Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis Melissa C Miles1, Michelle L Janket1, Elizabeth D A Wheeler1, Ansuman Chattopadhyay2, Biswanath Majumder1, Jeremy DeRicco1, Elizabeth A Schafer1 and Velpandi Ayyavoo1 Department of Infectious Diseases & Microbiology, Graduate School of Public Health, University of Pittsburgh, PA, USA Health Sciences Library System, University of Pittsburgh, PA, USA Keywords ANKHD1; ankyrin repeats; apoptosis; cell survival; HIV-1 Vpr Correspondence V Ayyavoo, Department of Infectious Diseases and Microbiology, Graduate School of Public Health, University of Pittsburgh, 130 DeSoto Street, Pittsburgh, PA 15261, USA Fax: +1 412 624 5612 Tel: +1 412 624 3070 E-mail: Velpandi@pitt.edu (Received 16 May 2005, revised June 2005, accepted 14 June 2005) doi:10.1111/j.1742-4658.2005.04821.x Multiple ankyrin repeat motif-containing proteins play an important role in protein–protein interactions ANKHD1 proteins are known to possess multiple ankyrin repeat domains and a single KH domain with no known function Using yeast two-hybrid system analysis, we identified a novel splice variant of ANKHD1 This splice variant of ANKHD1, which we designated as HIV-1 Vpr-binding ankyrin repeat protein (VBARP), does not contain the signature KH domain, and codes for only a single ankyrin repeat motif We characterized VBARP by molecular and functional analysis, revealing that VBARP is ubiquitously expressed in different tissues as well as cell lines of different lineage In addition, blast searches indicated that orthologs and homologs to VBARP exist in different phyla, suggesting that VBARP might be evolutionarily conserved, and thus may be involved in basic cellular function(s) Furthermore, biochemical analysis revealed the presence of two VBARP isoforms coding for 69 and 49 kDa polypeptides, respectively, that are primarily localized in the cytoplasm Functional analysis using short interfering RNA approaches indicate that this gene product is essential for cell survival through its regulation of caspases Taken together, these results indicate that VBARP is a novel splice variant of ANKHD1 and may play a role in cellular apoptosis (antiapoptotic) and cell survival pathway(s) The ankyrin repeat motif (ANK) is one of the most common protein motifs found in the protein database The ankyrin repeat is a 33-amino acid motif present in repeats of 12–24 and first identified in yeast and Drosophila [1] Ankyrin-repeat-containing proteins regulate multiple cellular functions including transcriptional regulation, cell-cycle regulation, ion channel, cell survival, and cell signaling [2–4] In addition, ankyrin repeat proteins also participate in protein–protein interactions via their repeat motifs [5,6] Using yeast two-hybrid system analysis, we identified a protein containing a single ankyrin repeat that interacts with HIV-1 viral protein R (Vpr) and we designated this protein as Vpr-binding ankyrin repeat protein (VBARP) This interaction was further confirmed by a mammalian hybrid system as well as in vivo interaction Abbreviations ANK, ankyrin repeat motif; ANKHD1, ankyrin repeat and KH domain 1; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; HEK293, human embryonic kidney 293; hMASK, human multiple ankyrin repeats single KH domain; NLS, nuclear localization signal; ORF, open reading frame; PBL, peripheral blood leukocytes; PBMC, peripheral blood mononuclear cells; RPLPO, ribosomal protein large protein; RTK, receptor tyrosine kinase; siRNA, short interfering RNA; UTR, untranslated region; VBARP, Vpr-binding ankyrin repeat protein FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4091 Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and to an unknown protein named PP2500 [7,8] Although ANKHD1 variants have been identified by several human genome sequencing groups, no known function has been identified for these proteins ANKHD1 is a large protein containing multiple ankyrin repeats and a single KH domain It is derived from an kb transcript, with a predicted molecular mass of > 280 kDa The gene is present in human chromosome 5q31.3 as a single copy To differentiate the variants of ANKHD1, NCBI has classified three transcript variants that code for three unique isoforms of ANKHD1 Our clone, VBARP, codes for two open reading frames (ORF) of 1.9 and 1.35 kb, each with an identical poly(A) tail These two cDNAs were designated VBARP-L (1.9 kb) and VBARP-S (1.35 kb), respectively Both VBARP-L and VBARP-S variants have high homology to PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S are comprised of 11 and exons, respectively However, although these two variants utilize many of the same exons, VBARP-S lacks a portion of exon and a 5¢ untranslated region (UTR) that can be found in VBARP-L Results from functional analyses indicate that these transcripts are ubiquitously expressed in human tissues and cell lines at different levels Specific loss of the VBARP transcripts induced by short interfering RNA (siRNA) caused apoptosis via caspase activation, indicating a potentially important role for these proteins in cell survival Taken together, these results suggest that HIV-1 Vpr interaction with VBARP might disrupt the cell survival pathway thus leading to host cell apoptosis Results Identification of VBARP as HIV-1 Vpr-interacting protein The HIV-1 Vpr-interacting protein, VBARP, was identified using the yeast two-hybrid system as previously described [9] A 915-bp fragment was initially identified and further confirmed through both repetitions of the yeast two-hybrid assay and using a mammalian hybrid system (Invitrogen, Carlsbad, CA) (EDA Wheeler & V Ayyavoo, unpublished data) A blast search revealed that the IMAGE clone, localized in chromosome 5q31.3, was fully homologous to the 915-bp fragment and revealed a possible full-length clone 4092 M C Miles et al containing multiple variants These variants, one measuring 1881 bp (designated VBARP-L) and a second 1305 bp clone (designated VBARP-S), were constructed and used to further confirm the Vpr and VBARP interaction using in vitro and in vivo interaction studies Ten microliters of 35S-labeled in vitro translated VBARP and Vpr or Nef (as control) products were mixed and immunoprecipitated with VBARP-, Vpr- or Nef-specific antibody and analyzed by autoradiography (Fig 1A) Results indicate that both Vpr and VBARP were able to form a complex and the complex was pulled by VBARP and Vpr antibodies, respectively, whereas VBARP and Nef did not form a complex, indicating that the interaction between VBARP and Vpr is specific The input panel represents the amount of protein used in this assay indicating that an equal amount of protein was used in all our samples and that the lack of interaction between VBARP and Nef is not due to the lack of input proteins To further confirm that a physical interaction exists between Vpr and VBARP in vivo, we tested this interaction in HEK293 T cells expressing Vpr and VBARP by cotransfecting Vpr and VBARP-His using calcium phosphate transfection Forty-eight hours post transfection, the cells were lysed and the whole cell proteins were extracted One hundred micrograms of total protein were used for immunoprecipitation (IP) using anti-Vpr (Fig 1B, lanes 1–3) or anti-His (lanes 1–3) IgG The bound proteins were eluted and subjected to western blot analysis using anti-His and anti-Vpr IgG As shown in Fig 1B, interaction of Vpr with VBARP was detected by the IP followed by immunoblotting, further confirming the specificity of this interaction Based on these results we were able to demonstrate the formation of a complex between Vpr and VBARP Characterization of VBARP variants The two VBARP clones differed only in the 5¢-end where VBARP-L consisted of a 576-bp fragment absent from the shorter VBARP-S and contained a 114-bp UTR (Fig 2A) Intron and exon analysis of VBARP revealed that VBARP-L and VBARP-S contain 11 and exons, respectively (Fig 2B) Interestingly, both clones shared the latter eight exons with corresponding splice donor and acceptor sites found in the genomic clone VBARP-L contained an additional three exons totaling 576 bp with a 114 bp 5¢-UTR, whereas VBARP-S started with a portion of exon (41 bp) with no known 5¢-UTR The NCBI Geneview website predicted exons from the targeted full genomic sequence attributing to the discrepancies in numbers (i.e exon 1, 2, 4, ) observed in Fig 2B, suggesting FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS M C Miles et al Molecular characterization of ANKHD1 splice variant A Fig Interaction of Vpr and VBARP proteins in vitro and in vivo (A) In vitro translated 35S-labeled VBARP-His isoforms were incubated with Vpr or Nef and immunoprecipitated using a-His (lanes 1–3), a-Vpr (lanes 4–6) or a-Nef (lanes 7–9) antibodies and resolved on SDS ⁄ PAGE Arrows indicate the respective protein size (Inset) In vitro translated products of VBARP isoforms, Vpr and Nef used in coimmunoprecipitation assay (B) Total cell lysates were prepared from HEK293T cells transfected with Vpr, VBARP-L, VBARP-S or control vector plasmids One hundred micrograms protein equivalent of cell lysates was used in IP followed by western blot utilizing antiVpr and anti-His IgG (A, B) In parallel, 50 lg of total cell lysates from the same samples were detected by western blot assay to detect the input protein (Input) Arrows depict the position of the VBARP-L, VBARP-S and Vpr B that alternate exons, designated as 3, 5, and 11, may code for additional splice variants Analysis with spidey software, another tool for intron ⁄ exon determination, generated an identical exon map, confirming the data presented in Fig 2B that VBARP-L and VBARP-S are coded by these specific exons VBARP-L and VBARP-S code for precursor proteins of 627 and 435 amino acids and with calculated peptide masses of 69 and 49 kDa, respectively Additional domain mapping revealed that the predicted structure of VBARP does not contain signal peptide(s) or transmembrane domains phd software, available from the Predict Protein server, suggested that the structure of VBARP-L is predominantly helical with multiple loops (helix, 55%; coil, 3%; loop, 42%) Sequence analysis using prosite motif scan and netphos software, also predicted the presence of several potential serine, threonine, and tyrosine FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS phosphorylation sites (cAMP, PKC, and CK2), and the presence of nine potential myristoylation sites in the VBARP protein (Fig 2C) psort software predicted with high accuracy the subcellular localization of VBARP, and indicated that it is a cytoplasmic protein The Expert Protein Analysis System predicted that this protein belongs to the family of ankyrin repeat proteins (Fig 2C) Comparative analysis of VBARP ankyrin repeats with other known ankyrin repeat proteins, using the consensus established by Kohl et al [10] and Mosavi et al [11], which contains ankyrin repeats from over 4000 proteins, indicated that the ankyrin repeat domains in VBARP exhibit a high homology to those present in the consensus within the conserved, semiconserved and the nonconserved regions of the ankyrin motifs (data not shown) Sequence homology searches indicated that VBARP shares strong homology across many phyla, including 4093 Molecular characterization of ANKHD1 splice variant M C Miles et al A B C Fig (A) Schematic representation of VBARP-L and VBARP-S in comparison with ANKHD1 variant (B) Exon–intron analysis of VBARP isoforms Exons and introns present in VBARP-L and VBARP-S are represented as boxes with numbers The length in base pairs of each exon is marked on top of the boxes representing the exons Exon numbers are derived from the genomic sequence, after designating the first coding exon number and counting all other exons located at this site (C) Predicted post-translational modification and domain distribution of VBARP-L translated amino acid sequences The grayshade regions in the amino acid sequence of VBARP-L protein represent the presence of ankyrin (ANK) repeats, amino acids underlined indicate predicted phosphorylation sites, and dark shaded regions represent the predicted N-myristylation sites proteins from mouse, rat, Drosophila and Anopheles Multiple sequence alignment of these orthologous proteins revealed the presence of a conserved region of human VBARP-L protein that shared 84% similarity with mouse, 69% similarity with rat, 46% similarity with Drosophila melanogaster and 48% similarity with Anopheles gambiae Interestingly, all the compared species contained the 12 ankyrin repeat domains and exhibited high homology between them, suggesting a conserved function for this protein Identification of VBARP splice variants in normal human tissue To precisely quantitate the amount of VBARP in different tissues and cell lines, real time RT-PCR was 4094 performed Total RNA was extracted from the brain, spleen, lymph node, liver, cervix, muscle and kidney, and real-time RT-PCR was carried out in triplicate using ANKHD1 ⁄ VBARP isoform primer and probe sets Based on human genome sequencing, ABI has identified and constructed several primer probe sets at multiple intron–exon junctions to quantitate the variants We used three sets of primers ⁄ probe to distinctly identify the 8.0 kb ANKHD1, 1.9 kb VBARP-L and MASK-BP3 (splice variant of ANKHD fused with BP3) Using RNA derived from multiple tissues we quantitated the various transcripts of VBARP using real-time PCR (Fig 3A) Human ribosomal large protein (RPLPO), a housekeeping gene, was used as an internal control and all ratios are presented relative to RPLPO Results indicate that FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS M C Miles et al Molecular characterization of ANKHD1 splice variant A B Fig (A) RNA expression of VBARP in various human tissues using real-time RT-PCR Total RNA was extracted from different human tissues and reverse transcribed Real-time PCR was carried out in triplicate The expression level of VBARP was normalized to the level of RPLPO control for each sample (B) mRNA expression of VBARP in various cell lines using real-time RT-PCR Total RNA was extracted from different human cell lines and reverse transcribed Real-time PCR was carried out in triplicate The expression level of VBARP was normalized to that of RPLPO control for each sample Each panel represents primers and probes that were used to specifically detect ANKHD1, VBARP-L and MASK-BP3 by Applied Biosystems All analyses were performed in triplicate ANKHD1 isoform (codes for an 8.0 kb transcript) exhibits a high ratio in cervix tissue followed by spleen, brain and lung Other tissues such as kidney, lymph node, and muscle expressed relatively low levels of ANKHD1 isoform In the case of VBARP-L isoforms, spleen showed the highest level (3.89 ratio) followed by lung, lymph node and kidney Interestingly, muscle and brain were almost negative, indicating that there is a differential expression of these transcripts within different human tissues Interestingly, MASKBP3 exhibits a different profile confirming the presence of these variants at different levels in multiple tissues Next, we tested several human primary and established cell lines of different lineages for the presence of the above three isoforms (Fig 3B) Results indicated that VBARP-L is present in most of the tested cell lines with varying amounts with the highest expression level in dendritic cells (ratio of 8), followed by PBMC and PBL It is interesting to note that among the different cell lines tested, primary lymphocytes (PBL, PBMC) express higher level compared with the immortalized T-cell line CEMx174 However, we have been unable to identify a cell line that is negative for VBARP-L transcript FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS Expression and biochemical characterization of VBARP The predicted sizes of the proteins encoded by VBARP-L and VBARP-S are 69 and 49 kDa, respectively To test this, C-terminal V5-tagged VBARP-L and VBARP-S constructs were translated in vitro, immunoprecipitated with anti-V5 IgG, and the protein products were resolved on an 8% SDS ⁄ PAGE gel (Fig 4A) The VBARP constructs expressed the predicted molecular mass protein, however VBARP-S expressed an additional, equally intense band slightly higher than the predicted 49 kDa band The additional protein resolved at  55 kDa, suggesting that VBARP-S might be modified post-translationally Next, the expression of the VBARP clones was tested in vivo using HEK293T cells HEK293T cells were transfected with VBARP-L, VBARP-S or pcDNA3.1 vector plasmids using calcium phosphate Forty-eight hours post transfection, cells were lysed and subjected to western blot analysis using anti-V5 IgG, and developed using the ECL kit (Amersham Biosciences, Piscataway, NJ) (Fig 4B) Results indicated that both VBARP-L and VBARP-S expressed the predicted molecular mass of protein similar to the in vitro 4095 Molecular characterization of ANKHD1 splice variant A B Fig Expression of VBARP isoforms in vitro and in vivo: (A) In vitro transcription ⁄ translation of VBARP-L and VBARP-S One microgram of VBARP-L, VBARP-S and vector plasmid was in vitro transcribed ⁄ translated using 35S-methionine as described in Experimental procedures In vitro translated products were immunoprecipitated with anti-V5 IgG, resolved in an 8% SDS ⁄ PAGE and autoradiographed (B) Expression of VBARP using transient transfection system: HEK293T cells were transfected with lg of VBARP-L, VBARP-S and vector plasmids and immunoblotted with anti-V5 IgG Lanes are represented with the respective plasmid used on the top and the markers are labeled on the left Arrows indicate specific gene products translated product Furthermore, VBARP-S exhibited protein products of 49 and 55 kDa, further confirming the possibility of post-translational modifications and ⁄ or splice variants Subcellular distribution of VBARP To determine the subcellular localization of VBARP isoforms, His-tagged VBARP plasmids were transfected into HeLa cells, and the distribution was assessed by indirect immunofluorescence using anti-His IgG M C Miles et al (Fig 5) Both VBARP-L and VBARP-S exhibited a distinct cytoplasmic pattern upon expression Similar cytoplasmic distribution was observed in 293 and A172 cells upon transfection with VBARP constructs (data not shown) This result was in agreement with the structure prediction analysis that indicated that VBARP is a cytoplasmic protein Together, the transiently expressed VBARP exhibited a distinct cytoplasmic arrangement, supporting the lack of any predicted nuclear localization signal (NLS) sequences or transmembrane domains in VBARP Also, the use of unsynchronized cells in these analyses further confirmed that the cytoplasmic distribution of VBARP is independent of the cycling stage of the cells Identification of biological function(s) of VBARP using a siRNA assay To examine the role of endogenous VBARP in the regulation of normal cellular events such as cell cycle and apoptosis, RNA interference studies were performed using VBARP siRNA and control siRNA Several VBARP siRNA duplexes were synthesized and purified using the Qiagen siRNA Tool Kit Based on the initial results, siRNA spanning nucleotides 143–154 (from the ATG) was identified that blocked the VBARP RNA synthesis in tested cell lines and this siRNA was used in subsequent assays Following transfection of VBARP siRNA into HeLa and NT2 cells, physical observation revealed that cell death occurred in a dose- and cell-dependent manner (data not shown) To further quantitate this effect, NT2 cells were transfected with different concentrations of VBARP siRNA or control siRNA and assayed for functional effects First, to confirm that VBARP Fig Subcellular distribution of VBARP-L and VBARP-S: HeLa cells were transiently transfected with His-tagged VBARP-L and VBARP-S Post transfection cells were stained with anti-His IgG and detected by Alexaflour 594 (Red) Nuclei were stained with Dapi (Blue) All images were captured at 60· magnification using a Nikon microscope 4096 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS M C Miles et al Molecular characterization of ANKHD1 splice variant A B Fig Functional analysis of VBARP using siRNA: (A) siRNA-specific knockdown of VBARP RNA Cells (NT2) cells were transfected with VBARP-specific siRNA or control siRNA Thirty-six hours post transfection, total RNA was isolated from the cells and amplified with VBARP or actin specific primers by RT-PCR M, represents DNA marker, L, represents the lipofectamine control Different concentrations of VBARP and control siRNA used are indicated at the bottom of the respective lanes (B) Effect of siRNA on cell viability HeLa1 and NT22 cells were transfected with the various concentration of VBARP or control siRNA in triplicate Forty-eight hours post transfection, cells were assayed for cell viability Percentage of viable cells in mock transfected (oligofectamine) was considered as 100% Results represent an average of three independent experiments expression is specifically blocked by treatment with VBARP siRNA, siRNA transfections were performed and total RNA was isolated from the cells, 36 h post transfection, and used to amplify VBARP and b-actin by RT-PCR (Fig 6A) Results indicated that treatment of VBARP siRNA inhibited the synthesis of VBARP RNA in a dose dependent manner, whereas the b-actin control was not altered, suggesting that VBARP treatment is specific and does not alter the global cellular transcription Effect of VBARP siRNA on cell viability was tested by the trypan blue exclusion assay and cell viability assay The cell viability results of VBARP and control siRNA, compared with the oligofectamine control (considered to be 100%), are presented in Fig 6B Results indicated that NT2 cells treated with 10 nm of VBARP siRNA exhibited 50% cell death, whereas control siRNA at the same concentration did not affect cell viability However, at a concentration of 100 nm the percentage of cell viability in VBARP and control siRNA-treated cells was 20 and 75, respectively The number of viable cells in the VBARP siRNA-treated group was reduced in a dosedependent manner At the highest concentration (200 nm), both control and VABRP siRNA complexes became toxic to NT2 cells Similar results were observed in HeLa cells, also indicating that VBARP might perform similar functions in cells of different lineages FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS Caspases involved in VBARP-mediated cell survival Caspases, a family of cysteine acid proteases, are central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation occurs at the intersection of all caspase-dependent pathways and is, therefore, an excellent marker of caspase-dependent apoptotic death We sought to identify whether caspase is activated during siRNA-mediated blocking of VBARP gene expression Cells treated with increasing concentrations of VBARP or control siRNA were assessed for caspase activity as described in Experimental Procedures, and the results are presented in Fig Results indicated that cells treated with VBARP siRNA exhibit a higher amount of caspase ⁄ activity when compared with the control siRNA-treated cells in a dose-dependent manner Also, the effect of the siRNA was also measured against time following transfection and the results indicated that the effect of VBARP siRNA was also time dependent (data not shown) Taken together, these results suggest that VBARP isoforms may possess an antiapoptotic effect and protect cells during normal cell proliferation Furthermore, the regulation of caspases may be one of the pathway(s) by which VBARP regulates cell survival Further study is warranted to 4097 Molecular characterization of ANKHD1 splice variant Fig VBARP siRNA induced caspase activity: NT2 cells (triplicate wells) were transfected with VBARP or control siRNA Thirty-six hours post transfection cells were lyzed and assessed for caspase ⁄ activity Caspase activity was measured and represented in relative light units (RLU) Figure represents one of three independent experiments understand the pathway(s) and mechanism(s) involved in VBARP and its regulation apoptosis Discussion We identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar to the MASK gene found in Drosophila Drosophila MASK (dMASK) has been implicated in cell survival and may play a role in promoting proliferation and preventing apoptosis [8] dMASK mediates receptor tyrosine kinase (RTK) signaling, independent of MAP kinase (MAPK) by either functioning downstream of MAPK or by defining a new pathway of RTK signaling [8] RTKs play important roles in cell signaling during cell proliferation, apoptosis, and cell survival upon stress [14–16] Despite the fact that a homolog of dMASK is present in the human genome, neither its function nor its involvement in RTK signaling is established for hMASK (ANKHDI) Poulin et al [17] identified a gene fusion between MASK and 4E-BP3 that occurs rarely in the human genome Although 4E-BP3 is a member of the eukaryotic initiation factor family, the role of this 4E-BP3–MASK fusion in transcription regulation has yet to be defined VBARP, identified as an HIV-1 Vpr-interacting protein through yeast two-hybrid system analysis is a distinct splice variant of ANKHD1 blast search analysis revealed that VBARP is located on chromosome 5q31.3, which has no known biological function(s) Unlike hMASK, VBARP does not contain a KH domain RNA analysis and blast analysis indicated that homologs and orthologs of VBARP exist, indicating the presence of VBARP in diverse phyla such as 4098 M C Miles et al plants, yeast, and eukaryotes These results suggest that VBARP might be evolutionarily conserved, implicating its involvement in basic cellular function(s) Also, VBARP appears to be ubiquitously expressed in multiple human tissues and primary and secondary cell lines of various lineages Taqman analysis further confirmed that VBARP is expressed at varying levels in different tissue types such as spleen, cervix, heart, brain, lung, liver, and skeletal muscle Although VBARP appears to be present in all the tested tissues, the various expression levels and transcripts suggest that differential or alternate splicing might be taking place in these tissues These findings were consistent with a recent study by Poulin et al [17], introducing a novel 8.0 kb transcript called human MASK which contains part of VBARP Stringent real-time RT-PCR analysis, using various cellular subsets, revealed expression of a range of ANKHD1 isoform (human MASK) among different cell types This suggests a specific role or requirement for VBARP in cells of many different types Because a large portion of VBARP is present within ANKHD1 (hMASK), a similar conclusion can be drawn for VBARP using these data Therefore, owing to its ubiquitous expression, it is possible that VBARP plays an important role in the life cycle of various tissues in multiple organisms Functional analysis supports predictions that ubiquitously expressed VBARP appears to play a role in cell survival, because blocking the expression of VBARP resulted in apoptosis Human cells of different lineages exposed to VBARP siRNA resulted in apoptosis in a dose- and time-dependent manner when compared with control siRNA-treated cells, confirming an important role for VBARP in cell survival and antiapoptotic pathway(s) However, our analysis focuses on human cell types, and it was not extended to other species Based on the presence of VBARP in many eukaryotes and the high level of homology, it is possible to propose that a similar phenomenon might occur in cells of other species In Drosophila, MASK is shown to be critical for photoreceptor differentiation, cell survival and proliferation [8] Further studies are in progress to address these pathways Several ankyrin repeat proteins are associated with cell survival and are antiapoptotic Interfering with the normal expression of these proteins leads to cell death and lethality during development [18] These proteins are also proposed to play important roles in neuronal degeneration and apoptosis induced by chemical toxins via degradation [19] It is not clear whether VBARP has a similar functional phenotype Our results indicate that expression of VBARP is essential for normal cell function and knockout of VBARP expression leads FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS M C Miles et al Molecular characterization of ANKHD1 splice variant to cell death in cells of different lineages However, the exact mechanism(s) by which this protein regulates cell survival is not fully understood and requires further study HIV-1 infection is characterized by the loss of immune cells, specifically severe T-cell depletion However, the direct cytopathic effects of virus infection on infected cells alone cannot account for this severe loss of T cells Several viral and host cellular proteins are known to play important roles in cell depletion in vivo [20,21] One of the HIV-1 virion-associated proteins, Vpr, has been shown to dysregulate several host cellular functions including apoptosis in infected and uninfected bystander target cells through its interaction with host cellular proteins [22–25] However, it is not clear at this point how interaction of Vpr and VBARP leads to apoptosis but several scenarios exist One possibility is that redistribution or degradation of VBARP in the presence of Vpr could abolish the antiapoptotic function of VBARP or alter it from its normal cell functions Using these potential mechanism(s), Vpr could exploit this pathway to induce apoptosis in the bystander-uninfected population, given the fact that VBARP is abundantly present in many of the tested human primary cells Understanding the functions and identifying the other regulatory proteins involved in antiapoptotic functions regulated by VBARP will shed new light on the function of this novel protein as well as developing additional therapeutics for HIV-1 Experimental procedures Cell culture Established cell lines HeLa, NT2, 293, HEK293T, and CEMx174 were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin solution Normal human primary PBMC, PBL, macrophages and dendritic cells were isolated from heparinized blood using the FicollHypaque method PBMC and PBL were blasted with PHA-P (5 lgỈmL)1, Sigma, St Louis, MO) for days and cultured in RPMI containing 10% FBS, 1% penicillin– streptomycin and interleukin-2 growth factor Monocytes were isolated using CD14 beads and differentiated into macrophages and dendritic cells using GM-CSF (500 mL)1) ⁄ M-CSF (15 ngỈmL)1) and GM-CSF ⁄ IL-4, respectively Yeast two-hybrid system To identify Vpr-interacting host cellular protein(s), we used a human cDNA library as described [9] Briefly, full-length Vpr was fused in-frame with a Gal4 DNA-binding domain and used as bait in the yeast expression vector pGBT9 The GAL-4 activation domain tagged brain cDNA library (gift from Dr Srinivasan, Thomas Jefferson University, PA) was used as prey To eliminate the false-positive clones, cDNA clones alone were transformed in yeast and screened on high-stringency plates Sequencing the remaining seven clones identified a 915-bp fragment multiple times Interaction of this 915-bp fragment was further confirmed by yeast two-hybrid system, as well as by using a Checkmate mammalian hybrid system as suggested by the manufacturer (Promega, Madison, WI) Construction of VBARP and Vpr expression plasmids Upon completion of the human genome project, the VBARP cDNA construct was available through the American Tissue Type Collection (ATCC) as an IMAGE clone PCR primers were designed to amplify the original 915-bp Vpr-interacting fragment, as well as the two VBARP isoforms, VBARP-L (1.9 kb) and VBARP-S (1.3 kb) The PCR products (Table for details on PCR primers) were amplified and cloned into pcDNA3.1 CMV ⁄ T7 TOPO vector with a V5 ⁄ His epitope as per the manufacturer’s instructions (Invitrogen) for use in further eukaryotic expression studies Positive clones were sequenced to verify nucleotide integrity at the University of Pittsburgh Genomics and Proteomics Core Laboratory The resulting plasmids were designated as pVBARP-L and pVBARP-S Vpr expression clones were constructed as described previously [9] GenBank BLAST and computer analyses The 915-bp fragment recognized as the Vpr-binding domain was sequenced The UCSC Genome Bioinformatics Blast Table Primers used to construct VBARP expression plasmids Isoform Size (kb) Primer sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization of ANKHD1 splice variant Like Alignment Tool (http://www.genome.ucsc.edu/cgi-bin/ hgBlat) was used to find the location of this nucleotide sequence in the human genome and also to identify the intron ⁄ exon boundaries of its genomic sequence spidey software (http://www.ncbi.nlm.nih.gov/) was also used to generate the intron ⁄ exon maps The nucleotide and deduced amino acid sequences were subjected to homology searches using the NCBI blast program (http://www.ncbi.nlm.nih gov/BLAST) in order to identify homologous sequences present in the sequence databases [26,27] Invitrogen’s alignx software was used for multiple sequence alignment of VBARP homologous proteins Databases of protein families and domains including pfam (http://www.sanger ac.uk/Software/Pfam/) prosite (http://lsexpasy.org/ prosite/) and NCBI’s Conserved Domain Database (CDD; http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) were searched to identify the presence of conserved motifs and domains [28,29] Several sequence analysis programs available from the Expert Protein Analysis System (expasy; http://lsexpasy.org/tools) proteomics server of the Swiss Institute of Bioinformatics were used for in sillico characterization of VBARP, including prediction of its subcellular localization (psort: http://www.psort.org), prediction of post-translational modification (netphos: http://www.cbs dtu.dk/services/NetPhos), prediction of its topology and the primary and secondary structure analysis (predictprotein: http://www.cubic.bioc.columbia.edu/predictprotein) RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from human tissues and human primary cells using Qiagen RNA purification kit (Qiagen, Valencia, CA) and used in real-time PCR analysis for various VBARP isoforms Two-step RT-PCR was performed as follows: RNA (0.2–0.5 lg) was reverse transcribed using Taqman reverse transcription reagents (Applied Biosystems, Foster City, CA) Real-time PCR was carried out in triplicate using an ABI Prism 7000 Detection System and analyzed using the included sequence detector software Commercially available primer ⁄ probe sets specific for the ANKHD1 ⁄ VBARP isoforms and the ribosomal large protein (RPLPO) were used (Applied Biosystems, San Diego, CA) to identify the different variants The comparative CT method was used to determine the relative ratio of transcript between different samples as described [30] RNA levels were normalized to RPLPO Protein expression analysis In vitro T7 transcription ⁄ translation In vitro transcription ⁄ translation of VBARP plasmids was accomplished using the TnTÒ Quick Coupled System as per the manufacturer’s instructions (Promega) Briefly, 4100 M C Miles et al 1–2 lg of VBARP-His were combined with 40 lL of TnTÒ Master mix containing rabbit reticulocyte lysates, lL of [35S]-methionine (MP Biomedicals, Irvine, CA) and nuclease-free water to a total volume of 50 lL The reaction was incubated at 30 °C for 90 and used in subsequent experiments For transient expression studies, HEK293T cells (1 · 106) were transfected with control vector, VBARP-L or VBARP-S expression constructs using calcium phosphate as described previously [31] Forty-eight hours post transfection, cells were washed with cold NaCl ⁄ Pi and collected Cell pellets were subsequently lysed with RIPA buffer containing 50 mm Tris (pH 7.5), 150 mm NaCl, 1% Triton X-100, mm sodium orthovanadate, 10 mm sodium fluoride, mm phenylmethylsulfonyl fluoride 0.05% deoxycholate, 10% SDS, trypsin inhibitor (0.07 unitỈmL)1) aprotinin, and protease inhibitors leupeptin, chymostatin, and pepstatin (1 lgỈmL)1; Sigma) as described [14] for 15 in ice Cell lysates were centrifuged at 22 000 g for 10 at °C to remove cell debris Protein estimation of the cell lysates was carried out using Bradford reagent (Bio-Rad Laboratories, Hercules, CA) Total cell lysates (50 lg) were separated on an 8–12% SDS ⁄ PAGE gel, transferred to poly(vinylidene difluoride) membrane and immunoblotted with antialpha-Tubulin (1 : 500) (NeoMarkers, Fremont, CA) and mouse monoclonal anti-His IgG (1 : 200) (Abcam, MA) followed by horseradish peroxidase-conjugated goat anti-mouse IgG (1 : 10000) and blots were developed using the ECL chemiluminescence detection kit (Amersham Biosciences) Subcellular localization studies by indirect immunofluorescence HeLa cells (1 · 104) were seeded in a four-well chamber slide (Falcon, Franklin Lakes, NJ) and transfected with VBARP-L and VBARP-S expression plasmid DNA using Lipofectamine (Invitrogen) according to the manufacturer’s instructions Forty-eight hours post transfection, cells were washed with 1· NaCl ⁄ Pi, fixed in 2% paraformaldehyde at room temperature for 10 min, then washed and permeabilized with 0.05% Triton X-100 for 10 After washing three times with 1· NaCl ⁄ Pi, fixed cells were incubated at room temperature for 90 with anti-His IgG (1 : 200) (Abcam), washed three times with 1· NaCl ⁄ Pi, and then incubated with goat anti-(mouse epitope) IgG Alexafluor 594 (1 : 400) (Molecular Probes, Eugene, OR) for 60 at room temperature Following several washes with 1· NaCl ⁄ Pi, cells were dried and mounted with VECTASHIELD mounting media containing DAPI (Vector Laboratories, Burlingame, CA) Immunofluorescence was detected using a fluorescence microscope with Nikon SPOT camera (Fryer, Huntley, IL) and images were processed using metamorph software (Universal Imaging Corp., Downington, PA) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS M C Miles et al Molecular characterization of ANKHD1 splice variant In vitro interaction studies RNA extraction and RT-PCR HIV-1 Vpr expression plasmids, VBARP plasmids and pNef expression plasmid (as control protein) were in vitro transcribed and translated using T7 TNT system as suggested by the manufacturer (Promega) and coimmunoprecipitated using specific antibodies In the coimmunoprecipitation assay, equal amounts of 35S-radiolabeled in vitro translated VBARP isoforms were incubated with either Vpr or Nef protein on ice for 90 The protein complex was immunoprecipitated with anti-Vpr (gift from Dr John Kappes, University of Alabama), anti-His (Invitrogen) or anti-Nef (ARRRP, NIH) IgG and then subjected to SDS ⁄ PAGE All complexes were subjected to extensive washings with stringent wash buffers Eluted proteins were subjected to SDS ⁄ PAGE in 8–12% gels and processed for autoradiography RNA was extracted from different cell lines using a QIAGEN RNeasymini RNA extraction kit (Qiagen) RNA concentration was determined by spectrophotometry and the integrity was assessed by 260 ⁄ 280 ratio and agarose gel electrophoresis Total RNA extracted from cultured cells was reverse transcribed to cDNA and PCR amplified using One Step RT-PCR Superscript II (Invitrogen) and primers specific for VBARP and b-actin (housekeeping gene) molecules The following VBARP primers were designed: forward 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction studies HEK293T cells (1 · 106) cotransfected with pVpr-Flag and pVBARP-His ⁄ V5 were lysed in a nondenaturing, nonionic lysis buffer containing 50 mm Tris (pH 7.5), 150 mm NaCl, 0.5% Triton X-100, mm sodium othovanadate, 10 mm sodium fluoride, mm phenylmethylsulfonyl fluoride, trypsin inhibitor (0.07 unitỈmL)1) aprotinin, with protease inhibitor mixture (Sigma) The cellular fraction was isolated by centrifugation (4 °C, 15 min, 14 000 g) and incubated with magnetic anti-His TALONÒ beads (Dynal Biotech, Oslo, Norway) by rotating for 30 at °C in nonreducing buffer Immune complexes were washed four times in wash buffer, before being eluted from beads using 5· SDS sample buffer and analyzed on SDS ⁄ PAGE and immunoblotted for Vpr using anti-Vpr (1 : 250) or anti-Nef IgG (NIH ARRRP) and detected by enhanced chemiluminescence kit For viability testing, HeLa and NT2 cells were cultured in 12-well plates and transfected with oligofectamine reagent (Invitrogen) with various concentrations of VBARP siRNA or control siRNA in duplicates Forty-eight hours post transfection, cells were collected and counted using trypan blue staining and ⁄ or cell viability assay kit (Promega) Caspase (3 ⁄ 7) activity was measured according the manufacturer’s instructions using the Caspase-Glo3 ⁄ assay kit (Promega) Briefly, HeLa and NT2 cells were plated in 96-well plates and transfected with VBARP and control siRNA Cells were incubated for 24, 36 and 48 h time intervals Following post transfection cells were lysed in 100 lL Caspase-Glo3 ⁄ substrate (Promega) and incubated for 30 in the dark at room temperature Caspase ⁄ activity was measured as relative light units (RLU) by a VeritasTM microplate luminometer (Turner Biosystems, Sunnyvale, CA) Gene expression knockout assay using siRNA Acknowledgements Three targeted sequences of VBARP were selected that met the following criteria: (a) nucleotide sequence was unique and not homologous to another sequence within the human genome; (b) targeted sequence achieved a high compatibility value using QIAGEN siRNA design software (siRNA tool kit program) available on their website (http://www.qiagen.com); (c) sequence did not contain a run of the same type of nucleotide; and (d) positive and negative strands were not palindromes Primers that fit the above criteria were synthesized and RNA sequences were generated using the siRNA synthesis kit (Ambion, Austin, TX) according to the manufacturer’s protocol Control siRNA (AATTCTCCGAAC GTTGTCACGT) targeting a sequence specific to Thermotoga maritimia was purchased from Qiagen and used as nonspecific control We thank Dr Martinson for critical reading of the manuscript This work was supported in part by the United States Army to MCM for career advancement FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS References Mosavi LK, Cammett TJ, Desrosiers DC & Peng ZY (2004) The ankyrin repeat as molecular architecture for protein recognition Protein Sci 13, 1435–1448 Lubman OY, Korolev SV & Kopan R (2004) Anchoring notch genetics and biochemistry; structural analysis of the ankyrin domain sheds light on existing data Mol Cell 13, 619–626 Hryniewicz-Jankowska A, Czogalla A, Bok E & Sikorsk AF (2002) Ankyrins, multifunctional proteins 4101 Molecular characterization of ANKHD1 splice variant 10 11 12 13 14 15 16 17 18 involved in many cellular pathways Folia Histochem Cytobiol 40, 239–249 Bork P (1993) Hundreds of ankyrin-like repeats in functionally diverse proteins: mobile modules that cross phyla horizontally? Proteins 17, 363–374 Peifer M, Berg S & Reynolds AB (1994) A repeating amino acid motif shared by proteins with diverse cellular roles Cell 76, 789–791 Binz HK, Amstutz P, Kohl A, Stumpp MT, Briand C, Forrer P, Grutter MG & Pluckthun A (2004) High-affinity binders selected from designed ankyrin repeat protein libraries Nat Biotechnol 22, 575–582 Qin WX, Zhou XM, Zhang PP, Jiang HQ, Hunang Y, Wan DF & Gu JR (2000) Direct Submission to National Laboratory for Oncogenes and Related Genes Shanghai Cancer Institute, Shanghai, China Smith RK, Carroll PM, Allard JD & Simon MA (2000) MASK, a large ankyrin repeat and KH domain-containing protein involved in Drosophila receptor tyrosine kinase signaling Development 129, 71–82 Mahalingam S, Ayyavoo V, Patel M, Kieber-Emmons T, Kao GD, Muschel RJ & Weiner DB (1998) HIV-1 Vpr interacts with a human 34-kDa mov34 homologue, a cellular factor linked to the G2 ⁄ M phase transition of the mammalian cell cycle Proc Natl Acad Sci USA 95, 3419–3424 Kohl A, Binz HK, Forrer P, Stumpp MT, Pluckthun A & Grutter MG (2003) Designed to be stable: crystal structure of a consensus ankyrin repeat protein Proc Natl Acad Sci USA 100, 1700–1705 Mosavi LK, Minor DL Jr & Peng ZY (2002) Consensus-derived structural determinants of the ankyrin repeat motif Proc Natl Acad Sci USA 99, 16029–16034 Riedl SJ & Shi Y (2004) Molecular mechanisms of caspase regulation during apoptosis Nat Rev Mol Cell Biol 5, 897–907 Shi Y (2004) Caspase activation: revisiting the induced proximity model Cell 117, 855–858 Schlessinger J (2000) Cell signaling by receptor tyrosine kinases Cell 103, 211–225 Noonberg SB & Benz CC (2000) Tyrosine kinase inhibitors targeted to the epidermal growth factor receptor subfamily: role as anticancer agents Drugs 59, 753–767 Saltiel AR (1994) The paradoxical regulation of protein phosphorylation in insulin action FASEB J 8, 1034– 1040 Poulin F, Brueschke A & Sonenberg N (2003) Gene fusion and overlapping reading frames in the mammalian genes for 4E-BP3 and MASK J Biol Chem 278, 52290–52297 Hamada Y, Kadokawa Y, Okabe M, Ikawa M, Coleman JR & Tsujimoto Y (1999) Mutation in ankyrin repeats of the mouse Notch2 gene induces early embryonic lethality Development 126, 3415–3424 4102 M C Miles et al 19 Sakaue M, Takanaga H, Adachi T, Hara S & Kunimoto M (2003) Selective disappearance of an axonal protein, 440-kDa ankyrinB, associated with neuronal degeneration induced by methylmercury J Neurosci Res 73, 831–839 20 Gougeon ML (2005) To kill or be killed: how HIV exhausts the immune system Cell Death Differ 12, 845–854 21 Alimonti JB, Ball TB & Fowke KR (2003) Mechanisms of CD4+ T lymphocyte cell death in human immunodeficiency virus infection and AIDS J Gen Virol 84, 1649–1461 22 Muthumani K, Choo AY, Premkumar A, Hwang DS, Thieu KP, Desai BM & Weiner DB (2005) Human immunodeficiency virus type (HIV-1) Vpr-regulated cell death: insights into mechanism Cell Death Differ 12, 962–970 23 Andersen JL, Zimmerman ES, DeHart JL, Murala S, Ardon O, Blackett J, Chen J & Planelles V (2005) ATR and GADD45alpha mediate HIV-1 Vpr-induced apoptosis Cell Death Differ 12, 326–334 24 Roumier T, Vieira HL, Castedo M, Ferri KF, Boya P, Andreau K, Druillennec S, Joza N, Penninger JM, Roques B et al (2002) The C-terminal moiety of HIV-1 Vpr induces cell death via a caspase-independent mitochondrial pathway Cell Death Differ 9, 1212– 1219 25 Gaynor EM & Chen IS (2001) Analysis of apoptosis induced by HIV-1 Vpr and examination of the possible role of the hHR23A protein Exp Cell Res 267, 243–257 26 Madden TL, Tatusov RL & Zhang J (1996) Applications of network BLAST server Methods Enzymol 266, 131–141 27 Pearson WR & Lipman DJ (1988) Improved tools for biological sequence comparison Proc Natl Acad Sci USA 85, 2444–2448 28 Hulo N, Sigrist CJA, Le Saux V, Langendijk-Genevaux PS, Bordoli L, Gattiker A, De Castro E, Bucher P & Bairoch A (2004) Recent improvements to the PROSITE database Nucleic Acids Res 32, D134–D137 29 Blom N, Gammeltoft S & Brunak S (1999) Sequenceand structure-based prediction of eukaryotic protein phosphorylation sites J Mol Biol 294, 1351–1362 30 Janket ML, Manickam P, Majumder B, Thotala D, Wagner M, Schafer EA, Collman RG, Srinivasan A & Ayyavoo V (2004) Differential regulation of host cellular genes by HIV-1 viral protein R (Vpr): cDNA microarray analysis using isogenic virus Biochem Biophys Res Commun 314, 1126–1132 31 Miura-Shimura Y, Duan L, Rao NL, Reddi AL, Shimura H, Rottapel R, Druker BJ, Tsygankov A, Band V & Band H (2003) Cbl-mediated ubiquitinylation and negative regulation of Vav J Biol Chem 278, 38495–38504 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS ... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar.. .Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,