Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio Suman Mitra, Ayham Alnabulsi, Chris J Secombes and Steve Bird Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, UK Keywords adaptive immunity; fish immunology; T-cells; transcription factors; zebrafish Correspondence S Bird, Scottish Fish Immunology Research Centre, School of Biological Sciences, Zoology Building, University of Aberdeen, Aberdeen AB24 2TZ, UK Fax: +44 1224 272396 Tel: +44 1224 272881 E-mail: s.bird@abdn.ac.uk (Received 25 August 2009, revised 16 October 2009, accepted 27 October 2009) doi:10.1111/j.1742-4658.2009.07460.x The discovery of cytokines expressed by T-helper (Th1), Th2, Th17 and T-regulatory (Treg) cells has prompted speculation that these types of responses may exist in fish, arising early in vertebrate evolution In this investigation, we cloned three zebrafish transcription factors, T-box expressed in T cells (t-bet), signal transducer and activator of transcription (stat6) and fork-head box p3 (foxp3), in which two transcripts are present, that are important in the development of a number of these cell types They were found within the zebrafish genome, using a synteny approach in the case of t-bet and foxp3 Multiple alignments of zebrafish t-bet, stat6 and foxp3 amino acids with known vertebrate homologues revealed regions of high conservation, subsequently identified to be protein domains important in the functioning of these transcription factors The gene organizations of zebrafish t-bet and foxp3 were identical to those of the human genes, with the second foxp3 transcript lacking exons 5, 6, and Zebrafish stat6 (21 exons and 20 introns) was slightly different from the human gene, which contained 22 exons and 21 introns Immunostimulation of zebrafish head kidney and spleen cells with phytohaemagglutinin, lipopolysaccharide or Poly I:C, showed a correlation between the expression of t-bet, stat6 and foxp3 with other genes involved in Th and Treg responses using quantitative PCR These transcription factors, together with many of the cytokines that are expressed by different T-cell subtypes, will aid future investigations into the Th and Treg cell types that exist in teleosts Introduction Naive CD4+ T-cells, on antigenic stimulation, become activated, expand and differentiate into different effector subsets called T-helper (Th) cells The differentiation of naive T-cells into Th effector cells depends on a variety of stimuli, such as antigen nature, antigen dose and the strength and duration of signals through the T-cell receptor (TCR)–CD3 complex, as well as the cytokine microenvironment which activates the cellular signalling pathways [1] These Th cell subsets are crucial for the induction of the most appropriate immune response towards a particular pathogen In mammals, three types of CD4+ Th effector cell populations exist, Th1, Th2 and Th17, characterized by their cytokine repertoire and how they regulate B-cell and T-cell Abbreviations foxp3 ⁄ Foxp3, fork-head box p3; IFN-c, interferon-c; IL, interleukin; LPS, lipopolysaccharide; OSBPL7, oxysterol-binding protein-like 7; PHA, phytohaemagglutinin; PPP1R3F, protein phosphatase 1, regulatory (inhibitor) subunit 3F; RACE, rapid amplification of cDNA ends; stat6 ⁄ STAT6, signal transducer and activator of transcription 6; t-bet ⁄ T-bet, T-box expressed in T cells; TCR, T-cell receptor; TGF-b, transforming growth factor-b; Th, T-helper; Treg, T-regulatory 128 FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al responses [2] Th1 cells produce interferon-c (IFN-c) and lymphotoxin, activating cell-mediated immunity and providing protection against intracellular pathogens and viruses Th2 cells secrete interleukin-4 (IL-4), IL-13 and IL-25 (also known as IL-17E), which are important in the generation of the correct class of antibodies by B-cells, and for the elimination of extracellular pathogens, such as helminths and other extracellular parasites [2] Th17 is the most recently identified Th cell subset and secretes pro-inflammatory cytokines, such as IL-17A, IL-17F, IL-21 and IL-22 [3,4] Th17 cells play an important role in host defence against extracellular pathogens, in particular extracellular bacteria, which are not efficiently cleared by Th1- and Th2-type immunity [5] Finally, in addition to Th cells, there is a population of CD4+ T-cells that is involved in the regulation of Th responses via the secretion of cytokines, called T-regulatory (Treg) cells, which help to inhibit harmful immunopathological responses directed against self- or foreign antigens [6,7] The majority of these cells constitutively express the CD25 cell surface marker and secrete two powerful anti-inflammatory cytokines: IL-10 and transforming growth factor-b (TGF-b) Whether a naive T-cell becomes a Th1, Th2, Th17 or Treg cell is influenced by the cytokines that are produced within the microenvironment, which, in turn, influence transcription factors and key signalling pathways [8] Th1 differentiation is initiated by coordinate signalling through the TCR and cytokine receptors, for cytokines such as type I and II IFNs or IL-27, which are associated with STAT1 [9,10] Activation of STAT1 induces the transcription factor, T-box expressed in T cells (T-bet), which is a master regulator of Th1 differentiation [11] T-bet potentiates the expression of IFN-c, which, in turn, upregulates the inducible chain of the IL-12 receptor (IL-12Rb2) Binding of IL-12 to its receptor induces signalling through STAT4, which further enhances IFN-c production and induces the expression of IL-18Ra, allowing the responsiveness of these now mature Th1 cells to IL-18 [12] Th2 differentiation is initiated by TCR signalling, together with IL-4 receptor signalling via signal transducer and activator of transcription (STAT6) This, in turn, up-regulates the low-level expression of GATA3, the master regulator of Th2 differentiation [13] GATA3 autoactivates its own expression, eventually enabling mature Th2 cells to express the Th2 cytokine cluster, IL-4, IL-5 and IL-13, as a result of epigenetic changes [14] Th1 and Th2 cells negatively regulate each other’s development GATA3 suppresses STAT4 and the IL-12Rb2 chain expression, Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 factors which are critical to the Th1 pathway [15], whereas IL-27 suppresses Th2 development [16] Th17 differentiation is slightly more complex because of differences between mice and humans [17] In mice, Th17 differentiation is initiated by TCR signalling, together with TGF-b1 and IL-6 receptor signalling, which activates STAT3 and induces the expression of the transcription factor retinoic acidrelated orphan receptor ct IL-23 also activates STAT3 but, in addition, serves to maintain Th17 cells in vivo In contrast, human cells not require TGF-b1, and it is IL-1, IL-6 and IL-23 that promote human Th17 differentiation [17] Lastly, Treg cells are crucial players in the regulation ⁄ suppression of each of the Th responses and self-reactive T-cells It is now known that there is more than one subtype of Treg cells, although the most important appear to be CD4+CD25+Foxp3+Treg [18] These cells are affected by the transcription factor fork-head box p3 (Foxp3), whose induction is initiated by TCR signalling, together with TGF-b1 receptor signalling [19] Treg suppressive activity is via IL-10 and TGF-b, although it remains unclear whether these cytokines are produced by CD4+CD25+Foxp3+Treg or whether they induce the production of these cytokines from another population of cells [20] To date, our knowledge about the different types of Th and Treg responses relates to studies performed in mammals, especially mice and humans [12] In fish, there has been a considerable amount of work undertaken on immunity over the last few decades, and a large number of genes involved in immune responses have been discovered However, although we know a lot about the innate and inflammatory immune responses of fish [21], relatively little is known about the lymphocyte subpopulations involved in the adaptive immune responses in fish, and whether Th subsets exist Speculation that Th1, Th2, Th17 and Treg responses may exist in fish, and arose early in vertebrate evolution, has been prompted by the discovery of many of the cytokines that are expressed by these cell types [22,23] However, it is important to note that not all the cytokines known in mammals have been found in fish, and it remains to be determined whether the regulation of adaptive immunity in fish is similar to that found in mammals, and if it is equally complex In addition, the key transcription factors involved in driving the differentiation of the naive T-cell to Th1, Th2, Th17 or Treg cells may exist in fish In this investigation, we have identified, for the first time, t-bet and stat6 in zebrafish and, for the first time in any fish species, foxp3 Lastly, we carried out some preliminary FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 129 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al expression analyses to investigate their role in the immune responses of fish Results Cloning and sequencing For t-bet, stat6 and foxp3, three overlapping products were obtained using PCR and specific primers, which contained the complete cDNA sequence for each gene The zebrafish t-bet cDNA (EMBL accession no AM942761) consisted of a 36 bp 5¢-UTR, a 419 bp 3¢-UTR and a single open reading frame of 1830 bp, giving a predicted 609 amino acid t-bet molecule In the 3¢-UTR, no obvious polyadenylation signal was present The stat6 cDNA transcript (EMBL accession no AM941850) consisted of a 135 bp 5¢-UTR, an 809 bp 3¢-UTR and a single open reading frame of 2277 bp, which translated into a predicted 758 amino acid stat6 molecule In the 3¢-UTR, two mRNA instability motifs (attta) were present, and again no obvious polyadenylation signal was found The foxp3 cDNA transcript (EMBL accession no FM881778) consisted of a 100 bp 5¢-UTR, a 410 bp 3¢-UTR and a single open reading frame of 1260 bp, which translated into a predicted 419 amino acid foxp3 molecule In the 3¢-UTR, four mRNA instability motifs (attta) were present upstream of the polyadenylation signal An alternative transcript of foxp3 (Fig 1) was also found and was shown to be missing the region containing the zinc-finger and leucine-zipper domain Multiple alignment of zebrafish t-bet, stat6 and foxp3 with other known T-bet, STAT6 and Foxp3 amino acid sequences (Figs 2–4, respectively) revealed areas of amino acid conservation throughout the vertebrates Significant homology was seen in the putative T-box DNA-binding domain of t-bet, the STAT protein interaction domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipper domain and fork-head domain of foxp3 In addition, for stat6 and foxp3, there were a few other conserved features Within the zebrafish stat6 sequence is an important tyrosine residue (Tyr664), which was conserved in all sequences Within the foxp3 molecule, some homology was found within the predicted transcriptional repressor domains, with domain containing a large number of proline residues As with other t-bet, stat6 and foxp3 molecules sequenced to date, the zebrafish t-bet, stat6 and foxp3 peptides did not possess a signal peptide, as predicted by SignalP v1.1 (data not shown) Zebrafish t-bet had the highest amino acid identity and similarity (Table 1) to Ginbuna crucian carp t-bet (91.0% and 95.4%, respectively), zebrafish stat6 to Tetraodon stat6 (52.9% and 71.5%, respectively) and zebrafish foxp3 to mouse foxp3 (31.6% and 49.0%, respectively) Phylogenetic analysis of t-bet, stat6 and foxp3 (Figs 5–7, respectively) grouped t-bet, stat6 and foxp3 with their mammalian homologues, all of which were strongly supported statistically, when all known vertebrate T-box, STAT family and Foxp family members were compared Fig Pairwise alignment of the full-length Danio rerio foxp3 (ZFfoxp3) and an obtained alternative transcript (ZFfoxp3b) The putative transcriptional repressor domains and 2, fork-head (FKH), leucine-zipper and zincfinger domains are highlighted The EMBL accession number of the foxp3b alternative transcript gene is FM881779 130 FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 Fig Multiple alignment of the predicted Danio rerio t-bet (T-box21) with selected known vertebrate T-bet molecules Identical (*) and similar (: or.) residues identified by the CLUSTALX program are indicated The putative T-bet DNA-binding domain is highlighted The EMBL accession numbers of the T-box21 genes are as follows: human, Q9UL17; mouse, Q9JKD8; Ginbuna crucian carp, AB290187; zebrafish, AM942761 FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 131 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al Fig Multiple alignment of the predicted Danio rerio stat6 with selected known vertebrate STAT6 molecules Identical (*) and similar (: or.) residues identified by the CLUSTALX program are indicated The putative STAT interaction, STAT all-alpha, STAT DNAbinding and SH2 domains are highlighted Boxed is an important tyrosine residue (Tyr664 in zebrafish) The EMBL accession numbers of the STAT6 genes are as follows: human, P42226; mouse, P52633; zebrafish, AM941850 t-bet, stat6 and foxp3 gene organization and chromosome synteny Using the zebrafish t-bet, stat6 and foxp3 cDNA sequences elucidated by PCR and the regions of the 132 zebrafish genome that contained these sequences, chromosomes 8, 12 and 23, the gene organizations were obtained (Fig 8; t-bet GenBank accession no FN435332, stat6 GenBank accession no FN435334, foxp3 GenBank accession no FN435333) t-bet was FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 Fig Multiple alignment of the predicted Danio rerio foxp3 with known Foxp3 molecules Identical (*) and similar (: or.) residues identified by the CLUSTALX program are indicated The putative transcriptional repressor domains and 2, fork-head (FKH), leucine-zipper and zinc-finger domains are highlighted Proline residues within the transcriptional repressor domains are underlined The EMBL accession numbers of the Foxp3 genes are as follows: human, Q9BZS1; mouse, Q99JB6; crab-eating macaque, Q6U8D7; zebrafish, FM881778 found to have six exons and five introns, stat6 was found to have 21 exons and 20 introns, and foxp3 was found to have 13 exons and 12 introns In the genomic sequence, the intron splicing consensus (GT ⁄ AG) is conserved at the 5¢ and 3¢ ends of the introns The gene organization was found to be similar to that of human t-bet and foxp3 genes (Fig 8), with human stat6 having a slightly different gene organization of 22 exons and 21 introns Generally, the sizes of the zebrafish t-bet, stat6 and foxp3 coding exons matched well with the corresponding mammalian exons (Fig 8) Using the Genscan [24], fasta [25] and blast [26] suite of programs, other genes were discovered on zebrafish chromosomes 8, 12 and 23 around the discovered zebrafish t-bet, stat6 and foxp3 genes (Fig 9) On comparison with the human genome, some degree of synteny was found between the two organisms for the regions containing the t-bet and foxp3 genes Around t-bet, the genes TBK1-binding protein 1, oxysterol-binding protein-like (OSBPL7) and mitochondrial ribosomal protein L10 were found in the same order on zebrafish chromosome 12 and human chromosome 17 and, around foxp3, the gene protein phosphatase 1, regulatory (inhibitor) subunit 3F (PPP1R3F) was found in the same order on zebrafish chromosome and human chromosome FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 133 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al Table Amino acid identity ⁄ similarity of zebrafish t-bet, stat6 and foxp3 with other vertebrate T-bet, STAT6 and Foxp3 molecules Human T-bet Human T-bet Mouse T-bet Zebrafish t-bet Ginbuna T-bet Human STAT6 Mouse STAT6 Zebrafish stat6 Tetraodon STAT6 Human Foxp3 Mouse Foxp3 Zebrafish foxp3 Mouse T-bet Zebrafish t-bet Ginbuna T-bet Human STAT6 Mouse STAT6 Zebrafish stat6 Tetraodon STAT6 Human Foxp3 Mouse Foxp3 Zebrafish foxp3 86.90 43.40 42.50 17.50 16.20 15.60 16.40 19.50 18.10 17.60 43.90 43.80 17.20 17.50 16.60 15.60 19.20 18.80 16.80 91.00 17.30 15.80 16.70 17.00 16.90 17.20 16.30 17.50 16.40 16.20 26.30 16.80 18.10 16.90 84.20 34.20 35.40 14.40 14.00 14.10 34.40 35.30 15.30 15.80 12.10 52.90 15.10 14.50 15.20 14.40 14.80 13.50 86.10 31.50 91.80 57.00 58.00 57.20 58.70 95.40 29.20 28.20 28.70 28.90 28.90 29.20 31.20 30.60 90.00 28.60 30.10 32.70 32.80 53.40 54.50 28.50 28.40 30.60 29.90 55.50 55.20 71.50 33.50 32.50 28.90 30.60 24.30 23.80 26.40 25.20 31.00 33.20 28.70 29.60 24.10 24.50 24.40 25.40 91.40 31.40 29.10 27.60 29.10 24.10 23.80 25.20 26.80 48.00 31.60 49.00 Above diagonal, identity; below diagonal, similarity X For stat6, no synteny was found between this locus on zebrafish chromosome 23 with the stat6 locus on human chromosome 12 Up-regulation was observed for a number of other genes investigated, but expression was not statistically significant Quantification of expressed stat6, t-bet and foxp3 genes in spleen or head kidney tissues stimulated with immunostimulants (quantitative real-time PCR) Discussion Using RT-PCR, the constitutive expression of t-bet, stat6 and foxp3 was observed in the spleen, kidney, gill, gut, liver and skin tissue of healthy fish (data not shown) After stimulation of kidney cells with a variety of immunostimulants, the expression of t-bet, stat6 and foxp3, together with other selected zebrafish transcription factors and cytokines, was compared using quantitative PCR (Fig 10) Stimulation of kidney cells with phytohaemagglutinin (PHA) led to a significant increase in il-4 and gata3 expression, stimulation with lipopolysaccharide (LPS) led to a significant increase in il-10, and stimulation with Poly I:C led to a significant increase in ifn-c, mx and t-bet Stimulation of spleen cells with PHA led to a significant increase in ifn-c, whereas stimulation with LPS led to a significant increase in il-10 and foxp3, and stimulation with Poly I:C led to a significant increase in mx and t-bet 134 This paper reports the isolation and sequencing of three zebrafish transcription factors, which are known to be important in T-cell subtype differentiation in mammals T-bet has already been sequenced within bony fish, in the Ginbuna crucian carp [27], and STAT6 in mandarin fish [28], whereas Foxp3 has been characterized for the first time in fish The availability of sequenced fish genomes has allowed the discovery of a number of immune relevant genes using the synteny (conservation of gene order) found between the human and fish genomes [29–32] and, in some cases, has helped determine whether the gene is a true homologue of a mammalian gene To begin with, we used a synteny approach to identify the chromosomal location containing the zebrafish t-bet, stat6 and foxp3 transcription factors We used this approach for t-bet as, at the time of discovery, the Ginbuna crucian carp sequence was unknown This approach enabled t-bet and foxp3 to be obtained quickly, as a major difficulty in the identification of transcription factors is that FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 58 60 0.1 HUMAN TBX2 DOG TBX2 MOUSE TBX2 ZEBRAFISH TBX2 XENOPUSTR TBX2 MOUSE TBX3 HUMANTBX3 CHICKEN TBX3 HUMAN TBX6 MOUSE TBX6 XENOPUSTR TBX6 ZEBRAFISH TBX6 HUMAN T -BET MOUSE T -BET ZEBRAFISH T -BET GINBUNACARP T -BET MOUSE TBX20 HUMAN TBX20 CHICKEN TBX20 XENOPUSTR TBX20 ZEBRAFISH TBX20 MOUSE TBX15 HUMAN TBX15 MOUSE TBX18 HUMAN TBX18 MOUSE TBX1 HUMAN TBX1 XENOPUSTR TBX1 MOUSE TBX10 HUMAN TBX10 MOUSE TBX5 RAT TBX5 HUMAN TBX5 CHICKEN TBX5 XENOPUSLA TBX5 ZEBRAFISH TBX5 DOG TBX4 HUMAN TBX4 TBOX -2/-3 2/- TBOX -6/-21 TBOX-20 TBOXTBOX -15/-18 TBOX-1/-10 TBOX- 1/- TBOX -4/-5 Fig Unrooted phylogenetic tree showing the relationship between the Danio rerio t-bet amino acid sequence for the full-length molecule with other known vertebrate T-box (TBX) family member sequences This tree was constructed by the neighbour-joining method using the CLUSTALX and TREEVIEW packages, and was bootstrapped 10 000 times All bootstrap values less than 75% are shown The EMBL accession numbers of the TBX-1 amino acid sequences are as follows: human, O43435; mouse, P70323; Xenopus tropicalis, Q3SA49 The accession numbers of the TBX-2 amino acid sequences are as follows: human, Q13207; mouse, Q60707; dog, Q863A2; X tropicalis, Q3SA48; zebrafish, Q7ZTU9 The accession numbers of the TBX-3 amino acid sequences are as follows: human, O15119; mouse, P70324; chicken, O73718 The accession numbers of the TBX-4 amino acid sequences are as follows: human, P57082; dog, Q861Q9 The accession numbers of the TBX-5 amino acid sequences are as follows: human, Q99593; mouse, P70326; rat, Q5I2P1; chicken, Q9PWE8; Xenopus laevis, Q9W7C2; zebrafish, Q9IAK8 The accession numbers of the TBX-6 amino acid sequences are as follows: human, O95947; mouse, P70327, X tropicalis, Q66JL1; zebrafish, P79742 The accession numbers of the TBX-10 amino acid sequences are as follows: human, O75333; mouse, Q810F8 The accession numbers of the TBX-15 amino acid sequences are as follows: human, Q96SF7; mouse, O70306 The accession numbers of the TBX-18 amino acid sequences are as follows: human, O95935; mouse, Q9EPZ6 The accession numbers of the TBX-20 amino acid sequences are as follows: human, Q9UMR3; mouse, Q9ES03; chicken, Q8UW76; X tropicalis, Q3SA46; zebrafish, Q9I9K7 The accession numbers of the TBX-21 (T-BET) amino acid sequences are as follows: human, Q9UL17; mouse, Q9JKD8; Ginbuna crucian carp, AB290187; zebrafish, AM942761 many of them belong to gene families, with members having high sequence identity, making it hard to find the correct sequence in the zebrafish genome This approach was not used for stat6 as the region in which this gene was found in the zebrafish genome shared no synteny with the human genome The zebrafish genome was searched using the human stat6 amino acid sequence directly for identification The zebrafish t-bet homologue is predicted to contain 609 amino acids, the stat6 homologue 758 amino acids and the foxp3 homologue 419 amino acids None of these molecules was found to contain a signal peptide (data not shown), indicating that the molecules are not secreted through the classical pathway and will remain cytosolic Also found in the 3¢-UTR of zebrafish stat6 and foxp3 were numerous copies of an mRNA instability motif (attta) which plays a role in mRNA degradation [33], typical of genes coding for inflammatory mediators [34], and suggesting that these genes are transiently transcribed It is unknown whether these FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 135 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al XENOPUSLA STAT1 CHICKEN STAT1 MOUSE STAT1 PIG STAT1 HUMAN STAT1 SALMON STAT1 TETRAODON STAT1 HALIBUT STAT1 SNAKEHEAD STAT1 CHICKEN STAT4 MOUSE STAT4 HUMAN STAT4 ZEBRAFISH STAT4 FUGU STAT4 TETRAODON STAT4 MOUSE STAT2 PIG STAT2 HUMAN STAT2 HUMAN STAT6 MOUSE STAT6 ZEBRAFISH STAT6 TETRAODON STAT6 HUMAN STAT5 58 COW STAT5 PIG STAT5 MOUSE STAT5 RAT STAT5 TROUT STAT5 63 ZEBRAFISH STAT5 FUGU STAT5 TETRAODON STAT5 TROUT STAT3 ZEBRAFISH STAT3 TETRAODON STAT3 55 MEDAKA STAT3 CHICKEN STAT3 MOUSE STAT3 STAT-1 STAT-4 STAT-2 STAT-6 STAT-5 STAT-3 71 RAT STAT3 PIG STAT3 0.1 49 HUMAN STAT3 Fig Unrooted phylogenetic tree showing the relationship between the Danio rerio stat6 amino acid sequence for the full-length molecule with other known vertebrate STAT family member sequences This tree was constructed by the neighbour-joining method using the CLUSTALX and TREEVIEW packages, and was bootstrapped 10 000 times All bootstrap values less than 75% are shown The EMBL accession numbers of the STAT-1 amino acid sequences are as follows: human, P42224; mouse, P42225; pig, Q764M5; chicken, CAG32090; Xenopus tropicalis, AAM51552; salmon, ACI33829; Tetraodon, AAL09414; halibut, ABS19629; snakehead, ABK60089 The accession numbers of the STAT-2 amino acid sequences are as follows: human, P52630; mouse, Q9WVL2; pig, O02799 The accession numbers of the STAT-3 amino acid sequences are as follows: human, P40763; mouse, P42227; rat, P52631; pig, Q19S50; chicken, Q6DV79; trout, AAB60926; zebrafish, AAH68320; Tetraodon, AAL09415; medaka, AAT64912 The accession numbers of the STAT-4 amino acid sequences are as follows: human, Q14765; mouse, P42228; chicken, BAF34318; zebrafish, CAD52132; Fugu, AAS10464; Tetraodon, AAL09416 The accession numbers of the STAT-5 amino acid sequences are as follows: human, P51692; mouse, P42232; rat, P52632; pig, Q9TUZ0; cow, Q9TUM3; trout, AAG14946; Tetraodon, AAL09417; Fugu, AAS80167; zebrafish, AAT95391 The accession numbers of the STAT-6 amino acid sequences are as follows: human, P42226; mouse, P52633; Tetraodon, AAO22057; zebrafish, AM941850 instability motifs will be found within the t-bet 3¢-UTR as it remains to be fully sequenced Phylogenetic analysis was carried out using the amino acid sequences of zebrafish t-bet, stat6 and foxp3 plus those of all known vertebrate T-box, STAT family and Foxp family members The zebrafish genes grouped well with their 136 vertebrate T-bet, STAT6 and Foxp3 homologues, which was supported by bootstrap values greater than 75%, providing further evidence of their identity Multiple alignments of the zebrafish t-bet, stat6 and foxp3 amino acids with their vertebrate homologues revealed regions of high conservation These regions FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 XENOPUS FOXP4 FOXP4 MOUSE FOXP4 HUMAN FOXP4 ZEBRAFISH FOXP3 MOUSE FOXP3 FOXP3 HUMAN FOXP3 MACAQUE FOXP3 XENOPUS FOXP2 HUMAN FOXP2 FOXP2 MACAQUE FOXP2 MOUSE FOXP2 ZEBRAFISH FOXP1 XENOPUS FOXP1 CHICKEN FOXP1 FOXP1 RAT FOXP1 MOUSE FOXP1 COW FOXP1 50 HUMAN FOXP1 0.1 Fig Unrooted phylogenetic tree showing the relationship between the Danio rerio foxp3 amino acid sequence for the full-length molecule with other known vertebrate Foxp family member sequences This tree was constructed by the neighbour-joining method using the CLUSTALX and TREEVIEW packages, and was bootstrapped 10 000 times All bootstrap values less than 75% are shown The EMBL accession numbers of the Foxp1 amino acid sequences are as follows: human, Q9H334; rat, Q498D1; mouse, P58462; cow, A4IFD2; chicken, Q58NQ4; Xenopus laevis, Q5W1J5; zebrafish, Q2LE08 The accession numbers of the Foxp2 amino acid sequences are as follows: human, O15409; mouse, P58463; crab-eating macaque, Q8MJ97; Xenopus laevis, Q4VYS1 The accession numbers of the Foxp3 amino acid sequences are as follows: human, Q9BZS1; mouse, Q99JB6, crab-eating macaque, Q6U8D7; zebrafish, FM881778 The accession numbers of the Foxp4 amino acid sequences are as follows: human, Q8IVH2; mouse, Q9DBY0; X laevis, Q4VYR7 were subsequently identified to be protein domains important in the functioning of these transcription factors T-bet (also known as Tbox-21) belongs to the T-box family of genes, consisting of over 20 members characterized in mammals [35] They contain a conserved sequence, around 200 amino acids in length, called the ‘T-box’, which, in T-bet, is centrally located, whereas, in other members, it is located at the amino- terminus [36] This region is known to be a DNA-binding domain and is quite clearly conserved in zebrafish, as the sequence, when compared with human and mouse T-bet [11,37], shows almost complete identity in this region STAT6 (also known as IL-4-induced transcription factor) belongs to the STAT family of proteins [38] STAT proteins share structurally and functionally FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 137 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al A Human Zebrafish 500 1000 1500 2000 2500 3000 3500 B * * Human Zebrafish 1000 2000 3000 4000 5000 6000 C Human Zebrafish 500 1000 1500 2000 2500 3000 3500 Fig Comparison of the gene organization and intron ⁄ exon sizes between known T-bet (A), STAT6 (B) and Foxp3 (C) genes with zebrafish t-bet, stat6 and foxp3 The exons are drawn to scale but, because of the large size of some of the introns, they are not For stat6, potential missing human exons in zebrafish are indicated by ‘*’ The EMBL accession numbers of the T-bet genes are as follows: human, CH471109; zebrafish, FN435332 The EMBL accession numbers of the STAT6 genes are as follows: human, AF417842; zebrafish, FN435334 The EMBL accession numbers of the Foxp3 genes are as follows: human, CH471224; zebrafish, FN435333 conserved domains, including an N-terminal STAT protein interaction domain, which strengthens interactions between STAT dimers on adjacent DNA-binding sites, a coiled-coil STAT protein all-alpha domain, which is implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated tyrosine residues in the context of a longer peptide motif within a target protein [38,39] Within zebrafish stat6, there is good conservation of the protein sequence in these regions when compared with mammalian STAT6 [40,41] Also conserved in the zebrafish sequence is a tyrosine molecule (Tyr664), which is an important phosphorylation site, necessary for STAT protein activity [39] Foxp3 belongs to the fork-head box (FOX) family of proteins [42], a family of transcription factors that are both transcriptional repressors and activators It contains at least three distinct structural domains [43]: a fork-head domain at the C-terminus (a sequence of 138 80–100 amino acids forming a motif that is critical for DNA binding and nuclear localization), which is shared by all FOX proteins, a leucine zipper domain and a C2H2 zinc finger domain, both of which are thought to help mediate DNA binding and may be involved in the induction of dimerization [43] Each of these three regions appears to be present within zebrafish foxp3, as there is very good conservation of protein sequence in these regions when compared with mammalian Foxp3 In addition, within human Foxp3, there are two other domains, not found in other Foxp subfamily members and possibly specific for Treg cell biology, which are transcriptional repressor domains and [44] In mammals, these regions contain fairly high numbers of proline residues [44] Similar domains may exist in zebrafish foxp3, as there is some homology within this region, with a relatively large number of proline residues present in the potential second transcriptional repressor domain, but not in the first Inter- FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS MAGIX GPKOW WDR45 TMEM81 PREX1 KCNQ2 SP2 STAC3 R3HDM2 ATF7 ASB8 NFE2L1 PLP2 STK38 SP6 NDUFA4L2 DIP2B CDK5RAP3 PRICKLE3 SLC38A3 SCRN2 SHMT2 TMPRSS12 ATAD4 SYP WASL LRRC46 NXPH4 SCN8A PNPO CACNA1F SEMA3F MRPL10 LRP1 FIGNL2 MRPL10 CCDC22 TSPYL2 OSBPL7 foxp3 TBET tbet STAT6 C stat6 Zebrafish Chr12 23.81 Mb – 24.32 Mb OSBPL7 FOXP3 PPP1R3F PPP1R3F TBKBP1 NAB2 MIP TBKBP1 GAGE10 SUV39H1 PDK2 TMEM194 PTGES3 KPNB1 GAGE12J TMEM9 UMOD9 MYO1A DTX3 NPEPPS GAGE12D C17ORF57 MMRN2 TAC3 CACNB3A ITGB3 ZBTB39 Zebrafish Chr23 26.44 Mb – 26.95 Mb RND1 MYO1D GPR182 MYL4 Human Chr12 55.67 Mb – 55.98 Mb CACNB3B Human Chr17 42.64 Mb – 43.37 Mb CDK5R1 B CACNA1S GAGE8 GAGE12I OPN5 TAF10 GAGE2A Zebrafish Chr8 26.13 Mb – 26.68 Mb EFHD2 Human ChrX 48.82 Mb – 49.13 Mb TMEM115 A Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 GAGE8L S Mitra et al Fig Comparative gene location map of the regions in which zebrafish and human Foxp3 (A), T-bet (B) and STAT6 (C) are found The zebrafish genome assembly version (Zv8) was used for this analysis estingly, two transcripts of foxp3 were sequenced within zebrafish, with the second transcript lacking exons 5, 6, and which contain transcriptional repressor domain 2, the zinc-finger domain and the leucine-zipper domain In humans, a similar scenario exists, with two alternatively spliced isoforms of Foxp3 also being expressed, but here only exon is lacking in the short form [45] This splicing variant has not been reported in mice [44] The gene organizations of zebrafish t-bet, stat6 and foxp3 were also determined and found to be very similar to their human homologues Both the human and zebrafish T-bet and Foxp3 genes contained the same number of exons and introns t-bet contained six exons and five introns, whereas foxp3 contained 13 exons and 12 introns However, zebrafish stat6 showed some differences from the human homologue, having 21 exons and 20 introns rather than 22 exons and 21 introns This difference was found at the 3¢ end of the gene, where the zebrafish and human sequences appear to be quite diverse Together with the well-conserved gene organization, there is a conservation of synteny between the human and zebrafish genomes where the t-bet and foxp3 genes are found In contrast, there was no synteny between the human and zebrafish regions containing the stat6 gene, showing that the use of a synteny approach to look for genes may not work in all cases Studies looking at the Fugu and human genomes have shown complete conservation of gene order and content at some loci, whereas other regions demonstrate variation in the order of linked genes, or extensive differences in gene order within conserved regions [36,46,47] Nevertheless, the fact that some groups of genes have remained in close proximity during evolution and could be found within an ancestral organization some 450 million years ago, before the fish–tetrapod divergence, may potentially be of importance functionally or have evolutionary significance [47,48] The localization of zebrafish t-bet, stat6 and foxp3 expression was also investigated, and indicated that these molecules are biologically relevant to bony fish immune responses and, in particular, Th and Treg cell responses PCR analysis of zebrafish t-bet, stat6 and foxp3 detected constitutive expression in the spleen, kidney, gill, gut, liver and skin tissue of healthy fish (data not shown) Previous studies on the expression of these genes within humans and mice, of T-bet within Ginbuna crucian carp [27] and STAT6 in mandarin fish [28] have shown similar widespread expression In the case of STAT6, highest expression in mammals occurs in peripheral blood lymphocytes, colon, intestine, ovary, prostate, thymus, spleen, kidney, liver, lung and placenta [40] More specifically, it FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 139 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al il-4 A gata3 30 25 20 15 10 –5 –10 Fold change compared to unstimulated control Fold change compared to unstimulated control Fold change compared to unstimulated control stat6 35 –2 –4 –6 –8 –10 –12 PHA B LPS Poly I:C –1 –2 –3 –4 –5 PHA il-10 LPS PHA Poly I:C LPS Poly I:C foxp3 35 Fold change compared to unstimulated control Fold change compared to unstimulated control 40 30 25 20 15 10 –5 –10 PHA LPS = Spleen –1 –2 –3 –4 PHA ifn-g C LPS Poly I:C mx 20 t-bet 10 15 10 5 Fold change compared to unstimulated control Fold change compared to unstimulated control Fold change compared to unstimulated control –5 Poly I:C = Kidney –2 –4 LPS Poly I:C –1 –2 –3 –4 –5 –6 –5 PHA PHA LPS Poly I:C PHA LPS Poly I:C Fig 10 Expression of Th2 (il-4, gata3 and stat6) (A), Treg (il-10 and foxp3) (B) and Th1 (ifn-c, mx and t-bet) (C) relevant molecules in head kidney or spleen tissues stimulated with PHA, LPS or Poly I:C Pooled head kidney or spleen tissue from five fish was incubated with each stimulant at previously optimized concentrations for h, and the total RNA was recovered Following reverse transcription, the relative expression of each gene was detected by real-time PCR and normalized to the expression of gapdh The means of six replicates are shown ± SEM Differences between treatments and control groups are significant: *P < 0.05; **P < 0.01 has been shown that various unstimulated murine and human T-cells, B-cells, myeloid cells, monocytic cells and fibroblasts, but not neuronal cells or embryonic stem cells, express STAT6, indicating that this gene is expressed in haematopoietic cells and more variably in other lineages [41] The expression of T-bet has been seen within a wide variety of tissues and cells in the Ginbuna crucian carp [27] and, in mammals, in the lung tissue of mouse and spleen and thymus of human and mouse [11,37] Foxp3 is also highly expressed in lymphoid organs, such as the thymus and spleen [49], and its expression within a variety of other tissues has also been observed, although to a far lesser extent [50,51] More recently, several genome-wide human tissue expression studies [52,53] have shown that the expression of T-bet, STAT6 and Foxp3 mRNA levels is constitutive in a wide variety of unstimulated 140 human tissues taken from immune, nervous, muscle, secretory, internal and reproductive tissue, although, relative to T-bet and STAT6, Foxp3 expression is much lower Although the expression of T-bet, STAT6 and Foxp3 is not restricted to any particular cell or tissue, they are known to play a crucial role in the differentiation of naive T-cells into Th and Treg cell subsets [12] In this investigation, we attempted to correlate the expression of the transcription factors with other genes known to be expressed by T-cell subsets after the immunostimulation of zebrafish head kidney and spleen cells with PHA, LPS or Poly I:C On PHA stimulation, a correlation between il-4 and gata3 expression was seen in both the spleen and head kidney, although only in the kidney was expression significantly different stat6 showed no significant increase in either tissue STAT6, FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al GATA3 and IL-4 are all involved in Th2 cell development [54] The induction of GATA3 expression has been shown to be dependent on IL-4-stimulated STAT6 activation, although it remains unclear whether STAT6 activates GATA3 transcription directly [55] It has also been described in a number of papers that activated STAT6 is required to drive Th2-specific cytokine production, which includes IL-4, in mammals [56–58] However, in the present investigation in zebrafish, no correlation was seen between stat6 and il-4 on stimulation This is probably a result of the fact that PHA, a known T-cell mitogen, selectively induces GATA3 expression [59,60], and this is known to be sufficient to drive elevated IL-4 cytokine production and to induce Th2 differentiation [13] On LPS, but not PHA or Poly I:C, stimulation, a correlation between il-10 and foxp3 expression was seen in the spleen, with both being up-regulated significantly Foxp3 is involved in CD4+CD25+Foxp3+Treg cell development and IL-10 is an essential cytokine in the mechanism underlying immune suppression by these cells [18] A similar correlation of Foxp3 and IL-10 mRNA expression has already been observed in mammals [61], and it has been shown that LPS upregulates the expression of Foxp3 in CD4+CD25) ⁄ CD4+CD25+ cells [62,63] In addition, elevated IL-10 expression has already been found in zebrafish that have been stimulated with LPS [64] Whether the expression of these two genes directly relates to each other will require further investigation in fish, as it has been found that IL-10 is produced by other sources on stimulation LPS induces an initial burst of inflammatory cytokine synthesis in human monocytes and other cells, which is followed by substantial IL-10 production [65,66] In addition, IL-10 has been found to be expressed by B-cells [67], dendritic cells [68] and by T-cells other than Treg [69] On Poly I:C, but not PHA or LPS, stimulation, there was a good correlation between t-bet, mx and ifn-c expression, with all three being up-regulated significantly in the kidney T-bet plays an important role in Th1 development [70] and IFN-c is produced by this cell type and is known to play a critical role in driving Th1 cell responses in mammals [54,70] In humans, T-bet gene expression is found to be rapidly induced by IFN-c in lymphoid and myeloid cells [71], but not by IFN-a, LPS or IL-1, indicating that the action of IFN-c is specific In the present investigation, high ifn-c, but not t-bet, expression was observed in response to PHA, but this has also been seen in mammals, where PHA upregulates IFN-c and IL-4 [72,73] This finding probably relates to a different mechanism by which IFN-c is released Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 In conclusion, this investigation has identified three important transcription factors in zebrafish, t-bet, stat6 and foxp3, that are expected to be involved in the differentiation of T-cell subsets Our preliminary expression data suggest that these genes are involved in the fish immune response, and that there is a relationship between the expression of these transcription factors and the cytokine genes known to be produced by different T-cell subtypes in mammals These transcription factors, together with many of the important cytokines that are expressed by different T-cell subtypes [22,23], will aid future investigations into the types of Th and Treg cells that exist in teleost fish Materials and methods Sequence retrieval The zebrafish t-bet, stat6 and foxp3 sequences were found initially using the zebrafish genome (http://www.ensembl.org/Danio_rerio/) assembly version (Zv7) and, in the case of t-bet and foxp3, by exploiting the conservation of synteny between the human and zebrafish genomes Chromosomes within the zebrafish genome database were searched by basic local alignment search tool (blast) analysis [26] using amino acid sequences for human OSBPL7 and PPP1R3F, known to be located close to the T-bet gene and the Foxp3 gene, respectively, in the human genome The human STAT6 sequence was used to search for the zebrafish stat6 A zebrafish homologue for OSBPL7 was found in chromosome 12, for PPP1R3F in chromosome and for stat6 in chromosome 23 Subsequently, the DNA surrounding these genes was retrieved ( 300 000 bp) for further analysis using various sequence software programs Using Genscan [24], possible coding regions within the genomic DNA were identified, and the amino acid sequences were analysed using blast [26] and fasta [25] This analysis identified regions within the zebrafish genome that appeared to code for possible t-bet, stat6 and foxp3 homologues, and the predicted cDNA sequences were exploited by designing primers to obtain the full coding sequences of these genes cDNA production Zebrafish, Danio rerio ( 10 g), were maintained in 20 L tanks in a freshwater recirculating system at 28 °C Fish were fed frozen bloodworm twice daily The zebrafish used for initial cDNA production for the cloning of cytokine genes were anaesthetized in bezocaine (1%), killed and the spleen tissue was collected under sterile conditions The spleens were cut finely using scalpel blades and cultured in Nunc six-well plates (Fisher Scientific, Loughborough, UK) containing mL L-15 medium (Invitrogen Ltd, Renfrew, FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 141 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al UK) supplemented with 5% fetal bovine serum (Life Technologies, Paisley, UK) and Gibco 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin (Invitrogen) at 28 °C Within each well, five spleens were used and the cells were stimulated with 10 lgỈmL)1 PHA, lgỈmL)1 LPS or 50 lgỈmL)1 Poly I:C for h To prepare cDNA templates for the cloning of t-bet, stat6 and foxp3, total RNA from these stimulated spleens was extracted using RNA-stat60 reagent (AMS Biotechnology Ltd, Abingdon, UK) according to the manufacturer’s instructions Single-strand cDNA was synthesized by reverse transcription with oligodeoxythymidylate (oligodT)12–18 (Invitrogen) or adapter-dT primer (Table 2) for 3¢-rapid amplification of cDNA ends (RACE), using Bioscript reverse transcriptase (Bioline Ltd, London, UK) cDNA for 5¢-RACE was prepared by transcribing from poly(A) mRNA using an oligo-dT primer (Invitrogen), which was then treated with Escherichia coli RNase H (Promega, Madison, WI, USA) following the manufacturer’s instructions The cDNA was then purified using a PCR purification kit (Qiagen, Crawley, UK), and tailed with poly(C) at the 5¢ end using terminal deoxynucleotidyl transferase (Promega, Madison, WI, USA) following the manufacturer’s instructions The cDNA was finally diluted with 10 mm Tris ⁄ EDTA buffer (10 mm Tris, mm EDTA, pH 8.0) and stored at )20 °C before use Table Primers used to amplify zebrafish stat6, t-bet and foxp3 cDNA Primer name Sequence (5¢- to 3¢) Used for Zfstat6-F1 Zfstat6-R1 Zfstat6-F2 Zfstat6-R2 Zf3¢stat6-F1 Zf3¢stat6-F2 Zf5¢stat6-R1 Zf5¢stat6-R2 Zf3¢stat6-F3 Zf3¢stat6-F4 Zftbet-F1 Zftbet-R1 Zf3¢tbet-F1 Zf3¢tbet-F2 Zf5¢tbet-R1 Zf5¢tbet-R2 Zffoxp3-F1 Zffoxp3-R1 Zffoxp3-F2 Zffoxp3-R2 Zf3¢foxp3-F1 Zf3¢foxp3-F2 Zf5¢foxp3-R1 Zf5¢foxp3-R2 Oligo dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA GGGGGGIGGGIIGGGIIG CTCGAGATCGATGCGGCCGCT17 CTCGAGATCGATGCGGCCGC Initial PCR Initial PCR Initial PCR Initial PCR 3¢-RACE 3¢-RACE 5¢-RACE 5¢-RACE 3¢-RACE 3¢-RACE Initial PCR Initial PCR 3¢-RACE 3¢-RACE 5¢-RACE 5¢-RACE Initial PCR Initial PCR Initial PCR Initial PCR 3¢-RACE 3¢-RACE 5¢-RACE 5¢-RACE 5¢-RACE 3¢-RACE 3¢-RACE 142 Cloning and sequencing Initially, PCR was performed using the cDNA prepared above, with primers zfstat6-F1, zfstat6-R1, zfstat6-F2 and zfstat6-R2 for stat6, zftbet-F1 and zftbet-R1 for t-bet, and zffoxp3-F1, zffoxp3-R1, zffoxp3-F2 and zffoxp3-R2 for foxp3 These primers amplified part of the initial predicted sequence which contained the majority of the open reading frames of zebrafish stat6, t-bet and foxp3 to check they were correct Having isolated these partial sequences, the complete zebrafish t-bet, stat6 and foxp3 cDNA sequences were obtained using 5¢- and 3¢-RACE-PCR, with gene-specific primers Initially, 5¢-RACE-PCR was performed to amplify the 5¢ end of the stat6, foxp3 and t-bet genes using the cDNA prepared above (see section on cDNA production) The first round of PCR used zf5¢stat6-R1, zf5¢tbet-R1 or zf5¢foxp3-R1 primer (Table 2) for the stat6, t-bet and foxp3 genes, respectively, with oligo dG (Table 2) Semi-nested PCR was performed on the first-round product using zf5¢stat6-R2, zf5¢tbet-R2 or zf5¢foxp3-R2 primer (Table 2) for the stat6, t-bet and foxp3 genes, respectively, with oligo dG The 3¢ end of the stat6, t-bet and foxp3 genes was obtained using 3¢-RACE-PCR performed on the cDNA prepared above (see section on cDNA production) The first round of PCR used zf3¢stat6-F1, zf3¢tbet-F1 or zf3¢foxp3-F1 primer (Table 2) for stat6, t-bet and foxp3 genes, respectively, with the adapter primer (Table 2) Semi-nested PCR was performed on the first-round product using zf3¢stat6-F2, zf3¢tbet-F2 or zf3¢foxp3-F2 primer (Table 2) for the stat6, t-bet and foxp3 genes, respectively, with the adapter primer (Table 2) Using the above method, complete transcripts were obtained for t-bet and foxp3 Additional primers for 3¢-RACE-PCR had to be designed for stat6 (zf3¢stat6-F3 and zf3¢stat6-F4) and a semi-nested PCR performed as above to obtain the complete 3¢-UTR of zebrafish stat6 The PCR products obtained were ligated into the pGEM-T Easy vector (Promega) Following transfection into competent E coli cells (ActifMotif, Rixensart, Belgium), recombinants were identified through red–white colour selection when grown on MacConkey agar (Sigma-Aldrich, Poole, UK) Plasmid DNA from at least three independent clones was recovered using an alkaline lysis-based method [74] and sequenced using an ABI 377 Automated Sequencer (Applied Biosystems, Foster City, CA, USA) The sequences generated were analysed for similarity with other known sequences using the fasta [25] and blast [26] suite of programs Homology analysis of the amino acid sequences was performed using matgat software v2.02 [75], and multiple sequence alignments were generated using clustalx v1.81 [76] Phylogenetic relationships were constructed from clustalx v1.81-generated alignments of the full-length amino acid sequences of the known T-box, STAT and Foxp family molecules using the neighbour-joining method [77] The tree was drawn using treeview v1.6.1 [78] and confidence limits were added [79] FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 Finally, the predicted amino acid sequences were analysed using SignalP v1.1 [80], and important conserved protein domains were predicted using the NCBI Conserved Domain Database v2.16 [81] stat6, t-bet and foxp3 gene organization and chromosome synteny The zebrafish stat6, t-bet and foxp3 gene organization was elucidated by comparing the zebrafish stat6, t-bet and foxp3 cDNA obtained by PCR with zebrafish chromosomes 23, 12 and 8, respectively, using gap2 [82] Genscan, blast and fasta were used to discover a number of other genes, together with the already found genes (see section on Sequence retrieval) The order of the genes surrounding zebrafish t-bet, stat6 and foxp3 was compared with the human chromosomes in which these genes were found (http://www.ncbi.nlm.nih.gov/genome/guide/human) to determine the level of synteny conserved around the T-bet, STAT6 and Foxp3 genes Expression analysis in normal tissues PCR with t-bet, stat6 or foxp3 primer combinations (Table 3), Zftbet-F ⁄ Zftbet-R, Zfstat6-F ⁄ Zfstat6-R or Zffoxp3-F ⁄ Zffoxp3-R, respectively, was performed using spleen, head kidney, gill, gut, liver and skin cDNA as prepared above (see section on cDNA production) Primers for zebrafish b-actin, Zfbactin-F and Zfbactin-R (Table 3), Table Primers used in quantitative PCR for zebrafish stat6, t-bet and foxp3 Primer name Sequence (5¢- to 3¢) Zfbactin-F Zfbactin-R Zfgapdh-F Zfgapdh-R ZFil4-F ZFil4-R ZFmx-F ZFmx-R ZFifnc-F ZFifnc-R ZFil10-F ZFil10-R Zfgata3-F Zfgata3-R Zfstat6-F Zfstat6-R Zftbet-F Zftbet-R Zffoxp3-F Zffoxp3-R Used for CGAGCAGGAGATGGGAACC Real-time CAACGGAAACGCTCATTGC Real-time CGCTGGCATCTCCCTCAA Real-time TCAGCAACACGATGGCTGTAG Real-time CATCCAGAGTGTGAATGGGA Real-time TTCCAGTCCCGGTATATGCT Real-time TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time GCTTCTTCCTCCTCGCTGTC Real-time TGCACTCTTTGTCTTCCTGTCG Real-time CGGTAGTCAGGAAATCAATGC Real-time ATCTGTCCAATAGTCTCGTAGG Real-time ACACTGGCACTCACTGGATG Real-time CTCCTTCACCTCCACGATGT Real-time GCAACCAGCCTTTTCCACAAGC Real-time GACTATATGGATGCTTCCCAGTA Real-time PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR were used as an internal control for RT-PCR PCR conditions were as follows: one cycle of 94 °C for min, 32 cycles of 94 °C for 30 s, 54 °C for 30 s and 72 °C for 30 s, followed by one cycle of 72 °C for PCR products were separated on 1.5% agarose gels and visualized by staining the gels in TBE buffer (Promega) containing 100 ngỈmL)1 ethidium bromide (Sigma-Aldrich) RT-PCR analysis was performed on four individual fish Quantification of expressed stat6, t-bet and foxp3 genes in spleen or head kidney tissues stimulated with immunostimulants (quantitative real-time PCR) Stimulation by immunostimulants and cDNA synthesis Spleen and head kidney tissues were collected under sterile conditions from freshly killed zebrafish (90 individuals) Each spleen and head kidney was cut finely using scalpel blades and cultured in Nunc six-well plates (Fisher Scientific) containing mL L-15 medium (Invitrogen) supplemented with 5% fetal bovine serum (Life Technologies) and Gibco 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin (Invitrogen) at 28 °C In each well within a plate, either five spleens or five head kidneys were used The three plates containing the spleens or the head kidneys contained three wells that were nonstimulated and three that were stimulated with 10 lgỈmL)1 PHA, lgỈmL)1 LPS or 50 lgỈmL)1 Poly I:C for h After incubation, total RNA from these stimulated spleens and head kidneys was extracted, and single-stranded cDNA was prepared using the methods detailed above (see section on cDNA production) All cDNA was finally diluted with 100 lL of 10 mm Tris ⁄ EDTA buffer (10 mm Tris, mm EDTA, pH 8.0), and lL was used as template for PCR employing the primers described in Table Quantitative real-time PCR Real-time amplification was performed with a single batch of 2· SYBR green PCR Ready-Mix (Sigma) in glass capillaries (20 lL reaction volume) using a Light Cycler realtime PCR machine (Roche, Burgess Hill, UK) Fluorescence outputs were measured and recorded at 80 °C after each cycle for 40 cycles, and quantified by comparison with a serial 10-fold dilution of reference samples for each primer pair used Three reference samples were amplified during each run in order to ensure consistency between PCR runs PCR primers were designed so that at least one primer in each pair straddled the predicted splicing sites, and the suitability of each primer pair in real-time PCR assays was tested by conventional PCR using cDNA and genomic DNA as template Samples loaded onto an agarose gel stained with ethidium bromide confirmed primer pairs not amplifying a product from genomic DNA and confirmed FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 143 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 S Mitra et al that a band of the correct size was amplified from cDNA A negative control (no template) reaction was also performed for each primer pair tested A melting curve for each PCR was performed between 72 and 94 °C to ensure that only a single product had been amplified Expression levels of zebrafish il-4 (EMBL accession no AM403245), gata3 [83], stat6, ifn-c [84], mx [85], t-bet, il-10 [64] and foxp3, using the cDNA prepared above (see section on Stimulation by immunostimulants and cDNA synthesis), were normalized to two housekeeping genes, gapdh and bactin Both housekeeping genes showed similar expression patterns, and so gapdh was employed, and the results were expressed as the fold change compared with the expression level in the unstimulated control cells using the Pfaffl method [86] IL-4, GATA3, IFN-c, Mx and IL-10 were included alongside the genes characterized in this investigation, as they are either involved in mammalian Th1, Th2 or Treg responses or are good markers of an antiviral response 10 11 Statistical analysis The assessment of statistical significance was analysed by independent Student’s t-test Values were considered to be significant when P < 0.05 and P < 0.01 12 13 Acknowledgement This work was supported by a SORAS studentship to S.M 14 References Mosmann TR & Sad S (1996) The expanding universe of T-cell subsets: Th1, Th2 and more Immunol Today 17, 138–146 Mosmann TR, Cherwinski H, Bond MW, Giedlin MA & Coffman RL (2005) Pillars article: two types of murine helper T cell clone I Definition according to profiles of lymphokine activities and secreted proteins J Immunol 175, 5–14 Park H, Li ZX, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q et al (2005) A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17 Nat Immunol 6, 1133–1141 Bettelli E, Korn T & Kuchroo VK (2007) Th17: the third member of the effector T cell trilogy Curr Opin Immunol 19, 652–657 Ouyang WJ, Kolls JK & Zheng Y (2008) The biological functions of T helper 17 cell effector cytokines in inflammation Immunity 28, 454–467 Maloy KJ, Salaun L, Cahill R, Dougan G, Saunders NJ & Powrie F (2003) CD4(+)CD25(+) T-R cells 144 15 16 17 18 19 suppress innate immune pathology through cytokinedependent mechanisms J Exp Med 197, 111–119 Maloy KJ & Powrie F (2001) Regulatory T cells in the control of immune pathology Nat Immunol 2, 816–822 Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM & Weaver CT (2005) Interleukin 17-producing CD4(+) effector T cells develop via a lineage distinct from the T helper type and lineages Nat Immunol 6, 1123–1132 Lucas S, Ghilardi N, Li J & de Sauvage FJ (2003) IL-27 regulates IL-12 responsiveness of naive CD4(+) T cells through Stat1-dependent and -independent mechanisms Proc Natl Acad Sci USA 100, 15047– 15052 Hibbert L, Pflanz S, Malefyt RD & Kastelein RA (2003) IL-27 and IFN-alpha signal via Stat1 and Stat3 and induce T-Bet and IL-12R beta in naive T cells J Interferon Cytokine Res 23, 513–522 Szabo SJ, Kim ST, Costa GL, Zhang XK, Fathman CG & Glimcher LH (2000) A novel transcription factor, T-bet, directs Th1 lineage commitment Cell 100, 655–669 Weaver CT, Hatton RD, Mangan PR & Harrington LE (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages Annu Rev Immunol 25, 821–852 Ouyang WJ, Lohning M, Gao ZG, Assenmacher M, Ranganath S, Radbruch A & Murphy KM (2000) Stat6-independent GATA-3 autoactivation directs IL-4independent Th2 development and commitment Immunity 12, 27–37 Yamashita M, Ukai-Tadenuma M, Miyamoto T, Sugaya K, Hosokawa H, Hasegawa A, Kimura M, Taniguchi M, DeGregori J & Nakayama T (2004) Essential role of GATA3 for the maintenance of type helper T (Th2) cytokine production and chromatin remodeling at the Th2 cytokine gene loci J Biol Chem 279, 26983–26990 Zhu JF, Min B, Hu-Li J, Watson CJ, Grinberg A, Wang Q, Killeen N, Urban JF, Guo LY & Paul WE (2004) Conditional deletion of Gata3 shows its essential function in T(H)1–T(H)2 responses Nat Immunol 5, 1157–1165 Yoshimoto T, Yoshimoto T, Yasuda K, Mizuguchi J & Nakanishi K (2007) IL-27 suppresses Th2 cell development and Th2 cytokines production from polarized Th2 cells: A novel therapeutic way for Th2-mediated allergic inflammation J Immunol 179, 4415–4423 Chen Z & O’Shea JJ (2008) Th17 cells: a new fate for differentiating helper T cells Immunol Res 41, 87–102 Romagnani S (2006) Regulation of the T cell response Clin Exp Allergy 36, 1357–1366 Fontenot JD, Gavin MA & Rudensky AY (2003) Foxp3 programs the development and function of FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al 20 21 22 23 24 25 26 27 28 29 30 31 32 CD4(+)CD25(+) regulatory T cells Nat Immunol 4, 330–336 Roncarolo MG, Gregori S, Battaglia M, Bacchetta R, Fleischhauer K & Levings MK (2006) Interleukin-10secreting type regulatory T cells in rodents and humans Immunol Rev 212, 28–50 Whyte SK (2007) The innate immune response of finfish – a review of current knowledge Fish Shellfish Immunol 23, 1127–1151 Bird S, Zou J & Secombes CJ (2006) Advances in fish cytokine biology give clues to the evolution of a complex network Curr Pharm Des 12, 3051–3069 Secombes CJ, Zou J & Bird S (2009) Fish cytokines: discovery, activities and potential applications In Fish Defenses, Vol (Zaccone G, Meseguer J & GarciaAyala AK eds), pp 1–36 Science Publishers, Enfield, NH Burge CB & Karlin S (1998) Finding the genes in genomic DNA Curr Opin Struct Biol 8, 346–354 Pearson WR & Lipman DJ (1988) Improved tools for biological sequence comparison Proc Natl Acad Sci USA 85, 2444–2448 Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ (1990) Basic Local Alignment Search Tool J Mol Biol 215, 403–410 Takizawa F, Araki K, Kobayashi I, Moritomo T, Ototake M & Nakanishi T (2008) Molecular cloning and expression analysis of T-bet in ginbuna crucian carp (Carassius auratus langsdorfii) Mol Immunol 45, 127–136 Guo CJ, Zhang YF, Yang LS, Yang XB, Wu YY, Liu D, Chen WJ, Weng SP, Yu XQ & He JG (2009) The JAK and STAT family members of the mandarin fish Siniperca chuatsi: molecular cloning, tissues distribution and immunobiological activity Fish Shellfish Immunol 27, 349–359 Bird S, Zou J, Kono T, Sakai M, Dijkstra JM & Secombes C (2005) Characterisation and expression analysis of interleukin (IL-2) and IL-21 homologues in the Japanese pufferfish, Fugu rubripes, following their discovery by synteny Immunogenetics 56, 909–923 Kono T, Bird S, Sonoda K, Savan R, Secombes CJ & Sakai M (2008) Characterization and expression analysis of an interleukin-7 homologue in the Japanese pufferfish, Takifugu rubripes Febs J 275, 1213–1226 Bird S, Zou J, Savan R, Kono T, Sakai M, Woo J & Secombes C (2005) Characterisation and expression analysis of an interleukin homologue in the Japanese pufferfish, Fugu rubripes Dev Comp Immunol 29, 775– 789 Zou J, Bird S, Truckle J, Bols N, Horne M & Secombes C (2004) Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) Eur J Biochem 271, 1913–1923 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 33 Sachs AB (1993) Messenger-RNA degradation in eukaryotes Cell 74, 413–421 34 Caput D, Beutler B, Hartog K, Thayer R, Brownshimer S & Cerami A (1986) Identification of a common nucleotide-sequence in the 3¢-untranslated region of messenger-RNA molecules specifying inflammatory mediators Proc Natl Acad Sci USA 83, 1670–1674 35 Naiche LA, Harrelson Z, Kelly RG & Papaioannou VE (2005) T-box genes in vertebrate development Annu Rev Genet 39, 219–239 36 Smith J (1997) Brachyury and the T-box genes Curr Opin Genet Dev 7, 474–480 37 Zhang WX & Yang SY (2000) Cloning and characterization of a new member of the T-box gene family Genomics 70, 41–48 38 Lim CP & Cao XM (2006) Structure, function, and regulation of STAT proteins Mol Biosyst 2, 536–550 39 Chen XM, Vinkemeier U, Zhao YX, Jeruzalmi D, Darnell JE & Kuriyan J (1998) Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA Cell 93, 827–839 40 Hou JZ, Schindler U, Henzel WJ, Ho TC, Brasseur M & McKnight SL (1994) An interleukin-4-induced transcription factor – IL-4 Stat Science 265, 1701–1706 41 Quelle FW, Shimoda K, Thierfelder W, Fischer C, Kim A, Ruben SM, Cleveland JL, Pierce JH, Keegan AD, Nelms K et al (1995) Cloning of murine Stat6 and human Stat6, Stat proteins that are tyrosine-phosphorylated in response to IL-4 and IL-3 but are not required for mitogenesis Mol Cell Biol 15, 3336–3343 42 Carlsson P & Mahlapuu M (2002) Forkhead transcription factors: key players in development and metabolism Dev Biol 250, 1–23 43 Li B, Samanta A, Song XM, Furuuchi K, Iacono KT, Kennedy S, Katsumata M, Saouaf SJ & Greene MI (2006) FOXP3 ensembles in T-cell regulation Immunol Rev 212, 99–113 44 Ziegler SF (2006) FOXP3: Of mice and men Annu Rev Immunol 24, 209–226 45 Allan SE, Passerini L, Bacchetta R, Crellin N, Dai MY, Orban PC, Ziegler SF, Roncarolo MG & Levings MK (2005) The role of FOXP3 isoforms in the generation of human CD4(+) Tregs J Clin Invest 115, 3276–3284 46 Montpetit A, Wilson MD, Chevrette M, Koop BF & Sinnett D (2003) Analysis of the conservation of synteny between Fugu and human chromosome 12 BMC Genomics 4, 30, doi:10.1186/1471-2164-4-30 47 McLysaght A, Enright AJ, Skrabanek L & Wolfe KH (2000) Estimation of synteny conservation and genome compaction between pufferfish (Fugu) and human Yeast 17, 22–36 48 Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A & Talbot WS (2000) Zebrafish comparative genomics and the FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 145 Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 49 50 51 52 53 54 55 56 57 58 59 60 146 S Mitra et al origins of vertebrate chromosomes Genome Res 10, 1890–1902 Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Yasayko SA, Wilkinson JE, Galas D, Ziegler SF & Ramsdell F (2001) Disruption of a new forkhead ⁄ winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse Nat Genet 27, 68–73 Karanikas V, Speletas M, Zamanakou M, Kalala F, Loules G, Kerenidi T, Barda AK, Gourgoulianis KI & Germenis AE (2008) Foxp3 expression in human cancer cells J Transl Med 6, 19, doi:10.1186/1479-5876-6-19 Chen GY, Chen C, Wang LZ, Chang X, Zheng P & Liu Y (2008) Cutting edge: broad expression of the FoxP3 locus in epithelial cells: a caution against early interpretation of fatal inflammatory diseases following in vivo depletion of FoxP3-expressing cells J Immunol 180, 5163–5166 Shmueli O, Horn-Saban S, Chalifa-Caspi V, Shmoish M, Ophir R, Benjamin-Rodrig H, Safran M, Domany E & Lancet D (2003) GeneNote: whole genome expression profiles in normal human tissues CR Biol 326, 1067–1072 Yanai I, Benjamin H, Shmoish M, Chalifa-Caspi V, Shklar M, Ophir R, Bar-Even A, Horn-Saban S, Safran M, Domany E et al (2005) Genome-wide midrange transcription profiles reveal expression level relationships in human tissue specification Bioinformatics 21, 650–659 Murphy KM & Reiner SL (2002) The lineage decisions of helper T cells Nat Rev Immunol 2, 933–944 Ranganath S, Ouyang WJ, Bhattarcharya D, Sha WC, Grupe A, Peltz G & Murphy KM (1998) Cutting edge: GATA-3-dependent enhancer activity in IL-4 gene regulation J Immunol 161, 3822–3826 Mikita T, Campbell D, Wu PG, Williamson K & Schindler U (1996) Requirements for interleukin-4-induced gene expression and functional characterization of Stat6 Mol Cell Biol 16, 5811–5820 Kurata H, Lee HJ, O’Garra A & Arai N (1999) Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells Immunity 11, 677–688 Kubo M, Ransom J, Webb D, Hashimoto Y, Tada T & Nakayama T (1997) T-cell subset-specific expression of the IL-4 gene is regulated by a silencer element and STAT6 EMBO J 16, 4007–4020 Su RC, Becker AB, Kozyrskyj AL & HayGlass KT (2008) Epigenetic regulation of established human type versus type cytokine responses J Allergy Clin Immunol 121, 57–63 Stolte EH, Savelkoul HFJ, Wiegertjes G, Flik G & Verburg-van Kemenade BML (2008) Differential expression of two interferon-gamma genes in common carp (Cyprinus carpio L.) Dev Comp Immunol 32, 1467–1481 61 Mann MK, Maresz K, Shrives LP, Tan YP & Dittel BN (2007) B cell regulation of CD4(+)CD25(+) T regulatory cells and IL-10 via B7 is essential for recovery from experimental autoimmune encephalomyelitis J Immunol 178, 3447–3456 62 Bryn T, Yaqub S, Mahic M, Henjum K, Aandahl EM & Tasken K (2008) LPS-activated monocytes suppress T-cell immune responses and induce FOXP3+T cells through a COX-2-PGE(2)-dependent mechanism Int Immunol 20, 235–245 63 Crellin NK, Garcia RV, Hadisfar O, Allan SE, Steiner TS & Levings MK (2005) Human CD4(+) T cells express TLR5 and its ligand flagellin enhances the suppressive capacity and expression of FOXP3 in CD4(+)CD25(+) T regulatory cells J Immunol 175, 8051–8059 64 Zhang DC, Shao YQ, Huang YQ & Jiang SG (2005) Cloning, characterization and expression analysis of interleukin-10 from the zebrafish (Danio rerio) J Biochem Mol Biol 38, 571–576 65 Cao SJ, Liu JG, Song LH & Ma XJ (2005) The protooncogene c-Maf is an essential transcription factor for IL-10 gene expression in macrophages J Immunol 174, 3484–3492 66 Wanidworanun C & Strober W (1993) Predominant role of tumor-necrosis-factor-alpha in human monocyte IL-10 synthesis J Immunol 151, 6853–6861 67 Moore KW, Malefyt RD, Coffman RL & O’Garra A (2001) Interleukin-10 and the interleukin-10 receptor Annu Rev Immunol 19, 683–765 68 McGuirk P, McCann C & Mills KHG (2002) Pathogen-specific T regulatory cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: A novel strategy for evasion of protective T helper type responses by Bordetella pertussis J Exp Med 195, 221–231 69 O’Garra A & Robinson D (2004) Development and function of T helper cells Adv Immunol 83, 133–162 70 Rengarajan J, Szabo SJ & Glimcher LH (2000) Transcriptional regulation of Th1 ⁄ Th2 polarization Immunol Today 21, 479–483 71 Lighvani AA, Frucht DM, Jankovic D, Yamane H, Aliberti J, Hissong BD, Nguyen BV, Gadina M, Sher A, Paul WE et al (2001) T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells Proc Natl Acad Sci USA 98, 15137–15142 72 Asare AL, Kolchinsky SA, Gao Z, Wang R, Raddassi K, Bourcier K & Seyfert-Margolis V (2008) Differential gene expression profiles are dependent upon method of peripheral blood collection and RNA isolation BMC Genomics 9, 474, doi:10.1186/1471-2164-9-474 73 Abdalla AO, Kiaii S, Hansson L, Rossmann ED, Jeddi-Tehrani M, Shokri F, Osterborg A, Mellstedt H & Rabbani H (2003) Kinetics of cytokine gene FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS S Mitra et al 74 75 76 77 78 79 80 expression in human CD4(+) and CD8(+) T-lymphocyte subsets using quantitative real-time PCR Scand J Immunol 58, 601–606 Birnboim HC (1983) A rapid alkaline extraction method for the isolation of plasmid DNA Methods Enzymol 100, 243–255 Campanella JJ, Bitincka L & Smalley J (2003) MatGAT: an application that generates similarity ⁄ identity matrices using protein or DNA sequences BMC Bioinformatics 4, 29, doi:10.1186/1471-2105-4-29 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 Saitou N & Nei M (1987) The neighbor-joining method – a new method for reconstructing phylogenetic trees Mol Biol Evol 4, 406–425 Page RDM (1996) TreeView: an application to display phylogenetic trees on personal computers Comput Appl Biosci 12, 357–358 Felsenstein J (1985) Confidence-limits on phylogenies – an approach using the bootstrap Evolution 39, 783– 791 Nielsen H, Engelbrecht J, Brunak S & vonHeijne G (1997) Identification of prokaryotic and eukaryotic Zebrafish T-cell transcription factors t-bet, stat6 and foxp3 81 82 83 84 85 86 signal peptides and prediction of their cleavage sites Protein Eng 10, 1–6 Marchler-Bauer A, Anderson JB, Derbyshire MK, DeWeese-Scott C, Gonzales NR, Gwadz M, Hao LN, He SQ, Hurwitz DI, Jackson JD et al (2007) CDD: a conserved domain database for interactive domain family analysis Nucleic Acids Res 35, D237–D240 Huang XQ (1994) On global sequence alignment Comput Appl Biosci 10, 227–235 Neave B, Rodaway A, Wilson SW, Patient R & Holder N (1995) Expression of zebrafish Gata-3 (Gta3) during gastrulation and neurulation suggests a role in the specification of cell fate Mech Dev 51, 169–182 Zou J, Carrington A, Collet B, Dijkstra JM, Yoshiura Y, Bols N & Secombes C (2005) Identification and bioactivities of IFN-gamma in rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish J Immunol 175, 2484–2494 Altmann SM, Mellon MT, Johnson MC, Paw BH, Trede NS, Zon LI & Kim CH (2004) Cloning and characterization of an Mx gene and its corresponding promoter from the zebrafish, Danio rerio Dev Comp Immunol 28, 295–306 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR Nucleic Acids Res 29, e45 FEBS Journal 277 (2010) 128–147 ª 2009 The Authors Journal compilation ª 2009 FEBS 147 ... seen in the putative T-box DNA-binding domain of t-bet, the STAT protein interaction domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger... implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated tyrosine residues in the context of a longer peptide motif within a... expression of these genes within humans and mice, of T-bet within Ginbuna crucian carp [27] and STAT6 in mandarin fish [28] have shown similar widespread expression In the case of STAT6, highest