Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... FEBS Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis Melissa C. Miles 1 , Michelle L. Janket 1 , ... regulation of caspases. Taken together, these results indicate that VBARP is a novel splice variant of ANKHD1 and may play a r...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

... primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢. Another primer pair used for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCC ACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAA TACATCA-3¢. Western ... 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ (with HindIII and ClaI) with 16 complementary bases, which...

Ngày tải lên: 23/03/2014, 07:20

14 397 0
Báo cáo khoa học: Escherichia coli cyclophilin B binds a highly distorted form of trans-prolyl peptide isomer doc

Báo cáo khoa học: Escherichia coli cyclophilin B binds a highly distorted form of trans-prolyl peptide isomer doc

... planarity of the Ala-cis-Pro amide bond. In the case of CyPB in complexes with Suc-Ala-trans-Pro- Ala-pNA and Ac-Ala-Ala-trans-Pro-Ala-AMC, the large distortion in the orientation of Ala1 and Ala2 ... Ala-Pro, Ala-Pro-Phe, Ala-Ala- Pro-Ala and Ala-Ala-Pro-Ala-Ala i nhibit cis to trans isomerase activity of calf thymus CyPA [27]. It was suggested that in the m...

Ngày tải lên: 30/03/2014, 15:20

10 244 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... proteins. The prim–pol domain and putative heli- case ⁄ NTPase domain are indicated in gray and black respectively. (B) Purification of the recombinant Rep245 protein. SDS ⁄ PAGE of protein extracts ... the DNA binding and the active site subdomains, we man- aged to model the entire domain without it. Another significant finding concerns the nature of the acid r...

Ngày tải lên: 18/02/2014, 18:20

14 620 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... USA ATP-regenerating enzymes may have an important role in maintaining ATP levels in mitochondria-like kinetoplast organelle and glycosomes in parasitic protozoa. Adenylate kinase (AK) (ATP:AMP ... were obtained by simple rotation of the same model. The flexible LID domain appears at top of the three figures, NMP-binding site and ATP binding domain are displayed, NH 2...

Ngày tải lên: 21/02/2014, 00:20

9 487 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... P764 (5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCT TTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTC TAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGA GTT-3¢). It was also digested with EcoRI and XhoI, ligated withthevectorandclonedinJM109Escherichia ... to adenylate cyclase with the exception of an artificial isoform (CRFR1h2) with the insertion of 37 amino acids between the ligand binding domain and the first e...

Ngày tải lên: 07/03/2014, 15:20

10 671 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... than six CHH-like cDNA have been identified and can be divided into CHH -A and CHH-B groups [19]. In the crabs Can- cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus ... RNAs were allowed to anneal by mixing equal amounts of each strand, heating to 100 °C for 1 min, and cooling gradually to room temperature for 3–4 h. Single-stranded RNAs...

Ngày tải lên: 23/03/2014, 10:20

9 486 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 (1) Protein containing DNAJ domain; unknown function cuacgucggacggaacugggaaaccgaucaguguugguagugaguuaa cucggugaccgaguuaguagaacgaguuaauuag UGUAAAUAcgaagcca At4g39090 ... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse)...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... within the a- domain and a -domain. Instead, they both contain the sequence CPRS in the a- domain and CMNC or CINC in the a -domain. GmPDIL- 3a and GmPDIL-3b contain a C-terminal KDEL sequence that ... with a Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G...

Ngày tải lên: 18/02/2014, 11:20

12 622 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... subunits have been implicated at the nucleotide binding domains and the regulatory domain, indicating the importance of these domains for the tetramerization of the enzyme [18]. It was shown that serine ... between thedomainsaredepictedby An open box in the nucleotide binding domain indicates the NAD + -binding domain (Gly-Xaa-Gly-Xaa 2 - Gly-Xaa 17 -Asp) and al...

Ngày tải lên: 19/02/2014, 13:20

12 464 0
w