Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Eur J Biochem 269, 458±469 (2002) Ĩ FEBS 2002 Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens Hoang Ha Chu, Viet Hoang*, Peter Kreutzmann², Brigitte Hofemeister, Michael Melzer and Jurgen Hofemeister È Institute of Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany The use of Bacillus amyloliquefaciens for enzyme production and its exceptional high protein export capacity initiated this study where the presence and function of multiple type I signal peptidase isoforms was investigated In addition to type I signal peptidases SipS(ba) [Meijer, W.J.J., de Jong, A., Bea, G., Wisman, A., Tjalsma, H., Venema, G., Bron, S & van Dijl, J.M (1995) Mol Microbiol 17, 621±631] and SipT(ba) [Hoang, V & Hofemeister, J (1995) Biochim Biophys Acta 1269, 64±68] which were previously identi®ed, here we present evidence for two other Sip-like genes in B amyloliquefaciens Same map positions as well as sequence motifs veri®ed that these genes encode homologues of Bacillus subtilis SipV and SipW SipU-encoding DNA was not found in B amyloliquefaciens SipW-encoding DNA was also found for other Bacillus strains representing different phylogenetic groups, but not for Bacillus stearothermophilus and Thermoactinomyces vulgaris The absence of these genes, however, could have been overlooked due to sequence diversity Sequence alignments of 23 known Sip- like proteins from Bacillus origin indicated further branching of the P-group signal peptidases into clusters represented by B subtilis SipV, SipS-SipT-SipU and B anthracis Sip3-Sip5 proteins, respectively Each B amyloliquefaciens sip(ba) gene was expressed in an Escherichia coli LepBts mutant and tested for genetic complementation of the temperature sensitive (TS) phenotype as well as pre-OmpA processing Although SipS(ba) as well as SipT(ba) eciently restored processing of pre-OmpA in E coli, only SipS(ba) supported growth at TS conditions, indicating functional diversity Changed properties of the sip(ba) gene disruption mutants, including cell autolysis, motility, sporulation, and nuclease activities, seemed to correlate with speci®cities and/or localization of B amyloliquefaciens SipS, SipT and SipV isoforms The principles of protein transport through membranes are basically similar in eukaryotic and prokaryotic organisms [1], although destinations of proteins are numerous in eukaryotic cells but only few in bacterial cells, such as the cytoplasmic membrane, periplasm, outer membrane, cell wall, spore compartment, or the extracellular environment [2±4] The majority of export proteins are transported via the Sec pathway by recognition and site-speci®c processing [3±5] These export proteins carry a particular N-terminal leader (signal) peptide, which bears distinct domains (N, H and C), that are distinguished by charge and hydrophobicity pro®le [3±5] The N- and H-regions are thought to interact with the translocase machinery and to mediate membrane insertion, whereas the C-region allows sequence-speci®c cleavage by SPases and removal of the signal peptide from the precursor (export) protein [4,6±8] Minor differences between individual signal peptides, speci®c properties of the export protein precursor [5,7,9], as well as the speci®city of distinct SPases [3,10,11] affects the processing of individual or groups of export proteins The B subtilis genome sequencing project [12] has enabled computer analysis to predict that  166 proteins of the total B subtilis proteome contain a N-terminal signal peptide, characteristic for Sec export protein precursors [4] Several eubacteria and archaebacteria possess only one type I SPase functioning in Sec export protein processing [13] However, B subtilis contains ®ve chromosomally encoded type I SPases, named SipS, SipT, SipU, SipV, and SipW, respectively [4,5,14,15] Multiple type I SPases were also found in Archaeoglobus fulgidus [16], Streptomyces lividans [17], Bradyrhizobium japonicum [18,19] and Staphylococcus aureus [20] The presence of a unique type I SPase (LepB in E coli) was shown to be essential for cell viability [21,22] In contrast, B subtilis has ®ve Sip homologues, of which SipS as well as SipT isoforms were shown to be essential for cell viability, and have overlapping processing functions Double mutants Correspondence to J Hofemeister, Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstrasse 3, Gatersleben, D-06466, Germany Fax/Tel.: + 49 394825 138/241, E-mail: hofemeij@mendel.ipk-gatersleben.de Abbreviations: Ap, ampicillin; c.f.u., colony forming units; Cm, chloramphenicol; CWBP, cell wall bound proteins; Em, erythromycin; pre-OmpA, OmpA precursor protein; Sip, signal peptidase protein; SPase I, signal peptidase I (leader peptidase I); TS, temperature sensitivity; IPTG, isopropyl thio-b-D-galactoside De®nitions: SipS(ba), SipS(bj), SipT(ba), SipV(ba) and SipW(ba) are the products of the sipS(ba), sipS(bj), sipT(ba), sipV(ba), and sipW(ba) genes of Bacillus amyloliquefaciens (ba) or Bradyrhizobium japonicum (bj), respectively *Present address: George Beadle Center for Genetics, School of Biological Sciences, University of Nebraska, Lincoln, USA  Present address: Lower Saxony Institute for Peptide Research, Hannover, Germany (Received 29 May 2001, revised November 2001, accepted 13 November 2001) Keywords: Signal peptidase I; Bacillus amyloliquefaciens; protein secretion; E coli; genetic complementation Ó FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 459 were nonviable, whereas deletion of SipU, SipV and SipW, even in quadruple mutant derivatives in combination with either SipS or SipT de®ciency, was without lethal consequences This allows the distinction between Spases of major and minor importance for cell viability [13,23] These functional differences are not clearly re¯ected by sequence motifs, but likely due to unknown activities [15] Only one minor Bacillus SPase, SipW, differs in several characteristics from the group of prokaryotic (P-type) SPases, as it has pronounced similarity to (ER-type) SPases found in archea and in the ER membrane of eukaryotes [13,24,25] SipW of B subtilis displays processing speci®city for TasA, an export protein that acts from the spore membranes on spore coat assembly This study presents a ®rst example for secretion to deliver individual proteins to speci®c cellular locations, e.g during sporulation [25] In spite of this speci®city, other SPase homologues of B subtilis could apparently substitute SipW functions, as the sipW gene was dispensable for cell growth and sporulation [13,25] B amyloliquefaciens strains have only recently been ranked from B subtilis subspecies validation to a distinct taxon [26,27] Although strains of B amyloliquefaciens are among the most potent producers of industrial enzymes [28], little is known about physiological and genetic peculiarities [29] In previous studies, two SipS-like signal peptidases SipS1(ba) and SipS2(ba) of B amyloliquefaciens were described [30] and later shown to have the highest sequence similarity to SipS or SipT of B subtilis, respectively [31] These ®ndings indicated sequence, as well as mapping speci®city, of type I-SPase homologous of Bacillus species [4,14] The aim of this study was to isolate additional Sip-like genes in B amyloliquefaciens, and to evaluate differences in functions after genetic complementation in an E coli LepBts mutant and after construction of B amyloliquefaciens sip(ba) gene disruption mutants MATERIALS AND METHODS Strains and culture conditions Table lists the strains and plasmids used Bacteria were usually grown in trypton/yeast extract TBY broth or on TBY-agar [32], Spizizen minimal medium (SMM) [33] or Schaeffer's sporulation medium (SSM) [34], respectively Isopropyl thio-b-D-galactoside (IPTG, mM) was added to cultures For antibiotica selection, Bacillus cultures were supplemented with erythromycin (Em, gáL)1) and/or with chloramphenicol (Cm, gáL)1); E coli cultures were supplemented with ampicillin (Ap, 50 gáL)1), Cm (10 gáL)1) or kanamycin (20 gáL)1), respectively The spores heat resistance test was carried out according to Nicholsen & Setlow [34] Recombinant DNA techniques Chromosomal DNA from B amyloliquefaciens was prepared as described previously [33] Large-scale or minipreparations of plasmid DNA were made from E coli either by standard methods [35,36] or by using a QIAGEN plasmid isolation kit (Qiagen GmbH, Hilden, FRG) The Table Bacterial strains and plasmids used in this study Designation Strains Escherichia coli XL1blue Escherichia coli IT41 Bacillus subtilis GSB26 Bacillus amyloliquefaciens GBA12 GBA13 GBA14 GBA15 GBA16 Plasmids pUC18 pQE16 pE194 pDG148 pEAS*, pEAT*, pEAV*, pEAW* pOpac pOpacSh, pOpacTh, pOpacVh, pOpacWh, pOpacBh pTK99 pTK100 a Relevant characteristics Description/reference recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lacI, [F proAB, lacIqZDM15, Tn10(Tcr)] W3110, Lep-9ts; Tcr arol906 metB6 sacA321 str6 amyE Stratagene ALKO2718; GBA12, but GBA12, but GBA12, but GBA12, but 53 This This This This DnprE, DaprE sipS::pEAS* a sipT::pEAT* sipV::pEAV* sipW::pEAW* Apr Apr Emr, temperature- sensitive (TS) integration plasmid Kmr, Pmr, Apr, Pspac, lacI pE194, Emr::pUC18, Apr with core-DNA of sipS*(ba),sipT*,sipV*, sipW* genes, respectively pDG148 with ompA gene pDG148 with Sip(ba) expression cassettes Pspac-ompA- sip(ba)His-tag, respectively pDG148 with LepB expression cassette Pspac-ompA- lepB(ec)His-tag pJQ501, Gmr, sipS(bj) in antisenese orientation pJQ501, Gmr, sipS(bj) in sense orientation 22 32 study study study study Stratagene QIAGEN 41 40 This study This study This study This study 19 19 The symbol:: indicates the insertion of a respective pEA* integration plasmid at a homologous chromosomal sip gene locus 460 H H Chu et al (Eur J Biochem 269) same procedures were applied for B subtilis or B amyloliquefaciens except that for plasmid isolation, cells were prepared in lysis buffer with lysozyme (4 gáL)1) at 37 °C, incubated for The digestion and ligation of DNA were performed with various restriction enzymes and T4 DNA ligase, following the supplier's instructions The general molecular cloning techniques and DNA electrophoresis were carried out essentially as described by Sambrook et al [36] and Ausubel et al [35] DNA fragments were prepared from agarose gels using the QIAEX gel elution kit (Qiagen) E coli was transformed with competence treatment [36] B subtilis was transformed either after competence treatment [33] or protoplast formation [37] The latter method was also used to transform B amyloliquefaciens, except that prior to transformation, the DNA was occasionally treated with BamHI methylase Alternatively, plasmid DNA was transformed into B amyloliquefaciens by electroporation [38] DNA sequencing and sequence analysis DNA sequencing was performed by an automated system (A.L.F express, Pharmacia), using the recommended primers for the pGEM-T and pUC18 vector, with the AutoRead sequencing kit (Pharmacia) Sequence analysis was performed with the PC/GENE software from IntelliGenetics, Inc (Mountain View, Calif.) and DNA-STAR software from Lasergene Inc (Madison, WI, USA) The BLAST software (National Center for Biotechnology Information, Bethesda, MD, USA) was used for online database scanning Phenetic and cladistic analyses of the amino-acid alignment were performed in PAUP* 4.0b8 [39] Mean character differences were used to calculate pairwise distances, which were clustered with the NeighborJoining algorithm Fitch parsimony analysis was conducted with ACCTRAN character optimization, with the gaps treated as missing data and the heuristic search algorithm with 100 random sequence additions To test the statistical support of the branches in phenetic and cladistic analyses, bootstrap resamples were conducted with 5000 and 500 replicates, respectively Parsimony analysis resulted in two equally parsimonious trees of 1388 steps length (CI 0.7177, RI 0.6631), which are compatible with the tree topology obtained by the Neighbor-Joining analysis Plasmid and mutant constructions For Sip protein expression and processing studies plasmids pOpacSh, pOpacTh, pOpacVh, and pOpacWh were constructed These plasmids contain within the vector pDG148 [40], the ompA as well as the respective sip(ba)gene for IPTG-inducible expression of pre-OmpA and Sip proteins in one single cassette, essentially as follows: Pspac-ompAsipHis-tag-Ppen-lacI A PCR fragment carrying the ompA gene was ampli®ed from E coli chromosomal DNA using primers Omp1 and Omp2 (Table 2) This ompA DNA was cloned into vector pUC18 and after digestion with HindIII and EcoRI, cloned into pDG148 vector to obtain the plasmid pOpac (Table 1) The respective sip(ba) genes were isolated from initial cloning vectors and cloned into the vector pQE16 in frame with the His-tag-encoding sequence The lepB gene was PCR ampli®ed from E coli Ó FEBS 2002 DNA using the primers Lep1 and Lep2 (Table 2), and then cloned into the pQE16 vector After restriction enzyme digestion of pQE derivated plasmids (pQSh, pQTh, pQVh, pQWh, pQBh), the His-tagged genes (sipSh, sipTh, sipVh, sipWh, and lepBh) were isolated and each cassette was cloned into the pOpac vector to obtain the OmpA-Sip/Lep expression plasmids (pOpacSh, pOpacTh, pOpacVh, pOpacWh, and pOpacBh) The integrative plasmids pEAS*, pEAT*, pEAV* and pEAW* used for construction of the B amyloliquefaciens sip gene disruption mutants were formed as follows: a core DNA fragment covering an internal portion of the respective sip gene was ampli®ed using chromosomal DNA of B amyloliquefaciens and the respective gene-speci®c, internal primers (Table 2) These PCR fragments were cloned into the pUC18 vector and the resulting pUC18-sip construct ligated into the PstI site of the temperature sensitive (TS) plasmid pE194 After the transformation of ALKO2718 cells with one respective integrative plasmid (see above), integration mutants were isolated by Em selection at 42 °C [41] Several Em and heat resistant colonies of each mutant progeny were isolated and tested for integration of the sip::pE* cassette after PCR ampli®cation The construction scheme of mutant strains GBA13 (sipS::pEAS*), GBA14 (sipT::pEAT*), GBA15 (sipV:: pEAV*) and GBA16 (sipW::pEAW*) is shown in Fig Pulse-chase protein labelling, immunoprecipitation, SDS/PAGE and ¯uorography The pulse-chase labelling method was carried out as described by Edens [42] The preculture of each strain was grown at 30 °C to D600  0.5, and then divided into cultures A and B, each of mL After incubation for 10 at either 30 °C or 42 °C, the two cultures were labelled for at the indicated temperature by the addition of 35S[methionine] (50 mCiáL)1) and chased by the addition of nonradioactive methionine and cysteine (2.5 gáL)1) Samples were collected at intervals and after the addition of mL trichloroacetic acid, kept on ice for 30 Polyclonal anti-OmpA Ig was used to precipitate the protein Assay for cell autolysis Cultures of wild-type and mutant strains of B amyloliquefaciens were grown in TBY medium to D600  0.6 After addition of 0.05 M sodium azide, cell lysis was followed spectrophotometrically while continuing incubation at 37 °C and agitation at 200 r.p.m [43] Cell-wall-bound protein (CWBP) extraction, and autolysin detection after SDS/PAGE Cell wall substrate was isolated from exponential growing B amyloliquefaciens cells according to Harwood et al [44] The CWBP extract was prepared from vegetative B amyloliquefaciens cells according to Blackman et al [43], except that cells were desintegrated by ultrasonication Autolysin activities were performed after SDS/PAGE, and enzymography was assayed after renaturation of gels as described by Foster [45] using B amyloliquefaciens vegetative cell wall as the substrate Ó FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 461 Table Oligonucleotide primers used for PCR Name 5 đ 3 Sequencea Description CH1 CH2 CH5 CH6 CH7 CH8 HV11 U1 V1 V2 V3 V4 V5 V6 V7 V8 V9 W1 W2 W7 W8 W9 W10 W11 W12 S1 S2 T1 T2 Lep1 Lep2 Omp1 Omp2 Uni1 Uni2 CAYTTYGGNGCNGGNAAYATNGG CAYGGNWSNGCNCCNGAYATNGCNGG ATGATHGCNGCNYTNATHTTYACNAT TTYTAYAARCCNTTYYTNATHGARGG TCYTCNSWNGGCATNCCCATNCCRTT TTNGCYTGNCKCATYTCNCCRAANGG TTRTCNCCCATNACRAARTA TTGAAYGCNAARACNATHACNYTNAARAA TTGAARAARMGNTTYTGGTTYYTNGC GTNTTYATNGTYTAYAARGTNGARGG TCNGCRTCNSWNATNACNCCNACNAT GCCAAAACAACGATAAGCACGCC GGATTCATGCTGATTCCTTCGAC ACTTGGCACTACACCGCACCTCATGCG ATTTCGTGATTGGCGACAACCGC GAGAATTCCGGAGGGGGACAGGAATCTTG GCAGATCTCTTGGCGTATGATTCACTGAT GGNWSNATGGARCCNGARTTYAAYACNGG TCNGCNGCNGCRTTRTTRTCNCCYTTNGT TTGTGTAAAAGTGATGACATCGCC GTGATCCCGATTATTCTGTGTGTT GGCGATGTCATCACTTTTACACAA AACACACAGAATAATCGGGATCAC GAGAATTCAAAAGAAAGCGGGGAAGAA CGAGATCTTGTGGACATGGTCCCGTTTC CGGAATTCGCTAATGGGAGGAAATCAC TACAGATCTTTTCGTCTTGCGAATTTC CAGAATTCGTCTAGGAGGAACCACGTT GCGAGATCTTTTTGTCTGACGCATATC CAGCAATTGACCCTTAGGAGTTGGCAT GATGGATCTATGGATGCCGCCAATG GCAAAGCTTATTTTGGATGATAACGAGGCG GCGAATTCCTACCAGACGAGAACTTAAGCC GTTTTCCCATGCACGAC GTAAAACGACGGCCAGT Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV Construction of pOpacVh Construction of pOpacVh Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Construction of pOpacWh Construction of pOpacWh Construction of pOpacSh Construction of pOpacSh Construction of pOpacTh Construction of pOpacTh Construction of pOpacBh Construction of pOpacBh Construction of pOpac Construction of pOpac Primer for pUC18 Primer for pUC18 a The IUPAC-code was used; N denotes an inosine residue DNase detection after SDS/PAGE Supernatant proteins of respective cultures were trichloroacetic acid-precipitated, collected, washed and separated by 12% SDS/PAGE containing calf thymus DNA (10 mgáL)1) according to the method described by Rosenthal & Lacks [46] Electron microscopy For the primary ®xation, cells of B amyloliquefaciens were kept for h at room temperature in 50 mM cacodylate buffer (pH 7.2), containing 0.5% (v/v) glutaraldehyde and 2.0% (v/v) formaldehyde After washing, the samples were subjucted to a secondary ®xation [1 h in a solution of 1.0% (w/v) OsO4 in 50 mM cacodylate buffer] Prior to dehydration, the cells were washed and transferred into 1.5% agar Dehydration, embedding and cutting of mm3 agar blocks was performed as previously described [47] The ultrathinsections were contrasted with a saturated methanolic solution of uranyl acetate and lead citrate prior to exam- ination in a Zeiss CEM 920 A transmission electron microscope at 80 kV RESULTS Cloning of a sipV-like gene PCR reactions with genomic DNA of B amyloliquefaciens and primers V1, V2, and V3 (Table 2) for regions MKKRFWFLA, VFIDYKVEG, and IVGVISDAE of the B subtilis SipV protein were chosen and found to generate PCR fragments of about 0.5 and 0.4 kb, respectively (Fig 1,A1) Moreover, Southern hybridization with the 0.5 kb-PCR fragment as a probe indicated that the genomic DNA of B amyloliquefaciens contains speci®cally hybridizing DNA The previously described RAGE protocol [30] was used to PCR amplify and clone a corresponding DNA region (Fig 1,A2) A BLAST search of the nucleotide sequence of the ampli®ed DNA fragment revealed the presence of three ORFs, the deduced proteins having 70, 77, and 67% identity to proteins encoded by the yhjE-sipV-yhjG 462 H H Chu et al (Eur J Biochem 269) Ó FEBS 2002 Fig Identi®cation of the sipV(ba) and sipW(ba) gene regions of B amyloliquefaciens (A1/B1) PCR reactions with genomic DNA of B amyloliquefaciens and the degenerative primers V1/V3 and V2/V3 or W1 and W2, led to the isolation of core DNA fragments of about 0.5 kb (lane b) and 0.4 kb (lane c), or 0.2 kb, respectively (A2/B2) The respective 0.5 or 0.2 kb-DNA fragments were used as a probe for Southern hybridization of either PstI (lane a) or EcoRI (lane b) digested chromosomal DNA in case of sipV or HindIII (lane a) or EcoRI-SacI (lane b) digested genomic DNA in case of sipW Hybridization indicated DNA fragments of about 2.5 and 1.6 kb or 0.8 and 1.2 kb, respectively Each digest indicated one speci®c signal and suggested the existence of sipV or sipW like genes in B amyloliquefaciens (A3/B3) The RAGE protocol [30] was used for PCR ampli®cation as follows: The DNA of B amyloliquefaciens was cut with either PstI and EcoRI in case of sipV or EcoRI-SacI in case of sipW and ligated into corresponding sites of pUC18 DNA The ligation mixes were used for PCR with oligo nucleotides Uni1 or Uni2 and pairs of primers V6/V7 and V4/V5 or W9/W10 and W11/W12 (Table 2) for forward or reverse reactions, respectively The latter were chosen according the indicated regions within the 0.5 kb- or 0.2 kb-PCR fragments from step A1 or step B1 The PCR fragments were cloned and sequenced Ultimate PCR led to fragments covering 1.2 or 1.3 kb of DNA, respectively The nucleotide sequence was submitted to GenBank and given the accession number AF085497 or AF084950, respectively The detected open reading frames are indicated genes of B subtilis, respectively (Fig 1,A3) Thus, ¯anking ORFs indicated the B amyloliquefaciens sipV(ba) gene to occupy a similar genomic position as compared to sipV(bs) of B subtilis [12] Search for sipU Several attempts were made, but failed to identify a sipU homologous gene in B amyloliquefaciens The degenerate primers U1, CH5, CH6 and HV11, CH7, and CH8 (Table 2) based on several regions (MNAKTITLKK, MIAALIFTI, FKPFLIEG, YFVMGDN, NGMGMPSED, PFGEMRQAK) were chosen, which were most speci®c for the B subtilis SipU, when compared to other Sip proteins In nine independent primer combinations, parallel PCR ampli®cation reactions were carried out with genomic DNA from B subtilis 168 or B amyloliquefaciens Although the former template always resulted in the generation of a DNA fragment of the expected size, no ampli®cation products were obtained with B amyloliquefaciens DNA (data not shown) In extension, the forward primers CH1 and CH2 were designed for conserved regions HFGAGNIG and HGSAPDIAG of the genes mtlD and ycsA, which map in B subtilis upstream of the searched sipU, and used in combination with reverse primers HV11, CH7 and CH8 Speci®c ampli®cation Ĩ FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 463 Fig Abundance of sipW- like DNA in several Bacillus species representing di€erent 16S rRNA phylogenetic groups [26,48] Group 1, B subtilis (13), B amyloliquefaciens (1), B circulans (2), B lentus (3), B licheniformis (4), B megaterium (5), B thuringiensis (6); From group 2, B sphaericus (7); From group 3, B macerans (8), B polymyxa (9); From group 4, B brevis (10); From group 5, B stearothermophilus (11); Thermoactinomyces vulgaris (12) PCR was under standard conditions using about lg of genomic DNA and primers W1 and W2 (Table 2) The brightness of DNA bands correlates with the amount of PCR product per run products were obtained with DNA of B subtilis, but not with DNA of B amyloliquefaciens (data not shown) Southern hybridization experiments with a 0.4-kb DNA fragment for a sipU-speci®c probe, that had been PCR ampli®ed with primers CH5 and CH7 from B subtilis DNA (Table 2) were carried out with B subtilis as well as B amyloliquefaciens genomic DNA Even at low stringency, B amyloliquefaciens yielded no hybridizing band, but with DNA from B subtilis 168, a positive band appeared (data not shown) Cloning of a sipW-like gene In order to isolate a sipW-like gene from B amyloliquefaciens a similar strategy as outlined in Fig was followed PCR ampli®cation was done with degenerative primers W1 and W2 according to conserved regions VLSGSMEPEFNTG and TKGDNNAAAD of B subtilis SipW (Fig 1,B1) The core DNA fragment of about 0.2 kb, was in Southern hybridization experiments found to hybridize with B amyloliquefaciens DNA (Fig 1,B2) Subsequent RAGE ampli®cation with B amyloliquefaciens genomic DNA and primers W7, W8 and W9, W10 (Table 2), as well as a ®nal ampli®cation step with terminal primers yielded a DNA fragment of 1.3 kb The nucleotide sequence demonstrated the presence of three ORFs, and the deduced proteins to have 42, 73, and 82% of identity to Fig E coli LepBts complementation after Sip(ba) protein expression (A) Growth of E.coli IT41 transformants containing following plasmids: (s), pTK100; (r), pOpacBh; (.), pOpacSh; pTK99; (d), pOpacTh; (j), pOpacVh; (h), pOpacWh The cultures were grown in TBY medium at 42 °C without IPTG Di€erent transformant colonies were used in repeated experiments (B) Processing of pre-OmpA in E coli IT41 was analysed after pulse-chase labelling, immunoprecipitation, SDS/PAGE and ¯uorography Samples were withdrawn at the intervals indicated p, precursor; m, mature protein (a), IT41/pOpac; (b), IT41/pTK100; (c), pOpacSh; (d), pOpacTh; (e), pOpacVh or (f), pOpacWh, respectively (C) Expression of His-tagged Bacillus SipS(ba) proteins in E coli IT41 was detected by Western blotting Lanes 1/2, 3/4, 5/6 and 7/8 refer to His-tagged Sip(ba) protein detection in cells with SipS(ba), SipT(ba), SipV(ba) or SipW(ba) expression either grown without or with the addition of IPTG at 30 °C 464 H H Chu et al (Eur J Biochem 269) Fig Scheme of construction of sip(ba) gene disruption mutants of B amyloliquefaciens The integrative plasmids pEAS*, pEAT*, pEAV* and pEAW* were transformed into ALKO2718 cells, and integration was achieved after several rounds of cultivation with Em selection at 42 °C [41] Campbell-type integration of the 6.3 kb-DNA cassette disrupted the respective sip(ba) gene Integration of the sip::pE* cassette at the desired sip(ba) gene locus was con®rmed after PCR ampli®cation using primers with speci®city for either chromosomal DNA outside of the integration cassette or pUC18 primer Uni1 (Table 2) The relative positions and orientation of open reading frames (amp and ery stand for antibiotic resistance genes of the plasmids) as well as proposed tanscription terminator elements (t) are shown Ó FEBS 2002 plasmids pOpacSh, pOpacTh, pOpacVh, and pOpacWh, was basically as follows: Pspac-ompA-sipHis-tag-Ppen-lacI, whereby the C-terminal His-tag enabled immunodetection of Sip protein expression (Fig 3) For a control, the LepB protein of E coli was His-tagged and the gene likewise cloned on plasmid pOpacBh The plasmids pTK100 and pTK99, carrying a sipS-like gene of Bradyrhizobium japonicum in either sense or antisense orientation [19] served for an additional control E coli IT41 transformants were maintained at 30 °C After growth in TBY with or without IPTG expression of Sip(ba)- and LepB- proteins were in respective transformants con®rmed by immunodetection using His-tag antibodies (Fig 3) Without IPTG induction, IT41 transformants with expression of LepB, SipS(ba), or SipS(bj) of B japonicum revealed growth at 42 °C, but not with SipT(ba), SipV(ba) or SipW(ba) (Fig 3) Moreover, all Sip(ba) expressing IT41 cultures, grow signi®cantly slowed after IPTG addition indicating overexpression lethality (data not shown) Processing of pre-OmpA was thus studied without IPTG induction at the non permissive temperature and found in SipS(ba) and SipT(ba) expressing IT41 cultures, but not with SipV(ba) or SipW(ba) expression (Fig 3) Sip disruption mutants proteins encoded by yqxM-sipW-tasA genes of B subtilis, respectively (Fig 1,B3) This map position also indicated the B amyloliquefaciens sipW(ba) gene to be similar to sipW(bs) of B subtilis [12] Abundance of sipW-encoding DNA in diverse Bacillus groups After successful application of primers W1 and W2 for PCR ampli®cation of a sipW gene homologue from B amyloliquefaciens (Fig 1B), the same strategy was applied to search for the abundance of similar genes in other, distantly related Bacillus species Genomic DNA of several species, including at least one strain of each Bacillus 16S rRNA-phylogentic group [26,48], was used to carry out the above mentioned PCR approach The abundance of the sipW-like genes was indeed con®rmed for distantly related Bacillus species, but not found in DNA of B stearothermophilus and Thermoactinomyces vulgaris (Fig 2) The latter might have been overlooked due to primer speci®city Genetic complementation of an E coli lepBts mutant E coli strain IT41, a lep-9 Tetr P1 transductant of E coli W3110, contains an amber mutation in the lepB gene Due to heat sensitivity of its type I-signal peptidase LepB [22], the mutant stops growth and accumulates precursor proteins, i.e of pre-OmpA, at non permissive temperature conditions It has been repeatedly shown that growth of this mutant at high temperature can be restored after transformation with lepB-like genes from Gram-negative as well as Grampositive bacterial origin, i.e of Bradyrhizobium japonicum [18,19], Staphylococcus aureus [20], Streptococcus pneumoniae [49] and Streptomyces lividans TK21 [17] In order to verify the functionality of the four Sip(ba) proteins, the SPases and OmpA were coexpressed in a single expression cassette in this E coli mutant The expression cassette of In order to study the phenotype of sipS(ba), sipT(ba), sipV(ba) and sipW(ba) mutants, B amyloliquefaciens strains GB13, GBA14, GBA15 and GBA16 were grown and tested under certain conditions Inspecting the changed characters of the mutants, it should be stressed that secondary mutant allels (see Material and methods), translation of front portions of each sip gene as well as promoter activities on downstream genes from the large DNA insert (Fig 4), are unlikely but ®nally not excluded Growth and protein secretion The growth of sip(ba) mutants was compared at either 37 or 45 °C in TBY and SMM medium Under each condition, the sipV(ba) mutant exhibited slower growth rate, compared to the wild type and other sip(ba) mutant strain (data not shown) The yields of protein secreted after 24 h of growth in TBY medium as well as the protein changed banding pattern were compared after SDS/PAGE (data not shown) Although the total protein of sipS(ba) and sipT(ba) mutants, was about 30% lower compared to wild type cultures, slab gel SDS/PAGE was not suf®cient to demonstrate more than vague differences which might correlate with a distinct sip(ba) gene de®ciency (data not shown, but see Fig 6) Sporulation In order to study the effect of sip(ba) gene disruption on sporulation, strains were grown in SSM for 8±48 h at 37 °C and respective samples tested for heat resistant c.f.u Under these conditions, wild-type cultures contained after 24 and 48 h about 25 and 43% of spores, respectively No signi®cant differences were observed for sipS(ba), sipV(ba) and sipW(ba) mutant cultures, whereas spores were rarely found at frequencies of about 0.001% in the sipT(ba) Ó FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 465 Fig Electron microscopy of B amyloliquefaciens wild type (A) and SipT(ba) mutant forespore structures (B) Cells were collected after h of growth in SSM and processed for ultrathin-section electron micrography as described in Materials and methods mutant cultures These experiments were several times repeated This distinct gene disruption was always found to correlate with low spore frequencies and cell lysis of SSM cultures after h of growth (data not shown) The few sporulating cells from sipT(ba) mutant cultures in this incubation period exhibited the structure of stage III forespores and exhibited obvious abnormalities in either coat or cortex structures (Fig 5) The progeny from SMM cultures without antibiotica selection, was Em sensitive to about 80%, and exhibited restored spore frequencies (data not shown) This correlation underlined sipT(ba) gene disruption to correlate with spore formation de®ciency Autolysis and cell motility Fig Cell autolysis, CWBP pattern and autolysin activities of B amyloliquefaciens and of sip(ba) mutants (A) Sodium azide (0.05 M) was added to exponential-phase TBY-cultures (D600 ˆ 0.5±0.6) Cell lysis was followed spectrophotometrically at 600 nm (d) wild type GBA12; (s), sipS(ba) mutant GBA13; (.), sipT(ba) GBA14; (,), sipV(ba) mutant GBA 15; (j) sipW(ba) mutant GBA16 (B) SDS/ PAGE separation of the CWBP fraction of B amyloliquefaciens GBA12 and sipV(ba) mutant GBA15 (a) and enzymography of autolysin activities after renaturing SDS/PAGE of gels containing puri®ed B amyloliquefaciens cell wall material as substrate (b) Sample preparation is described in Methods and renaturation of the SDS/ PAGE gel was according to Foster [45] Lane 1, GBA15; lane 2, GBA12 The arrows indicate protein bands reduced or lacking in the mutant The labels a1 and a2 point to autolysins which are most signi®cantly a€ected The data are from one representative experiment after three times of repetition Microscopical inspection of stationary cultures indicated cells of the sipV(ba) mutant to grow in TBY as ®laments, while cultures of the wild-type and other mutants grow as rod shaped cells This observation indicated a de®ciency in either cell division or cell wall formation We therefore compared the mutants for cell autolysis, cell motility as well as autolysin activities of puri®ed CWBP fractions by SDS/PAGE After the addition of sodium azide (0.05 M) cultures of the sipV(ba) mutant were exceptionally less affected by autolysis, compared to wild-type and the other sip(ba) mutants (Fig 6) As changed cell autolysis was expected to correlate with changed cell motility [43], the halo diameter of colonies of wild type and mutant cultures was compared after plating on soft agar and growth at 25 or 37 °C The sipV(ba) mutant colonies in the average had swarming halo diameters of  49% compared to the diameter of wild type as well as other mutant colonies, except that of the sipW(ba) mutant, which was reduced to about 70% (data not shown) CWBP preparations of wild type and mutant cells were analysed for autolysin activities after SDS/PAGE and enzymography (Fig 6) The CWBP pattern of sipV(ba) mutant cells was indeed found to differ with respect to the presence and the relative amount of several CWBP's However, at least one out of about ®ve major autolysin activities of wild type cells, which runs in a double band of proteins of about 35 kDa was missing Nuclease activities Occasionally we observed that after plasmid isolation higher yields of DNA could be obtained from distinct mutants The respective sipS(ba) and sipT(ba) mutants were therefore suspected to have either changed content of plasmid DNA or reduced DNA degradation due to loss or reduction of nuclease activities A pronounced zone of nuclease activity was after SDS/PAGE and enzymography found in 466 H H Chu et al (Eur J Biochem 269) Fig Enzymogram of nuclease activity of culture supernatant of B amyloliquefaciens sip(ba) mutants Aliquots (50 lL) of cell-free supernatant of 24 h TBY-cultures of wild type GBA12 (1) mutant strains sipS(ba) GBA13 (2), sipT(ba) GBA14 (3), sipV(ba) GBA 15 (4) and sipW(ba) GBA 16 (5) were separated after 12% SDS/PAGE containing calf thymus DNA (10 mgáL)1) The gel was renatured and stained with ethidium bromide The bright areas indicate zones of DNA hydrolysis the area of 30 kDa-proteins of supernatant fractions of wild type and several sip(ba) mutant cultures This nuclease activities were strongly reduced in the sipT(ba), about nearly lacking in the supernatant of sipS(ba) mutant cultures (Fig 7) In spite of numerous attempts to purify that suspected nuclease, likely due to low protein concentration, it could not be isolated from wild type cultures Consequently, the identity of the suspected nuclease activity, even of its export protein character has not been veri®ed DISCUSSION Here we present evidence for the existence of sipV- and sipW-like genes in chromosomal DNA of B amyloliquefaciens as compared to B subtilis [12] The similarity of the deduced proteins, conserved sequence motifs, the protein length, as well as same neighbourhood of genes, also con®rm gene homology with sipV and sipW of B subtilis as previously shown for SipS(ba) and SipT(ba) of B amyloliquefaciens [12,13,23,30,31] In contrast, sipU-encoding DNA was not found Although, its absence could have been overlooked due to sequence diversity, one of these two species might have gained or lost a sipU-type gene paralogue after evolutionary constrains [1] Variation of the sip gene multiplicity was already indicated by the presence of additional plasmidal sipP genes in Bacillus strains [5,31] In this study, SipW-encoding DNA was ampli®ed from 10 out of 12 strains representing four distant 16S rRNAgroups of the phylogenetic Bacillus tree [26,48], but not found in group strains B stearothermophilus and Thermoactinomyces vulgaris As indicated for SipU, the PCR approach could have also been failed due to DNA sequence Ó FEBS 2002 diversity of these remote Gram-positive spore- forming bacilli [27] Diversity of paralogous Sip proteins is also indicated from phenetic distance analysis as illustrated in Fig As much as 23 Bacillus Sip proteins known from B subtilis, B amyloliquefaciens, B licheniformis, B stearothermophilus, B caldolyticus, B halodurans and B anthracis were included The Neighbor-Joining algorism was used to compare the Bacillus sequences with E coli LepB and yeast Sec11 ER-type SPase The phylogenetic tree strengthen the distinction between P- and ER-type SPases as previously proposed [13], but also the clustering of P-type Sip proteins into at least three subgroups represented by B subtilis SipV-, SipS,T,U- and B anthracis Sip3,5-like SPases, respectively This analysis showed close relationship between Sip proteins of B amyloliquefaciens and B subtilis as well as their relatedness to other SPases, where the Sipisoforms of these two Bacillus species Basically these data are similar to those of van Roosmalen et al [15], where 15 different SPases were included and the authors claimed the distinction between major and minor SPases upon similar phylogenetic analyses According to our data, which include additional SPases from B halodurans, as well as from B anthracis, the given criteria for major and minor SPases might differ from one species to another For instance, SipV(Bha) of B halodurans, apparently plays the role of a major SPase, but according to its phylogenetic character would not belong to the group of major SPases With respect to their group character of Sip isoforms, it was asked, whether SPases of one group genetically complement each other more likely, than SPases from another group Each of the four Sip(ba) proteins was in a LepBts mutant of E coli tested for its ef®ciency to restore de®ciencies of LepB, i.e the complementation of the mutant TS phenotype as well as pre-OmpA processing Only SipS(ba) and SipT(ba) were active in processing pre-OmpA, while SipV(ba) and SipW(ba) failed The lack of processing activities of the latter correlates with enhanced degradation, as indicated by degradation products of the SipV(ba) as well as SipW(ba) protein from E coli after immunodetection (Fig 3) These observation could re¯ect inactivation by selfcleavage of these SPases in E coli, as it was shown for a truncated SipS(ba) protein lacking its unique N-terminal membrane anchor [50] The processing data might be compared to the processing activities of their B subtilis homologues in E coli, tested with the pre(A13i)-b-lactamase precursor, where SipV was also inactive [14] Moreover, the growth of the LepBts mutant was only restored after SipS(ba) but not after SipT(ba) expression These likely re¯ects differences in the speci®city or capacity to cope with the range of growth-limiting LepB processing functions These differences for the ®rst time demonstrated differences between SipS- and SipT-like SPases with respect to their activities in E coli and could be due to their different mode of membrane insertion as well as enzyme activities [15,50] Mutant studies in E coli implemented LepB to be essential [21,22], while in B subtilis, heat inactivation of SipSts in a SipT mutant background, i.e a SipS/SipT double de®ciency, had lethal consequences [5,13] So far, no distinct phenotype was found to distinguish B subtilis sip mutants, although SipW activities in pre-TasA processing and transport into B subtilis endospores provided a ®rst example of speci®cation of this SPase isoform for spore- Ĩ FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 467 Fig Unrooted phenogram of the Neighbor± Joining analysis of known Bacillus Sip proteins including Saccharomyces cerevisiae Sec11_Sce (NP012288) The Bacillus Sip proteins analysed are: B amyloliquefaciens SipS_Bam (P41026), SipT_Bam (P41025), SipV_Bam (AAF02219), SipW_Bam (AAF02220); B subtilis SipS_Bsu (P28628), SipT_Bsu (G69707), SipU_Bsu (I39890), SipV_Bsu (A69708), SipW_Bsu (B69708), pTA1015 (I40470), pTA1040 (I40552); B halodurans SipV_Bha (BAB04749), SipW_Bha (BAB05849); B licheniformis Sip_Bli (CAA53272); B caldolyticus Sip_Bca (I40175); B anthracis Sip1_Ban, Sip2_Ban, Sip3_Ban, Sip4_Ban, Sip5_Ban, SipW_Ban; B stearothermophilus Sip1_Bst, Sip2_Bst (preliminary sequence data from the website http://www.tigr.org) The length of each pair of branches represents the distance between sequence pairs and bootstrap values are given The cluster of major SPases as de®ned by Roosmalen et al [15] is circled speci®c protein sorting [13,24,25] Inactivation of either SipS or SipT in B subtilis just decreased the total yields of export proteins compared to the wild type, as it was also found in B amyloliquefaciens to  30% (data not shown) All of the B amyloliquefaciens Sip(ba) disruption mutants were viable, but some had impaired growth, sporulation and cell division properties Strict correlation of a distinct mutant phenotype with that distinct sip gene disruption, as well as restoration of the mutant phenotype after spontaneous excision of the insertion cassette from B amyloliquefaciens mutants, strongly indicated gene disruption to correlate with the distinct mutant de®ciencies, which were preliminary analysed Disruption of sipT(ba) in B amyloliquefaciens correlated with a drastic reduction of sporulation and rare forespores stalled in stage III development with apparently changed cortex or coat structures [45] Similar, sporulation de®ciency of B subtilis sipT-sipV double-deletion mutants have been reported [51] These two ®ndings would suggest a distinct role of those SPases in the processing and export of sporulation-related proteins in both species The same might be true for export of a not yet de®ned nuclease in B amyloliquefaciens, which was most affected by sipS(ba), and to a lesser extend also by sipT(ba) gene disruption The respective nuclease of B amyloliquefaciens is apparently not a homologue of the 12 kDa-B subtilis extracellular NucB [52], as the size of the protein was about 30 kDa Its nature remains unknown, as any attempt to isolate the protein from B amyloliquefaciens failed (data not shown) Moreover, impaired growth, inhibited cell autolysis and reduced motillity speci®ed sipV(ba) mutants Indeed, changed pattern of CWBP's as well as loss of at least one (major) 35-kDa autolysin correlated with SipV(ba) de®ciency In B subtilis, LytC (50 kDa amidase), LytD (90 kDa glucosaminidase) or a sigD controlled (minor) 49-kDa autolysin are shown to change cell wall turnover, septation, cell lysis as well as swarming motility [43] An autolysin of B amyloliquefaciens might correlate with that distinct SipV(ba) mutant phenotype which seems to differ from known autolysins of B subtilis [12,45] In summary, more detailed studies are required to explain the mystery of multiple Sip proteins with more or less different characters in various Bacillus species As B amyloliquefaciens strains have only recently ranked to a distinct taxon [26,27], the indicated differences of B amyloliquefaciens Sip candidates compared to B subtilis homologues could indicate these species have slightly changed characters of their processing apparatus with respect to the presence and specialization of Sip protein homologous ACKNOWLEDGEMENTS We thank Susanne Konig and Christian Horstmann for nucleotide and È amino acid sequencing, and Renate Manteu€el for preparation of antibodies, respectively Peter Muller kindly provided plasmids pKT99 È 468 H H Chu et al (Eur J Biochem 269) and pKT100 as well as valuable data about sipS genes of B japonicum Roland Freudl kindly provided the anti-OmpA- antibodies We are indebted to Adam Driks for helpful comments about forespore structures as well as Frank Blattner's professional help with phylogentic analyses The work was funded by grants from the Bundesministerium fur Bildung, Wissenschaft, Forschung und Technologie BEO 0319689 È and HO 1494 from the Deutsche Forschungsgemeinschaft REFERENCES Pohlschroder, M., Prinz, W.A., Hartmann, E & Beckwith, J È (1997) Protein translocation in the three domains of life: variations on a theme Cell 91, 563±566 Dricks, A (1999) Bacillus subtilis spore coat Microbiol Mol Biol Rev 63, 1±20 Driessen, A.J., Fekkes, P & van der Wolk, J.P (1998) The Sec system Curr Opin Microbiol 1, 216±222 Tjalsma, H., Bolhuis, A., Jongbloed, J., Bron, S & van Dijl, J.M (2000) Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of the secretome Mirobiol Mol Biol Rev 64, 515±547 Bron, S., Bolhuis, A., Tjalsma, H., Holsappel, S., Venema, G & van Dijl, J.M (1998) Protein secretion and possible roles for multiple signal peptidases for precursor processing in Bacilli J Biotechnol 64, 3±13 Akita, M., Sasaki, S., Matsuyama, S & Mizushima, S (1990) SecA interacts with secretory proteins by recognizing the positive charge at the amino terminus of the signal peptide in Escherichia coli J Biol Chem 265, 8164±8169 Ng, D.T., Brown, J.D & Walter, P (1996) Signal sequences specify the targeting route to the endoplasmic reticulum membrane J Cell Biol 134, 269±278 van Voorst, F & De Kruij€, B (2000) Role of lipids in the translocation of proteins across membranes Biochem J 347, 601±612 Wu, L.F., Chanal, A & Rodrigue, A (2000) Membrane targeting and translocation of bacterial hydrogenases Arch Microbiol 173, 319±324 10 Dalbey, R.E., Lively, M.O., Bron, S & van Dijl, J.M (1997) The chemistry and enzymology of the type I signal peptidases Protein Sci 6, 1129±1138 11 Paetzel, M., Dalbey, R.E & Strynadka, N.C (2000) The structure and mechanism of bacterial type I signal peptidases A novel antibiotic target Pharmacol Ther 87, 27±49 12 Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A., Borchert, S et al (1997) The complete genome sequence of the Gram-positive bacterium Bacillus subtilis Nature 390, 249±256 13 Tjalsma, H., Bolhuis, A., van Roosmalen, M.L., Wiegert, T., Schumann, W., Broekhuizen, C.P., Quax, W., Venema, G., Bron, S & van Dijl, J.M (1998) Functional analysis of the secretory precursor processing machinery of Bacillus subtilis: identi®cation of an eubacterial homolog of archaeal and eukaryotic signal peptidases Genes Dev 12, 2318±2331 14 Tjalsma, H., Noback, M.A., Bron, S., Venema, G., Yamane, K & van Dijl, J.M (1997) Bacillus subtilis contains four closely related type I signal peptidases with overlapping substrate speci®cities: constitutive and temporally controlled expression of di€erent genes J Biol Chem 272, 25983±25992 15 van Roosmalen, M.L., Jongbloed, J.D.H., Dubois, J.-Y.F., Venema, G., Bron, S & van Dijl, J.M (2001) Distinction between major and minor Bacillus signal peptidases based on phylogenetic and structural criteria J Biol Chem 276, 25230± 25235 16 Klenk, H.P., Clayton, R.A., Tomb, J.F., White, O., Nelson, K.E., Ketchum, K.A., Dodson, R.J., Gwinn, M., Hickey, E.K., Peterson, J.D et al (1997) The complete genome sequence of the Ó FEBS 2002 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus Nature 390, 364±370 Parro, V., Schacht, S., Anne, J & Mellado, R.P (1999) Four genes encoding di€erent type I signal peptidases are organized in a cluster in Streptomyces lividans TK21 Microbiology 145, 2255±2263 Bairl, A & Muller, P (1998) A second gene for type I signal È peptidase in Bradyrhizobium japonicum, sipF, is located near genes involved in RNA processing and cell division Mol Gen Genet 260, 346±356 Muller, P., Ahrens, K., Keller, T & Klaucke, A (1995) A TnphoA È insertion within the Bradyrhizobium japonicum sipS gene, homologous to prokaryotic signal peptidases, results in extensive changes in the expression of PBM-speci®c nodulins of infected soybean (Glycine max) cells Mol Microbiol 18, 831±840 Cregg, K.M., Wilding, I & Black, M.T (1996) Molecular cloning and expression of the spsB gene encoding an essential type I signal peptidase from Staphylococcus aureus J Bacteriol 178, 5712± 5718 Date, T (1983) Demonstration by a novel genetic technique that leader peptidase is an essential enzyme of Escherichia coli J Bacteriol 154, 76±83 Inada, T., Court, D.L., Ito, K & Nakamura, Y (1989) Conditionally lethal amber mutations in the leader peptidase gene of Escherichia coli J Bacteriol 171, 585±587 Tjalsma, H., van den Dolder, J., Meijer, J.J., Venema, G., Bron, S & van Dijl, J.M (1999) The plasmid-encoded signal peptidase SipP can functionally replace the major signal peptidase SipS and SipT of Bacillus subtilis J Bacteriol 181, 2448±2454 Serrano, M., Zilhao, R., Ricca, E., Ozin, A.J., Moran Jr, C.P & Henriques, A.O (1999) A Bacillus subtilis secreted protein with a role in endospore coat assembly and function J Bacteriol 181, 3632±3643 Stover, A.G & Driks, A (1999) Secretion, localization, and È antibacterial activity of TasA, a Bacillus subtilis spore-associated protein J Bacteriol 181, 1664±1672 Priest, F.G (1993) Systematic and ecology of Bacillus In Bacillus subtilis and Other Gram-Positive Bacteria (Sonenshein, A.L., Hoch, J.A & Losick, R., eds), pp 3±16 American Society for Microbiology, Washington, DC Stackebrandt, E., Ludwig, W., Weizenegger, M., Dorn, S., McGill, T., Fox, G.E., Woese, C.R., Schubert, W & Schleifer, K.-H (1987) Comparative 16S rRNA oligonucleotide analyses and murein types of round-spore-forming bacilli and non-sporeforming relatives J General Microbiol 133, 2523±2529 Debabov, V.G (1982) The industrial use of bacilli In The Molecular Biology of the Bacilli (Dubnau, D.A., ed.), pp 331±370 Academic Press, Boston Bron, S., Meima, R., van Dijl, J.M., Wipat, A & Harwood, C (1999) Molecular biology and genetics of Bacillus spp In Manual of Industrial Microbiology and Biotechnology (Demain, A.L & Davies, J.E., eds), pp 392±416 ASM Press, Washington, DC Hoang, V & Hofemeister, J (1995) Bacillus amyloliquefaciens possesses a second type I signal peptidase with extensive sequence similarity to other Bacillus SPases Biochim Biophys Acta 1269, 64±68 Meijer, W.J.J., de Jong, A., Bea, G., Wisman, A., Tjalsma, H., Venema, G., Bron, S & van Dijl, J.M (1995) The endogenous Bacillus subtilis (natto) plasmids pTA1015 and pTA1040 contain signal peptidase- encoding genes: identi®cation of a new structural module on cryptic plasmids Mol Microbiol 17, 621±631 Hofemeister, B., Konig, S., Hoang, V., Engel, J., Mayer, G., È Hansen, G & Hofemeister, J (1994) The gene amyE (TV1) codes for a nonglucogenic a-amylase from Thermoactinomyces vulgaris 94±2A in Bacillus subtilis Appl Environ Microbiol 60, 3381±3389 Cutting, S.M & Horn, P.B.V (1990) Genetic analysis In Molecular Biology Methods for Bacillus (Harwood, C.R & Cutting, S.M., eds), pp 66 John Wiley & Sons Ltd, New York Ó FEBS 2002 Signal peptidases of B amyloliquefaciens (Eur J Biochem 269) 469 34 Nicholsen, W.L & Setlow, P (1990) Sporulation, germination and outgrowth In Molecular Biological Methods for Bacillus (Harwood, C.R & Cutting, S.M., eds), pp 391±450 John Wiley & Sons Ltd, New York 35 Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A & Struhl, K (1995) Current Protocols in Molecular Biology John Wiley & Sons, Inc, New York 36 Sambrook, J., Fritsch, E.J & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 37 Chang, S & Cohen, S.N (1979) High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA Mol Gen Genet 168, 111±115 38 Vehmaanpera, J (1989) Transformation of Bacillus amyloÈ liquefaciens by electroporation FEMS Microbiol Lett 61, 165± 170 39 Swo€ord, D.L (2001) PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods), Version Sinauer Associates, Sunderland, Massachusetts 40 Stragier, P., Bonamy, C & Karmazyn-Campelli, C (1988) Processing of a sporulation sigma factor in Bacillus subtilis: How morphological structure could control gene expression Cell 52, 697±704 41 Hofemeister, J., Israelis-Reches, M & Dubnau, D (1983) Integration of plasmid pE194 at multiple sites on the Bacillus subtilis chromosome Mol Gen Genet 189, 58±68 42 Edens, L., Heslinga, L., Klok, R., Ledeboer, A.M., Maat, J., Toonen, M.Y., Visser, C & Verrips, T (1982) Cloning of cDNA encoding the sweet-tasting plant protein thaumatin and its expression in Escherichia coli Gene 18, 1±12 43 Blackman, S.A., Smith, T.J & Foster, S.J (1998) The role of autolysins during vegetative growth of Bacillus subtilis 168 Microbiology 144, 73±82 44 Harwood, C.R., Coxon, R.D & Hancock, I.C (1990) The Bacillus cell envelope and secretion In: Molecular Biological Methods for Bacillus (Harwood, C.R & Cutting, S.M., eds), p 374 John Wiley & Sons Ltd, New York 45 Foster, S.J (1992) Analysis of the autolysins of Bacillus subtilis 168 during vegetative growth and di€erentiation by using renaturing polyacrylamide gel electrophoresis J Bacteriol 174, 464±470 46 Rosenthal, A.L & Lacks, S.A (1977) Nuclease detection in SDSpolyacrylamide gel electrophoresis Anal Biochem 80, 76±90 47 Meyer, S., Melzer, M., Truernit, F., Hummer, C., Besenbeck, R., È Stadler, R & Sauer, R (2000) AtSUC3, a gene encoding a new Arabidopsis sucrose transporter, is expressed in cells adjacent to the vascular tissue and in a carpel cell layer Plant J 24, 869±882 48 Ash, C., Farrow, J.A., Dorsch, M., Stackebrandt, E & Collins, M.D (1991) Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA Int J Syst Bacteriol 41, 343±346 49 Zhang, Y.B., Greenberg, B & Lacks, S.A (1997) Analysis of a Streptococcus pneumoniae gene encoding signal peptidase I and overproduction of the enzyme Gene 194, 249±255 50 van Roosmalen, M.L., Jongbloed, J.D.H., Kuipers, A., Venema, G., Bron, S & van Dijl, J.M (2000) A truncated soluble Bacillus signal peptidase produced in Escherichia coli is subject to selfcleavage at its active site J Bacteriol 182, 5765±5770 51 Jiang, M., Grau, R & Perego, M (2000) Di€erential processing of propeptide inhibitors of Rap phosphatases in Bacillus subtilis J Bacteriol 182, 303±310 52 van Sinderen, D., Kiewiet, R & Venema, G (1995) Di€erential expression of two closely ralated deoxyribonuclease genes, nucA and nucB Bacillus subtilis Mol Microbiol 15, 213±223 53 Vehmaanpera, J., Steinborn, G & Hofemeister, J (1991) Genetic È manipulation of Bacillus amyloliquefaciens J Biotechnol 19, 221±240  ... Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV... Cloning of sipV Cloning of sipV Cloning of sipV Construction of pOpacVh Construction of pOpacVh Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW... Construction of pOpacWh Construction of pOpacWh Construction of pOpacSh Construction of pOpacSh Construction of pOpacTh Construction of pOpacTh Construction of pOpacBh Construction of pOpacBh Construction