Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... Sampieri, F. (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian sodium channel: sequence and circular dichroism study. ... mammals and can acts on the a- andb-sites of the mammalian sodium channel [44]. Therefore, whether Tyr31 is related Table 2. The amounts of aconitine r...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

... MW.Custom- made software and hardware were used for acquisition and analysis of data. Leakage and linear capacity currents were subtracted by using P/4 protocols. Data were sampled once every 5 ls and ... shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio, and the sample size per cRNA combination is shown in parenthesis. Data are from five differe...

Ngày tải lên: 16/03/2014, 23:20

9 415 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... inflammation [27] and oncogenic transformation [28,29]. BLAST analysis of the mouse and human genome databases allowed us to identify an unknown sialyltrans- ferase gene encoding a second Galb1–4GlcNAc ... analysed by radio-imaging. Multiple tissue expression array and northern analysis An EcoRI–BamHI 1.6 kb fragment of the human ST6Gal II cDNA and a 1.8 kb human...

Ngày tải lên: 08/03/2014, 08:20

12 584 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... technical assistance and helpful discussion and to Dr Gabriella Fiorentino, Dr Pietro Amodeo and Dr Francesca Maria Pisani for critical reading of this manuscript. This work was grant-aided by the ... best of our knowledge, Rep245 typifies the shortest functional domain from a crenarchaeal plasmid endowed with DNA and RNA synthesis and terminal transferase activity. Abb...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

... the cement apparatus of three adult sessile barnacles, Elminius modestus, Balanus balanoides and Balanus haemri. Mar Biol 7, 239–248. 21 Lacombe D (1970) A comparative study of the cement glands ... Bicp-19k M. rosa, B. improvisus and B. albicostatus were collected from Miyako Bay (Iwate), Yodo River (Osaka) and Shi- mizu Bay (Shizuoka, Japan), respectively. RNA and DNA ma...

Ngày tải lên: 16/03/2014, 05:20

11 488 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... such as the spi- der toxin x-agatoxin [10], C-type natriuretic peptide from the Australian platypus [11], fulicin from Afri- can giant snails [12], and contryphan from cone snails (Table 2). The ... crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations as well as assig...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... the a- anomer and the b-anomer at equilibrium. The other panels show the results of partial hydrolysis of (GlcNAc) 6 and (Glc- NAc) 5 by chitinase G (ChiG). In these panels, substrates display the 60 ... chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six subsites [26,30]. However, the catalyti...

Ngày tải lên: 07/03/2014, 11:20

12 400 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... been identified and can be divided into CHH -A and CHH-B groups [19]. In the crabs Can- cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus clarkii and Orconec- tes ... were allowed to anneal by mixing equal amounts of each strand, heating to 100 °C for 1 min, and cooling gradually to room temperature for 3–4 h. Single-stranded RNAs and th...

Ngày tải lên: 23/03/2014, 10:20

9 486 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... with a Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse ... lanes 3–5). A lar- ger amount of the 54 kDa polypeptide was generated from the GmPDIL- 3a mRNA with the AUG2 muta- tion (Fig. 1B, lanes 4 and 5) than from that contain-...

Ngày tải lên: 18/02/2014, 11:20

12 622 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

... 5¢-GACGACGACAAGATGGAG GAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGA AGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ for GmPDIL-1, and 5¢-GACGACGACAAGATGCTCACCGA CGACGAGGACC-3¢ and 5¢-GAGGAGAAGCCCGGTTC ATAATTCATCCTTCACATC-3¢ ... sequence data for the cDNA of GmPDIL-1 and GmPDIL-2 and genomic GmPDIL-1 and GmPDIL-2 are available in the DDBJ ⁄ EMBL ⁄ GenBank databases under accession numbers AB18...

Ngày tải lên: 07/03/2014, 05:20

15 424 0
w