simulating patterns of heroin addiction within the social context of a local heroin market

Báo cáo khoa học: "Interactive Discourse: Influence of the Social Context " pot

Báo cáo khoa học: "Interactive Discourse: Influence of the Social Context " pot

Ngày tải lên : 24/03/2014, 01:21
... COnversation openings In G° Psa~has (ed.), Everyday Language: Studies in EthnometbodoloqY 23-78 Thomas, J A design-interpreuation analysis of natural English with applications to man-computer interaction ... International Journal of Man-Machine Studies, Vol I0, 651-668 1978 Wynn, E Office conversation as an informauion medium Ph.D Thesis, Department of Anthropology, University of California, Berkeley...
  • 2
  • 304
  • 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

Ngày tải lên : 09/08/2014, 22:22
... vascular anastomosis taking place after the migration of the primordial germ cells to the site of the primitive gonad had finished, a mechanism which has been previously suggested to explain the ... studies of the segregational patterns of germ cells in chimeric cattle have concerned with the possibility or otherwise of the survival and function of germ cells in the gonads of bulls and freemartin ... cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of lymphomyeloid...
  • 5
  • 319
  • 0
Báo cáo y học: " The identification and management of ADHD offenders within the criminal justice system: a consensus statement from the UK Adult ADHD Network and criminal justice agencies" doc

Báo cáo y học: " The identification and management of ADHD offenders within the criminal justice system: a consensus statement from the UK Adult ADHD Network and criminal justice agencies" doc

Ngày tải lên : 11/08/2014, 16:23
... exacerbating factor that maintains antisocial behaviour and reduces the ability of an individual to alter their behavioural patterns Clearly ADHD has a greater impact on people than just the core ... with the judiciary to ensure that they have adequate information about the mental health and learning disabilities of defendants, and concerning local health and learning disability services - All ... communities A central tenet is that prisoners should be considered as part of the community and treated within mainstream services with access to the same standards of health and social care as the rest...
  • 14
  • 453
  • 0
The EE hoe hean club within the social political space

The EE hoe hean club within the social political space

Ngày tải lên : 01/10/2015, 11:39
... BETWEEN THE STATE AND THE POWER OF “PANG”: THE EE HOE HEAN CLUB WITHIN THE SOCIAL POLITICAL SPACE 吕双 LU SHUANG 新加坡国立大学中文系 硕士学位论文 A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ARTS DEPARTMENT OF CHINESE ... determined the organizational mechanism of the association and the decision-making model of its leaders; the Chinese government was its significant pillar of support before World War II, and the early ... post war period; the attitude and policies of the local government towards the Chinese associations were always the basis of their functioning Keywords: Ee Hoe Hean Club Tan Kah Kee Hokkien Pang...
  • 136
  • 1.2K
  • 0
Rousseau 039 s  039 The Social Contract 039  A Reader 039 s Guide Continuum Reader 039 s Guides

Rousseau 039 s 039 The Social Contract 039 A Reader 039 s Guide Continuum Reader 039 s Guides

Ngày tải lên : 13/10/2016, 11:16
... North America and the Pacific In the arts, the baroque magnificence of Bach and Rameau was gradually replaced by the cool brilliance of Mozart and Haydn, while a radical new form of literature, the ... pre -social state of affairs in which these capacities are allowed to flourish to their full potential Such a state may have even existed In any case, there is also a form of social interaction, characterized ... gradual accumulation of contacts and a persistence in the face of adversity resulted in ROUSSEAU’S THE SOCIAL CONTRACT a steadily increasing profile in the city After ten years of struggle, a...
  • 145
  • 368
  • 0
Báo cáo y học: "Malignant pleural mesothelioma with long-term tumor disappearance of a local relapse after surgery: a case report" doc

Báo cáo y học: "Malignant pleural mesothelioma with long-term tumor disappearance of a local relapse after surgery: a case report" doc

Ngày tải lên : 11/08/2014, 17:21
... complementary and alternative self-therapy Case presentation A 73-year-old man with a 75-pack-year history of cigarette smoking and asbestos exposure between the ages of 30 and 40 years had been admitted ... reported that natural killer cell activity was clinically elevated by ABMK-treated gynecological cancer patients Another therapy, parasympathetic nerve stimulation therapy with a minor modification ... regression and surgical excision of malignant mesothelioma Ann Thorac Surg 2007, 83:314-315 Allen RKA: Apparent spontaneous complete regression of a multifocal malignant mesothelioma of the pleura MJA...
  • 4
  • 243
  • 0
conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

Ngày tải lên : 02/03/2015, 14:17
... multicultural societies like Australia, the US, and the UK, among others The issue of access, first to the labor market and then to a variety of public institutions and social welfare services, was also ... products) approaches because the database only is insufficient to make progress towards a real explanatory theory The primary design of the study is the application and testing of the pragmatic cognitive ... particular emphasis on the role of context and the dynamics of interactivity in face-to-face communication Taking a descriptive discourseanalytical approach to her data, Wadensjo showed that the...
  • 272
  • 657
  • 5
Cambridge.University.Press.Globalisation.and.the.Western.Legal.Tradition.Recurring.Patterns.of.Law.and.Authority.Mar.2008.pdf

Cambridge.University.Press.Globalisation.and.the.Western.Legal.Tradition.Recurring.Patterns.of.Law.and.Authority.Mar.2008.pdf

Ngày tải lên : 21/09/2012, 10:54
... by Tamanaha as law are state law, customary law, religious law, international law, transnational law, indigenous law and natural law (pp 224–30) Tamanaha, General Jurisprudence, pp 206–8 The social ... ‘globalisation’ and ‘law’ are run together in a phrase, the standard response (at least amongst commercial lawyers) is to agitate issues relating to the law of international transactions, global financial markets, ... international law and national municipal law as part of a unity: he maintained that the basic foundational norm (Grundnorm) which gave all law its constitutional validity was from international law.14...
  • 378
  • 1.1K
  • 2
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study

The chart below shows the sleep patterns of people in five different occupations according to a Canadian study

Ngày tải lên : 04/10/2012, 10:02
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
  • 2
  • 1.4K
  • 3
INVESTIGATING HOW GENERAL EDUCATION MIDDLE SCHOOL TEACHERS  SUPPORT THE SOCIAL INCLUSION OF STUDENTS WITH SPECIAL NEEDS

INVESTIGATING HOW GENERAL EDUCATION MIDDLE SCHOOL TEACHERS SUPPORT THE SOCIAL INCLUSION OF STUDENTS WITH SPECIAL NEEDS

Ngày tải lên : 06/04/2013, 11:26
... and admit that they struggle with providing the skills and strategies to facilitate these relationships in their classroom These findings raise a variety of questions about the availability of ... condition that offers a sense 21 of belonging and acceptance of the students While many schools maintain an overreliance on physical inclusion as a way to promote awareness and acceptance of students ... or the assistance of a paraprofessional to deliver one-on-one support, a teacher may, unintentionally, play into the stigma that students with special needs cannot be an integrated part of the...
  • 144
  • 403
  • 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Ngày tải lên : 06/09/2013, 05:48
... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...
  • 23
  • 552
  • 0
The social dimension of service workers’ job satisfaction   the perspective of flight attendants

The social dimension of service workers’ job satisfaction the perspective of flight attendants

Ngày tải lên : 11/09/2013, 11:44
... as one factor of social dimension Organizational reputation can be another factor of the social dimension Organizational reputation is the overall long-term evaluation about the organization by ... derived and the total accountability was 63.64% The value of KMO was Table Result of exploratory factor analysis for organizational characteristic Factors Eigen value Accumulated accountability Wage ... the social dimension outside the organization actually plays an important role in job selection as much as internal factors of the organization 2.2 Social Dimension as a Factor of Job Satisfaction...
  • 12
  • 569
  • 0
Between fathers and fetuses - the social construction of male reproduction and the politics of fetal harm

Between fathers and fetuses - the social construction of male reproduction and the politics of fetal harm

Ngày tải lên : 01/11/2013, 08:20
... symbols of the ‘crack baby’, ‘pregnant addict’ and ‘absent father’ emerged at the center of debate over fetal hazards (A more detailed analysis of the social and political construction of these ... absence of fathers in news reports of crack babies was made easier to believe by the racial subtext of the story: African–American women are often characterized as abandoned, single mothers – ... of the symbol of the pregnant addict, has proved more diYcult Both metaphorically and literally, fathers were absent from virtually all of the news stories on fetal health and addiction The absence...
  • 18
  • 862
  • 0
Theories of cognition, emotion and the social world - missing links in psychosis

Theories of cognition, emotion and the social world - missing links in psychosis

Ngày tải lên : 01/11/2013, 09:20
... Negative appraisals of symptoms, of self and of others are of great clinical importance because they relate to suicidal ideation and high alcohol intake (Fialko et al., 2006) The appraisal of danger ... physical matrix of disorder, but they add to the complexity and probably to the potential of explanation They form one part of the overall model There are several variants, and all are better ... function and increases risk of schizophrenia Proceedings of the National Academy of Sciences of the USA, 102, 8627–32 Cantor-Graae, E and Selten, J P (2005) Schizophrenia and migration: a meta-analysis...
  • 19
  • 544
  • 0
Tài liệu To establish an Office on Women’s Health within the Department of Health and Human Services, and for other purposes pdf

Tài liệu To establish an Office on Women’s Health within the Department of Health and Human Services, and for other purposes pdf

Ngày tải lên : 13/02/2014, 07:20
... REPORTS.—Not later than January 31, 2003, 22 and January 31 of each second year thereafter, the Direc23 tor of the Office shall prepare and submit to the appro24 priate committees of Congress a report ... recommendations to the Di- rector of the Agency concerning findings made under subparagraphs (A) and (B) ‘‘(d) REPORTS.—Not later than January 31, 2003, and January 31 of each second year thereafter, ... make annual estimates of funds needed to 19 monitor clinical trials and analysis of data by sex in 20 accordance with needs that are identified; and 21 ‘‘(6) serve as a member of the Department of...
  • 18
  • 644
  • 0
Tài liệu To improve the health of women through the establishment of Offices of Women’s Health within the Department of Health and Human Services pdf

Tài liệu To improve the health of women through the establishment of Offices of Women’s Health within the Department of Health and Human Services pdf

Ngày tải lên : 13/02/2014, 07:20
... estab- 11 lish within the Office of the Administrator of the Health 12 Resources and Services Administration, an office to be 13 known as the Office of Women’s Health The Office shall 14 be headed ... REPORTS.—Not later than year after the date 11 of enactment of this section, and every second year there12 after, the Director of the Office shall prepare and submit 13 to the appropriate committees of ... REPORTS.—Not later than year after the date 16 of enactment of this section, and every second year there17 after, the Director of the Office shall prepare and submit 18 to the appropriate committees of...
  • 23
  • 627
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20
... GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA ... CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG ... dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

Ngày tải lên : 18/02/2014, 13:20
... (lacking the b4-strand aspartate) This may mean that the eventuality of a- glucosidase activity of true rBATs cannot be unambiguously eliminated The selected CSRs (Fig 2) characteristic of the a- amylase ... and S Janecek Origin of rBAT and 4F2hc within the GH13 a- amylase family Fig The CSRs of the hcHAT proteins and the GH13 a- amylase family members A list of the abbreviations of proteins and enzymes ... Takata H, Kuriki T, Okada S, Takesada Y, Iizuka M, Minamiura N & Imanaka T (1992) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1...
  • 14
  • 564
  • 0
Tài liệu Within the Realm of Possibility docx

Tài liệu Within the Realm of Possibility docx

Ngày tải lên : 19/02/2014, 01:20
... of Andile Gwabeni and Siyabonga Gwabeni of the University of Fort Hare, Asaph Ndlovu, Sekgothe makgoatsana and Phuti mokwele of the University of the North, and Catherine Odora Hoppers and Jane ... Frank Chikane, Abraham Tiro, Cyril Ramaphosa, Justice mokagdi mailula, mathews Phosa and others made their mark in student politics and in various areas of study Today UNIN alumni count among the ... University’s East London campus is placing challenges on the already strained resource base and financial management capacity of UFH There are advantages to be gained from the absorption of the campus,...
  • 182
  • 403
  • 1

Xem thêm