the effect of the type of triad that is formed with the third actor and its level of importance on the embedding of a start up in the pre existing network
... on StartUp Journey Antonella La Rocca, Christina Öberg, and Thomas Hoholm Part III Start Ups and Technological Collaboration in Industrial Networks R&D Collaboration and Start Ups Jens Laage-Hellman, ... in Scandinavian Journal of Management, Industrial Marketing Management and Journal of Business Research Alexandra Waluszewski is Professor of Business Studies and research director at Uppsala University’s ... Laage-Hellman, Maria Landqvist, and Frida Lind Starting Up from Science: The Case ofa University-Organised Commercialisation Project Malena Ingemansson Havenvid Part IV Academic Spin-Offs and the Issue...
... Grammartical Structures of the equivalent translation The target language is English and the source Adjective Warm language is Vietnamese The data are classified into semantic and pragmatic features ... hyponym of animal 2.2.1.7 Semantic field The semantic structure of vocabulary ofa language can be studied in a precise and systematic way by means of componential analysis of which the theory of ... analytical and equivalent translations are also adopted in ofthat expression thatis separate from the literal meaning or this study to assure that the study is reliable definition of the words of...
... onward, however, discovered that we had reached only an oasis in the desert, and that six miles ahead of us lay another pitiless barren stretch Anguish and dismay now filled all hearts Husbands ... Bartlett of the United States Navy, Alcalde of the town and district of San Francisco, but as yet had obtained nothing, now appeared before each in person, and was promised assistance Captain Mervine ... shore of Great Salt Lake, near thatofa stranger, who had been buried by the Hastings party a few weeks earlier Mr Halloran had appreciated the tender care bestowed upon him by my parents, and had...
... than I 56 ALEXEY A ZASLAVSKY B1 C A1 A1 1 O I I A P C1 B Fig References [1] A V Akopyan Geometry in figures Createspace, 2011 Central Economic and Mathematical Institute RAS E-mail address: zaslavsky@mccme.ru ... It is easy to see that they meet at a point on the circumcircle of ABC The points A2 , B2 , C2 are the reflections of this point in the midpoints of the sides of ABC Therefore, the triangles ABC ... Therefore, k is the Jerabek hyperbola Here follow some corollaries of this fact ONE PROPERTY OF THE JERABEK HYPERBOLA AND ITS COROLLARIES 55 Statement Let P be a point on the Euler line of ABC, A1 B1...
... 5’-CGGCCCGGGCTCCAGGTAGATG backward primer BCL11Bp 5’-6FAM-TCACCCACGAAAGGCATCTGTCCCAAGCA-TAMRA probe b2Mf 5’-CTCGCGCTACTCTCTCTTTCT forward primer b2Mb 5’-TACATGTCTCGATCCCACTTAACTAT backward primer b2Mp 5’-6FAM-CTCACGTCATCCAGCAGAGAATGGAAAGTCA-TAMRA ... 5’-6FAM-CTCACGTCATCCAGCAGAGAATGGAAAGTCA-TAMRA probe relative to an internal control gene [23,24] The efficiencies of real-time PCR for expression analysis of different genes were evaluated using diluted ... gene, as well as BCL2L1 and CREBBP mRNA, were characteristic features of T-ALL Recent evidence has suggested that multiple mechanisms may regulate the release of mitochondrial factors, some of which...
... Hypothalamic-Pituitary-Adrenal Axis (HPA Axis) The hypothalamo-pituitary-adrenocortical (HPA) axis plays a fundamental role in adaptation of the organism to homeostatic challenge, and should be thought of as ... pain disorders, immune disorders, cardiovascular disorders, metabolic disease and behaviour disorders, may be the result of chronic activation of the hypothalamo-pituitary-adrenal axis and sympatho-adrenal ... into pathological state of tissues, and most relevantly, that the application of spinal manipulative therapy can alter the prolonged reflex discharge or be associated with a reversal of the pathological...
... might also consider that this general sense ofa popular literacy has also evolved into a fundamental condition for adult education, as a resource that has enabled adult learners to engage with, and ... toward stagnation that afflict advanced, affluent economies (xi) 36 Here again, entrepreneurs are characterised both as "newcomers" as well as revolutionaries, and their role as agents of disruption ... basically brings about a radical transformation of some fundamental narrative of life an existential myth, on a transatlantic scale right in front ofa global audience: where in the past folks would...
... 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting ofa complex system of relatively ... Särkinen et al 2011, Venegas 2005) This ecoregion is home to a large number of vertebrates (e g Puma concolor, Tremarctos ornatus, Tamandua mexicana, Amazilia amazilia and Iguana iguana) with a high ... plants like Prosopis, Acacia, Capparis, Bursera, Phithecolobium, Cereus and Opuntia The surveyed localities are situated in the Regions Amazonas, Cajamarca and La Libertad along a stretch of...
... encodes a transcriptional activator The binding of A- factor on ArpA prevents its binding to the promoter of adpA, allowing the transcription of adpA and the synthesis of AdpA AdpA activates the transcription ... the intestinal release of glucose (Yamagishi et al., 2009) Clavulanic acid produced by Streptomyces clavuligerus isa betalactamase inhibitor thatis often associated with beta-lactam antibiotics ... in the utilisation of N-acetylglucosamine; high concentrations of this intermediate indicating that high levels of extracellular Nacetylglucosamine are available for use as a carbon and nitrogen...
... business associates and suppliers) An ample amount of seed capital is necessary to launch a successful capital-raising effort Seed capital is generally raised through the issuance of 1, to year ―Seed ... Most start- up and early-stage companies are also too risky (history shows that 85% of all start- up and early-stage companies will fail within their first five years, primarily due to the lack of ... on Main Street by shaking the foundations of the financial, commercial and political establishments That - isa promise we can keep Raising capital is like fishing We must deal with two factors,...
... P1O 5¢-ATACCATGGACAAAACCCACAGTACAATG P1OH 5¢-CATATGCACAAAACCCACAGTAC P2O 5¢-TATGGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢-CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATACCATGGCTGGAGAAGACTTTAAGATC P1ZH ... 5¢-CATATGACTGGAGACTTTAAGATC P2Z 5¢-TATGGATCCTCACCACCCAATTTCGGAAAG P2ZH 5¢-CTCGAGCCACCCAATTTCGGAAAGT Table Over-expression plasmids for Sno1p and Snz1p prepared in this study Symbols O, Z and ... centrifugation (14 000 g) for min, the absorbance of the supernatant was read at 363 nm The absorbance of the reduced form of APAD (APADH) was linear over the 2–100 lM range of glutamate with a molar...
... leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a time-dependent manner, we looked at the pattern of TSA-induced histone acetylation ... antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam) Analysis of GR was performed at : 1000 dilution of primary ... nucleosomal organization caused by TSA treatment Changes in the acetylation status of histones by TSA treatment may cause changes in the organization of chromatin Such altered chromatin may no longer...
... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... fraction of the total amount of PAI-1 forming a stable complex with uPA, was calculated from the amount of PAI-1 required to inhibit half the uPA The half-life of PAI-1 was finally calculated from an...
... Zea mays (O48556), Solanum tuberosum (O43187), Arabidopsis thaliana (AAC33503), Oryza sativa (AAC78101), Chlamydia pneumoniae (AAD19056), Chlamydia trachomatis (O84777), Mycoplasma pneumoniae (P75250), ... difluoride membranes and subjected them to analysis by the automatic Edman degradation method The sequence 1MALAASATIS-10 of native AsPPase was identical to thatof the putative mature protein This confirmed ... Y.M., Laroiya, K., Rea, P .A & Vaidya, A. B (2001) Two classes of plant-like vacuolar-type H+-pyrophosphatases in malaria parasites Mol Biochem Parasitol 114, 183–195 Nakanishi, Y & Maeshima, M (1998)...
... model is calibrated to replicate observed data of EU agriculture, based on assumed values of some parameters The solution of the model—for baseline parameter values as well as other alternatives—allows ... Biotechnology and Organic Agriculture: National Organic Standards, Labeling and Second-Generation of GM Products Paper presented at the AAEA annual meeting, Montreal, Canada, July Golan, E., Kuchler, ... loss of generality, because units are arbitrary) so that we can interpret z as the fraction of land thatis allocated to organic production Given this, before the advent of GM products the marginal...
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
... reaction uses two molecules of Ac-CoA to generate AcAc-CoA and CoA Cys89 is activated for nucleophilic attack by His348 (B) Comparison of the covalent structures of CoA (top), SPP (middle) and ... proton abstraction from the C2 of Ac-CoA (Fig 1) It has been shown that two oxyanion holes in the catalytic cavity play a key role in this reaction mechanism [2] Oxyanion hole I isformed by a water ... referred to as Wat82, and Ne2(His348) This oxyanion hole binds the Ac-CoA thioester oxygen atom, facilitating the nucleophilic attack of the C2 atom of Ac-CoA to the carbonyl carbon atom of the acetyl...
... proofreading polymerase (long and accurate Taq polymerase, Takara) with the primer pair based on the published sequence [19]: 5¢-GCCGAATTCCAACATGGC AGCACCAGAGACGGG-3¢; 5¢-GCCTCTAGATCATCG CAGCGTGCTGGTCAG-3¢ ... portion of the lysate was separated by 10% SDS ⁄ PAGE and autoradiographed A mock-programmed lysate was run in parallel Molecular mass markers are shown at the left An arrowhead indicates the ... proteins that are key players in a wide array of developmental and physiological pathways such as neurogenesis, circadian rhythms, hypoxia response, and toxin metabolism [20,21] PAS is an acronym...
... descriptors are largest for discordance of the source position x1 and that it is nearly-impossible to obtain a reliable retrieval of the imaginary part of ℑµ for ±10% discordance of any of the other ... parameters are far from negligible, even for a discordance ofa single parameter thatis as small as 10%; b) the retrieval errors of ρ, ℜλ, ℜµ, ℑµ are generally largest for model discordance pertaining ... which κ is visually found to be minimum, is pK A more quantitative method is to employ (as is done herein) a minimization ˜ scheme such as bisection to locate this abscissa To get a more accurate...
... talk given at the Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam ... The asymptotic behavior of systems of linear differental equations, Amer J Math 63 (1946) [6] H Inaba, A semigroup - approach to the strong ergodic theorem of the multistate stable population ... stable (see [12]) of solution of delay linear diffirential equation under nonlinear perturbation We recall that, the conditions (5), (6), (7) are satisfied By using the Gronwall-Bellman’s lemma(see...