases were aligned by CLUSTAL W and the corresponding phylogenetic tree was constructed using the neighbour-joining method the ST6Gal II cDNA (1.6 kb fragment) as a probe As shown in Fig 4A, among the 12 human tissues examined, hST6Gal II mRNA was detectable only in brain as an 8.0 kb transcript An expression array of 72 different human tissues and eight different control RNAs and DNAs, was also probed with the 1.6 kb hST6Gal II cDNA (Fig 4B) hST6Gal II gene appears to be expressed in lymph node, to a lesser extent in testis, thyroid gland, caudate nucleus, temporal lobe, hippocampus, and fetal tissues (brain, kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed in fetal lung and heart, uterus, bladder, kidney, duodenum, trachea, Burkitt’s lymphoma, and colorectal adenocarcinoma These data lead us to the conclusion that hST6Gal II gene is weakly expressed in a very restricted manner, which is in contrast to hST6Gal I which is expressed in most of human tissues [39] Expression of a recombinant hST6Gal II In order to facilitate functional analysis of the enzyme, a truncated cDNA of hST6Gal II lacking the first 33 amino acids of N-terminus region was generated by PCR from the human cDNA clone AB058780 The putative catalytic domain was fused to a Flag octapeptide (DYKDDDDK) and transiently expressed in COS-7 cells This construction including a preprotrypsin signal produced a soluble form of the enzyme secreted from the cells This soluble FlagST6Gal II fusion protein produced in cell culture media was concentrated on CMP-agarose beads, subjected to SDS/PAGE and Western blotting and visualized as a 70 kDa band (Fig 5) A smaller 40 kDa band was also observed, probably as the result of proteolytic degradation in the cell culture medium To monitor the activity of the soluble form of hST6Gal II, media from cells transfected with pFlag-sST6Gal II or control plasmid were collected after days of transfection and assayed for sialyltransferase activity, using various acceptor substrates (Table 1) We also simultaneously carried out the same enzymatic 956 M.-A Krzewinski-Recchi et al (Eur J Biochem 270) Ó FEBS 2003 Fig Immunoblotting of hST6Gal II recombinant protein from transfected cell culture media Cell culture media from pFlagsST6Gal II and mock-transfected cells (48 h after transfection) were incubated with CMP-Agarose beads The beads were washed, boiled and subjected to SDS/PAGE under reduced conditions and Western blotting using the BioM2 anti-Flag mAb The positions of the high range prestained SDS/PAGE standards are indicated in KDa on the left side of the figure Lane 1, 50 lL from mock transfected cells; lane 2, 50 lL from pFlag/ST6Gal-II transfected cells Fig hST6Gal II gene expression in various human tissues (A) Northern blot analysis Commercially prepared Northern blot (Clontech) with lg poly(A)+ RNA from various adult human tissues were probed with a 1.6 kb 32P-random-labelled hST6Gal II cDNA as described in the Materials and methods section and a 1.8 kb human b-actin cDNA control probe (upper and lower panels, respectively) RNA size marker bands are indicated on the left side of the blot Sizes of the detected mRNA are indicated on the right (B) Expression array analysis of the expression of hST6Gal II in various human tissues Commercially prepared Multiple Tissue Expression (Clontech) array with poly(A+) RNA from 72 different human tissues and eight different control RNAs and DNAs was probed with 32P-random-labelled hST6Gal II cDNA assay with a recombinant soluble form of hST6Gal I produced in the Sf9 cells hST6Gal II was shown to be able to transfer a sialic acid residue onto a terminal Gal residue of asialofetuin and asialo-a1-acid glycoprotein As shown in Table 1, the best acceptor substrate of hST6Gal II was the free disaccharide Galb1–4GlcNAc, lacto-N-neotetraose and Galb1–4GlcNAcb-O-octyl whereas hST6Gal I preferred Galb1–4GlcNAc-R disaccharide linked to a protein as found in asialo-a1-acid glycoprotein No significant activity was observed towards sialylated glycoproteins such as native fetuin and a1-acid glycoprotein, or type containing structures such as Galb1–3GlcNAc, Galb1– 3GlcNAcb-O-octyl or lacto-N-tetraose The kinetic parameters of hST6Gal II were determined using CMP-Neu5Ac as the donor substrate, and using Galb1–4GlcNAcb-O-octyl and asialo-a1-acid glycoprotein as the acceptor substrates The apparent Km value of hST6Gal II for CMP-Neu5Ac (59 lM) was very close to those previously described for native or recombinant hST6Gal I which range from 33 to 50 lM [40,41] The apparent Km value for asialo-a1-acid glycoprotein (0.12 mM) was also in the same range than that determined for the recombinant hST6Gal I (0.10 mM) [41] On the other hand, the apparent Km value of hST6Gal II for Galb1–4GlcNAcbO-octyl was 0.74 mM, which is significantly lower than the values determined for native (1.78 mM) or recombinant (2.38 mM) ST6Gal I using Galb1–4GlcNAc [41] Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 957 Table Comparison of the acceptor substrate specificity of ST6Gal I and ST6Gal II Acceptor substrates were used at a concentration of mM for arylglycosides and mgỈml-1 for glycoproteins Relative rates are calculated as a percentage of the incorporation of sialic acid onto asialo-a1-acid glycoprotein A value of indicates less than 0.4 % d bn, benzyl; pNp, para-nitrophenol Relative rate (%) Acceptor Structures hST6Gal II hST6Gal I Asialo-a1-acid glycoprotein a1-Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc LNT: Galb1-3GlcNAcb1-3Galb1-4Glc 100 (0.52)b 0 100 (13.86)b 1.4 Asialofetuin Arylglycosides Oligosaccharides 66 83 5.3 8.2 259 0 692 623 0.6 0.6 0.4 72 2.5 0.7 87 120 a Rrepresents the remainder of the N-linked oligosaccharide chain b Actual activities are shown in brackets in pmolỈh)1ỈlL)1 c Data from Spiro & Bhoyroo [50] Linkage analysis To determine the incorporated sialic acid linkage, sialidase digestions of asialo-a1-acid-glycoprotein, sialylated with either hST6Gal II, hST6Gal I, or hST3Gal III, and subsequent electrophoresis of the digested products were performed As shown in Fig 6, the incorporated 14C-labelled sialic acid was resistant to treatment with a2,3-specific sialidase compared to asialo-a1-acid-glycoprotein sialylated with ST3Gal III used as a positive control of the NANase I specific action The radioactive material was completely removed upon treatment with a2,3/6-sialidase or a2,3/6/8- sialidase, indicating that the product formed is indeed NeuAca2–6Gal ST6Gal II induces the expression of NeuAca2–6Gal structures at the cell surface of transfected cells In order to visualize a phenotypic change in the hST6Gal II expressing cells, the full-length ORF of hST6Gal II was inserted in the pFlag expression vector and transfected into CHO or COS-7 cells Forty-eight hours after transfection, cells were incubated with digoxigenin-labelled S nigra agglutinin, a lectin that recognized NeuAca2–6Gal/GalNAc structures, and revealed with an anti-digoxigenin fluorescein-labelled Fab fragment A negative control without lectin was also performed As observed by confocal microscopy (Fig 7), hST6Gal II induces the over-expression of NeuAca2–6Gal structures at the cell surface of transfected CHO cells whereas mock transfected cells weakly expressed NeuAca2–6Gal No fluorescence was detected in the control, indicating the specificity of the fluorescence detection The same result was also obtained with COS-7 cells (data not shown) Discussion Fig Analysis of linkage specificity of hST6Gal II [14C]Neu5Aclabelled asialo-a1-acid glycoprotein was produced using soluble recombinant ST6Gal II, ST6Gal I or ST3Gal III The sialylated labelled products were subjected to sialidase treatment with NANase I (specific for a2–3-linked sialic acid, lane 2), or NANase II (specific for a2–3/ 6-linked sialic acids, lane 3), or NANase III (specific for a2–3/6/8/ 9-linked sialic acids, lane 4), or none (lane 1) The resulting products were separated on SDS/PAGE and detected by radio-imaging The ST6Gal subfamily Unlike all the other sialyltransferases cloned to date and characterized [36], ST6Gal I was so far the unique member of the b-galactoside a2,6-sialyltransferase subfamily to be identified This unique gene is widely expressed in human tissues and the enzyme is mainly involved in the a6-sialylation of membrane and secreted glycoproteins However, other b-galactoside a2,6-sialyltransferases with different Ó FEBS 2003 958 M.-A Krzewinski-Recchi et al (Eur J Biochem 270) Fig S nigra agglutinin staining of CHO/hST6Gal II transfected cells CHO cells were transiently transfected with pFlag-wST6Gal II vector encoding the full length ORF of hST6Gal II cDNA or with the pFlag vector by means of LipofectAMINE-reagent plus Expression of NeuAca2– 6Gal was detected using digoxigenin-labelled S nigra agglutinin and an anti-digoxigenin-fluorescein Fab fragment, and the fluorescence was detected by confocal microscopy (A) CHO/pFlag-wST6Gal II cells, (B) CHO/pFlag cells, (C) CHO cells anti-digoxigenin-fluorescein Fab fragment substrate specificity or preferences were expected to exist to account for the presence 6-sialylated oligosaccharides such as 6¢-sialyl-lactose, sialyl-lactosamine or sialyl-lacto-N-neotetraose found in human milk [42,43], monosialylganglioside NeuAca2–6Galb1–4GlcNAcb1–3Galb1–4Glc-Cer immunostained in human meconium or NeuAca2–6GalNAcb1–4GlcNAc structures found on pituitary hormones As the human genome is being deciphered, we gain access to a large number of sialyltransferase-gene related sequences through screening of the databanks This strategy allowed us to identify a new human sialyltransferase gene located on chromosome with high similarity to hST6Gal I located on chromosome 3, both in terms of gene organization and sequence Our data clearly indicate that these two genes may have a common ancestral gene and after dispersion in the human genome would have evolved independently From an evolutionary point of view, we could also identify the rat homologue of this new gene (in genomic clones AC094827 and AC106335; data not shown), and also the mouse homologue located on mouse chromosome 17 (XM140080) Several EST (BU055532, BB651169, BB552328) expressed either in the neonate cerebellum or in pregnant mouse oviduct were assembled and the corresponding protein sequence deduced A protein sequence comparison of the two homologues is shown in Fig 8, which indicates 77% identity between them Two cDNAs corresponding to partial mRNAs were also found in the zebra fish databanks (BE606075, BM103887) which suggest that this ST6Gal II protein appeared early in the evolution overall identity with hST6Gal I and even higher identities within the sialylmotifs, with 67%, 56% and 90% identity for the L, S and VS motif, respectively In the catalytic domain, hST6Gal II protein shows six cysteine residues that are strictly conserved in hST6Gal I protein Ma and Colley (1996) [44] have described formation of a disulfide-bonded dimer of ST6Gal I that is catalytically inactive but retains its ability to bind galactose The presence of a faint band around 140 kDa in Fig suggests that this dimerization may also occur for hST6Gal II Human ST6Gal II protein shows also three potential N-glycosylation sites, two of which lie within the sialylmotif L (Fig 1) These two sites are conserved in the mouse ST6Gal II protein whereas the third-one, located in the stem region, is missing The influence of N-glycosylation on the activity and trafficking of ST6Gal I has been previously investigated [45] It appears that these N-glycosylation sites are required for the activity and endoplasmic reticulum to Golgi transport of the soluble form of ST6Gal I However, the position of these glycosylation sites is not conserved in ST6Gal II In addition, we have shown that the soluble hST6Gal II recombinant protein is secreted in the culture medium of COS-7 cells as a 70 kDa polypeptide (Fig 5) Taking into account the expected molecular mass of the nonglycosylated polypeptide (58 kDa), we can predict that these N-glycosylation sites are occupied Further analyses will be required to determine whether or not the N-glycosylation could influence ST6Gal II activity Gene expression pattern Sequence analysis Sequence analysis of the deduced protein showed that this protein has one of the longest stem region (around 200 amino acid residues) whereas the size of the catalytic domain is conserved among the different sialyltransferases It is interesting to note that hST6Gal II protein shared 48% The results of Northern and expression array analyses clearly indicated a restricted and low level expression of hST6Gal II gene as an kb transcript mainly in brain, which is in accordance with the size of the cDNA clone AB058780 (6.782 kb) It was found also in specific regions of the brain: hippocampus and amygdala of the limbic Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 959 Fig Comparison of the putative amino-acid sequence of hST6Gal II and mST6Gal II The two vertical dots indicate identical amino acid residues and single dots indicate similar amino-acid residues The underlined amino acid residues indicate the sialylmotifs L, S and VS Putative conserved N-glycosylation site (N-X-S/T) are marked with asterisks (*) system, caudate nucleus and the cerebral cortex temporal lobe Very low levels of mRNA were detected also in lymph node, testis, thyroid gland and fetal tissues This low and restricted level of expression is in agreement with the little number of ST6Gal II EST in databanks This is in contrast to the expression pattern of the ST6Gal I gene, which is abundantly expressed in almost all human tissues examined, including fetal tissues but with the notable exceptions of testis and brain [39] where it is expressed at lower levels One can postulate that expression of ST6Gal II in these two tissues could compensate for the lower expression of ST6Gal I or be responsible for the specific synthesis of a6-sialylated glycoconjugates We also identified two upstream untranslated exons, exon A (119 bp) found in the EST BE613250 and located 42 941 bp upstream the first coding exon, and exon B (62 bp) found in the mRNA sequence AB058780 and located 42 058 bp upstream the first coding exon (data not shown) The hST6Gal II gene would thus drive the expression of at least two individual mRNAs through the use of two distinct promoters Very preliminary analysis of the two upstream genomic sequences identified in the databanks indicated the presence potential trans-acting factors binding sites such as SP1 and TBP binding sites found upstream exon B This finding would argue for a ubiquitous and low-level expression of exon B containing transcripts On the other hand, the presence of CREB and SREBP binding sites upstream exon A would indicate a specific expression of exon A containing Ó FEBS 2003 960 M.-A Krzewinski-Recchi et al (Eur J Biochem 270) transcripts in brain and fetal tissues Future transcriptional regulation studies will help elucidate the biological significance of each transcript Expression and specific activity of hST6Gal II The acceptor substrate specificity of ST6Gal II was determined using a Flag-tagged soluble form of the enzyme missing the first 33 amino-acids The results of the enzymatic assays clearly suggested a narrow activity of hST6Gal II in transferring sialic acid residues in the 6-position of the Gal residue of the Galb1–4GlcNAc disaccharide, exclusively Although active with asialoglycoproteins, hST6Gal II showed a higher activity towards arylglycosides and above all onto free oligosaccharides In particular, the Km value determined using Galb1–4GlcNAcb-O-octyl (0.74 mM) was significantly lower than the value determined for native (1.78 mM) or recombinant (2.38 mM) ST6Gal I [41] These results raised the question of the biological significance of the presence of a second Galb1–4GlcNAc a2,6-sialyltransferase preferentially acting onto free oligosaccharides since hST6Gal I showed also activities towards these substrates (Table 1) The release of free 6-sialylated oligosaccharides in human milk is known for a long time (reviewed in [46]) and previous reports described elevated mammary gland sialyltransferase activity accompanying lactation [47] More recently, Dalziel et al (2001) [48] described an ST6Gal I mRNA induction mediated by recruitment of a novel 5¢ untranslated exon probably driven by a lactogenic promoter Our future studies will aim to refine ST6Gal II gene expression in various free 6-sialylated oligosaccharides producing tissues such as lactating mammary gland but also to refine ST6Gal II enzymatic activity towards substrate acceptors such as GalNAcb1–4GlcNAc or glycolipids In order to shed light on the biological function of ST6Gal II, in vivo activity of ST6Gal II was assessed through transient transfection of CHO cells and COS-7 cells with the full-length ST6Gal II cDNA Significant changes in the sialylation pattern of cell surface glycoconjugates were observed through the use of S nigra agglutinin Western blot analysis of ST6Gal II transfected CHO cells has also shown that only a small number of glycoproteins exhibit a modified sialylation profile (data not shown) This observation lent support to the conclusion that this b-galactoside a2,6-sialyltransferase generated NeuAca2– 6Galb1–4GlcNAc epitopes and may have very specific glycoproteins or glycolipids substrate acceptors, which our future studies will aim to determine The presence of this new b-galactoside a2,6-sialyltransferase ST6Gal II will shed new light onto previous studies conducted with ST6Gal I Acknowledgements ´ The authors are very thankful to Dr Claudine Auge (URA CNRS 462, ´ ´ ´ Orsay, France), Drs Gerard Strecker and Frederic Chirat (UMR CNRS-USTL 8576, Villeneuve d’Ascq, France) for the generous gift of acceptor substrates and to Prof J C Paulson for the kind gift of ST3N-1 clone The University of Sciences and Technologies of Lille, the European Carbohydrate Research Network GlycoTrain, the CNRS ´ Reseau >G3, and the Association pour la Recherche sur le Cancer (grant no 5469) have supported this work References Varki, A (1993) Biological roles of oligosaccharides: all of the theories are correct Glycobiology 3, 97–130 Kelm, S & Schauer, R (1997) Sialic acids in molecular and cellular interactions Int Rev Cytol 175, 137–240 Harduin-Lepers, A., Recchi, M.A & Delannoy, P (1995) 1994, the year of sialyltransferases Glycobiology 5, 5741–5758 Varki, A (1994) Selectin ligands Proc Natl Acad Sci USA 91, 7390–7397 Schauer, R (2000) Biochemistry of sialic acid diversity In Carbohydrates in Chemistry and Biology Part II, Biology of the Saccharides, V (Ernst, B., Hart, G.W & Sinay, P., eds), Vol 3, pp 227–243 Wiley-VCH, Wienhein, Germany Vallejo, V., Reyes-Leyva, J., Hernandez, J., Ramirez, H., Delannoy, P & Zenteno, E (2000) Differential expression of sialic acid on porcine organs during the maturation process Comp Biochem Phys B126, 415–424 Hakomori, S.I (1991) Possible functions of tumor-associated carbohydrate antigens Curr Opin Immunol 3, 646–653 Finne, J., Finne, U., Deagostini-Bazin, H & Goridis, C (1983) Occurrence of a2–8 linked polysialosyl units in a neural cell adhesion molecule Biochem Biophys Res Commun 112, 482– 487 Gyorgy, P., Jeanloz, R.W., von Nicolai, H & Zilliken, F (1974) Undialyzable growth factors for Lactobacillus bifidus var pennsylvanicus Protective effect of sialic acid bound to glycoproteins and oligosaccharides against bacterial degradation Eur J Biochem 43, 29–33 10 Prieto, P.A & Smith, D.F (1985) A new ganglioside in human meconium detected by antiserum against the human milk sialyloligosaccharide, LS-tetrasaccharide b Arch Biochem Biophys 241, 281–289 11 Green, E.D & Baenziger, J.U (1988) Asparagine-linked oligosaccharides on lutropin, follitropin, and thyrotropin I Structural elucidation of the sulfated and sialylated oligosaccharides on bovine, ovine, and human pituitary glycoprotein hormones J Biol Chem 263, 25–35 12 Harduin-Lepers, A., Vallejo-Ruiz, V., Krzewinski-Recchi, M.A., Samyn-Petit, B., Julien, S & Delannoy, P (2001) The human sialyltransferase family Biochimie 83, 727–737 13 Coutinho, P.M & Henrissat, B (1999) Carbohydrate-active enzymes: an integrated database approach In Recent Advances in Carbohydrate Bioengineering (Gilbert, H.J., Davies, G., Henrissat, B & Svensson, B., eds), pp 3–12 The Royal Society of Chemistry, Cambridge, UK 14 Paulson, J.C., Weinstein, J & Schauer, A (1989) Tissue-specific expression of sialyltransferases J Biol Chem 264, 10931–10934 15 Datta, A.K & Paulson, J.C (1995) The sialyltransferase ÔsialylmotifÕ participates in binding the donor substrate CMP-NeuAc J Biol Chem 270, 1497–1500 16 Datta, A.K., Sinha, A & Paulson, J.C (1998) Mutation of the sialyltransferase S-sialylmotif alters the kinetics of the donor and acceptor substrates J Biol Chem 273, 9608–9614 17 Geremia, R.A., Harduin-Lepers, A & Delannoy, P (1997) Identification of two novel conserved amino acid residues in eukaryotic sialyltransferases; implications for their mechanism of action Glycobiology 7, 5–7 18 Paulson, J.C., Rearick, J.I & Hill, R.L (1977) Enzymatic properties of b-D-galactoside a2 leads to sialytransferase from bovine colostrum J Biol Chem 252, 2363–2371 19 Nemansky, M & Van den Eijnden, D.H (1992) Bovine colostrum CMP-NeuAc: Gal b (1–4) GlcNAc-R a(2–6)-sialyltransferase is involved in the synthesis of the terminal NeuAca (2–6) GalNAcb (1–4) GlcNAc sequence occurring on N-linked glycans of bovine milk glycoproteins Biochem J 287, 311–316 Ó FEBS 2003 Characterization of the human ST6Gal II (Eur J Biochem 270) 961 20 Mercier, D., Wierinckx, A., Oulmouden, A., Gallet, P.F., Palcic, M.M., Harduin-Lepers, A., Delannoy, P., Petit, J.M., Leveziel, H & Julien, R (1999) Molecular cloning, expression and exon/intron organization of the bovine b-galactoside a2,6-sialyltransferase gene Glycobiology 9, 851–863 21 Weinstein, J., Lee, E.U., McEntee, K., Lai, P.H & Paulson, J.C (1987) Primary structure of b-galactoside a2,6-sialyltransferase Conversion of membrane-bound enzyme to soluble forms by cleavage of the NH2-terminal signal anchor J Biol Chem 262, 17735–17743 22 Grundmann, U., Nerlich, C., Rein, T & Zettlmeissl, G (1990) Complete cDNA sequence encoding human b-galactoside a-2,6sialyltransferase Nucleic Acids Res 18, 667 23 Hamamoto, T., Kawasaki, M., Kurosawa, N., Nakaoka, T., Lee, Y.C & Tsuji, S (1993) Two step single primer mediated polymerase chain reaction Application to cloning of putative mouse, b-galactoside a2,6-sialyltransferase cDNA Bioorg Med Chem 1, 141–145 24 Kurosawa, N., Kawasaki, M., Hamamoto, T., Nakaoka, T., Lee, Y.C., Arita, M & Tsuji, S (1994) Molecular cloning and expression of chick embryo Gal b1,4GlcNAc a2,6-sialyltransferase Comparison with the mammalian enzyme Eur J Biochem 219, 375–381 25 Lo, N.W & Lau, J.T (1996) Transcription of the b-galactoside a2,6-sialyltransferase gene in B-lymphocytes is directed by a separate and distinct promoter Glycobiology 6, 271–279 26 Taniguchi, A., Hasegawa, Y., Higai, K & Matsumoto, K (2000) Transcriptional regulation of human b-galactoside a2,6-sialyltransferase (hST6Gal I) gene during differentiation of the HL-60 cell line Glycobiology 10, 623–628 27 Dalziel, M., Lemaire, S., Ewing, J., Kobayashi, L & Lau, J.T (1999) Hepatic acute phase induction of murine b-galactoside a2,6 sialyltransferase (ST6Gal I) is IL-6 dependent and mediated by elevation of exon H-containing class of transcripts Glycobiology 9, 1003–1008 28 Lo, N.W., Dennis, J.W & Lau, J.T (1999) Overexpression of the a2,6-sialyltransferase, ST6Gal I, in a low metastatic variant of a murine lymphoblastoid cell line is associated with appearance of a unique ST6Gal I mRNA Biochem Biophys Res Commun 264, 619–621 29 Dall’Olio, F., Chiricolo, M., Ceccarelli, C., Minni, F., Marrano, D & Santini, D (2000) b-galactoside a2,6 sialyltransferase in human colon cancer: contribution of multiple transcripts to regulation of enzyme activity and reactivity with Sambucus nigra agglutinin Int J Cancer 88, 58–65 30 Samyn-Petit, B., Krzewinski-Recchi, M.-A., Steelant, W.F.A., Delannoy, P & Harduin-Lepers, A (2000) Molecular cloning and functional expression of human ST6GalNAc II Molecular expression in various human cultured cells Biochim Biophys Acta 1474, 201–211 31 Wen, D.X., Livingston, B.D., Medzihradszky, K.F., Kelm, S., Burlingame, A.L & Paulson, J.C (1992) Primary structure of Galb1,3(4) GlcNAc a2,3-sialyltransferase determined by mass spectrometry sequence analysis and molecular cloning Evidence for a protein motif in the sialyltransferase gene family J Biol Chem 267, 21011–21019 32 O’Reilly, D.R & Miller, L.K (1989) A baculovirus blocks insect molting by producing ecdysteroid UDP-glucosyl transferase Science 245, 1110–1112 ´ ´ 33 Misse, D., Cerutti, M., Schmidt, I., Jansen, A., Devauchelle, G., Jansen, F & Veas, F (1998) Dissociation of the CD4 and CXCR4 binding properties of human immunodeficiency virus type gp120 by deletion of the first putative alpha-helical conserved structure J Virol 72, 7280–7288 34 Felgner, P.L & Ringold, G.M (1989) Cationic liposome-mediated transfection Nature 337, 387–388 35 Giordanengo, V., Bannwarth, S., Laffont, C., Van Miegem, V., Harduin-Lepers, A., Delannoy, P & Lefebvre, J.-C (1997) Cloning and expression of cDNA for a human Gal (b1–3) GalNAc a2,3-sialyltransferase from the CEM T-cell line Eur J Biochem 247, 558–566 36 Harduin-Lepers, A., Stokes, D.C., Steelant, W.F., Samyn-Petit, B., Krzewinski-Recchi, M.-A., Vallejo-Ruiz, V., Zanetta, J.-P., ´ Auge, C & Delannoy, P (2000) Cloning, expression and gene organization of a human Neu5Aca2–3Galb1–3GalNAc a2,6sialyltransferase: hST6GalNAc IV Biochem J 352, 37–48 37 Weinstein, J., de Souza-e., -Silva, U & Paulson, J.C (1982) Sialylation of glycoprotein oligosaccharides N-linked to asparagine Enzymatic characterization of a Galb1–3 (4) GlcNAc a2,3-sialyltransferase and a Galb1–4GlcNAc a2,6-sialyltransferase from rat liver J Biol Chem 257, 13845–13853 38 Nagase, T., Nakayama, M., Nakajima, D., Kikuno, R & Ohara, O (2001) Prediction of the coding sequences of unidentified human genes The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro DNA Res 8, 85–95 39 Kitagawa, H & Paulson, J.C (1994) Differential expression of five sialyltransferase genes in human tissues J Biol Chem 269, 17872– 17878 40 Gross, H.J., Rose, U., Krause, J.M., Paulson, J.C., Schmid, K., Feeney, R.E & Brossmer, R (1989) Transfer of synthetic sialic acid analogues to N- and O-linked glycoprotein glycans using four different mammalian sialyltransferases Biochemistry 28, 7386– 7392 41 Williams, M.A., Kitagawa, H., Datta, A.K., Paulson, J.C & Jamieson, J.C (1995) Large-scale expression of recombinant sialyltransferases and comparison of their kinetic properties with native enzymes Glycoconj J 12, 755–761 42 Nakano, T., Sugawara, M & Kawakami, H (2001) Sialic acid in human milk: composition and functions Acta Paediatr Taiwan 42, 11–17 43 Smith, D.F & Ginsburg, V (1980) Antibodies against sialyloligosaccharides coupled to protein J Biol Chem 255, 55–59 44 Ma, J & Colley, K.J (1996) A disulfide-bonded dimer of the Golgi b-galactoside a2,6-sialyltransferase is catalytically inactive yet still retains the ability to bind galactose J Biol Chem 271, 7758–7766 45 Chen, C & Colley, K.J (2000) Minimal structural and glycosylation requirements for ST6Gal I activity and trafficking Glycobiology 10, 531–583 46 Rivero-Urgell, M & Santamaria-Orleans, A (2001) Oligosaccharides: application in infant food Early Hum Dev 65, S43– S52 47 Bushway, A.A., Park, C.S & Keenan, T.W (1979) Effect of pregnancy and lactation on glycosyltransferase activities of rat mammary gland Int J Biochem 10, 147–154 48 Dalziel, M., Huang, R.Y., Dall’Olio, F., Morris, J.R., TaylorPapadimitriou, J & Lau, J.T (2001) Mouse ST6Gal sialyltransferase gene expression during mammary gland lactation Glycobiology 11, 407–412 49 Cserzo, M., Wallin, E., Simon, I., von Heijne, G & Elofsson, A (1997) Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method Protein Eng 10, 673–676 50 Spiro, R.G & Bhoyroo, V.D (1974) Structure of the O-glycosidically linked carbohydrate units of fetuin J Biol Chem 249, 5703–5717  ... NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp... weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed in fetal lung and heart, uterus, bladder, kidney, duodenum, trachea,... Characterization of the human ST6Gal II (Eur J Biochem 270) 953 Fig Nucleotide and predicted amino acid sequence (A) and hydropathy profile (B) of human ST6Gal II, and (C) comparison of the sialylmotifs