quot flow quot is the corpus in the operation of a steel production process

metallurgical process engineering

Ngày tải lên : 02/04/2014, 15:47

... including analysis-integration of steel manufacturing process, control of multi-factorial mass flow in steel manufacturing process At the same time, the author emphasizes the time in the manufacturing ... manufacturing process Schematic of concept of analysis-integration of steel manufacturing process 106 The block diagram of analysis-integration model of steel manufacturing process 107 Schematic of ... nature It appears that the opinions of all countries are unanimous in these aspects A typical opinion is that of the AISI (Kavanagh, Carson, Dasgupta, et ai, 1998), which maintains that steel will...

361
675
0

Báo cáo khoa học: "Combining Tree Structures, Flat Features and Patterns for Biomedical Relation Extraction" ppt

Ngày tải lên : 08/03/2014, 21:20

... unlexicalized parsing In Proceedings of ACL 2003, pages 423–430, Sapporo, Japan David McClosky 2010 Any Domain Parsing: Automatic Domain Adaptation for Natural Language Parsing Ph.D thesis, Department of ... training corpus as it is the standard evaluation approach adopted by all the other studies on PPI extraction for comparing results All the results of the previous approaches reported in this table ... workshop: Learning Language in Logic (LLL05), pages 31–37 Toshihide Ono, Haretsugu Hishigaki, Akira Tanigami, and Toshihisa Takagi 2001 Automated extraction of information on protein–protein interactions...

10
377
0

Báo cáo y học: "he paediatric flat foot and general anthropometry in 140 Australian school children aged 7 - 10 years" ppsx

Ngày tải lên : 10/08/2014, 21:24

... additional research assistant: height, weight and waist girth Height was measured using a calibrated height gauge, weight using digital read-out scales and waist girth was measured using a standard ... angela.evans@unisa.edu.au School of Health Science, Division of Health Science, University of South Australia, City East Campus, North Terrace, Adelaide 5000, South Australia The definition of ... musculoskeletal pain, fractures, increased tibial/genu varum (Blount’s disease), slipped capital femoral epiphysis, and a flat foot posture [2] The paediatric flat foot is a controversial topic within the...

8
396
0

Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Ngày tải lên : 19/02/2014, 08:20

... in some of the assay lanes than at the start of the assay (Fig 7B, lane 1) results from the continued activity of the malonylCoA–ACP transacylase To summarize, the K328 isoleucine, glutamic acid ... conformational change in ACP proposed to inject the acyl chain into the substrate-binding pocket [32] If a similar mechanism is involved in the KAS I reaction then an intermediate ACP-acyl–KAS I ... and alanine mutants appear to totally lack decarboxylation activity, whereas the histidine, arginine and phenylalanine mutants are active, although less efﬁcient than the wild-type Transfer of...

16
450
0

Tài liệu Báo cáo khoa học: The undecided serpin The ins and outs of plasminogen activator inhibitor type 2 pdf

Ngày tải lên : 20/02/2014, 02:21

... (intracellular ⁄ extracellular) expression pattern of PAI-2 has also been shown for a related serpin known as maspin [13] and this feature remains one of the most intriguing aspects of PAI-2 (and maspin) ... PAI-2 in the metastatic spread of cancer of the neck, lung and breast [49–53] The only established protease target for PAI-2, namely uPA, is strongly implicated in facilitating cell dissemination ... Gliemann J (1993) Type-2 plasminogen-activator inhibitor is a substrate for trophoblast transglutaminase and factor XIIIa Transglutaminase-catalyzed cross-linking to cellular and extracellular...

10
466
0

Tài liệu Báo cáo khoa học: "Extracting Comparative Entities and Predicates from Texts Using Comparative Type Classification" pptx

Ngày tải lên : 20/02/2014, 04:20

... Secondly, the third labeler annotated the conflicting part of the corpus All three labelers discussed any conflict, and finally reached an agreement Table lists the distribution of the corpus Comparative ... Transformation-based Error-Driven Learning and Natural language Processing: A Case Study in Part -of- Speech tagging Computational Linguistics, 543-565 Gil-jong Ha 199 9a Korean Modern Comparative ... that this kind of sentence is as important as the other explicit comparisons from an engineering point of view After defining the seven comparative types, we simply match each sentences to a particular...

9
405
0

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Ngày tải lên : 07/03/2014, 21:20

... GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary ampliﬁcation with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ ... CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA ... a primary ampliﬁcation with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢...

9
422
0

Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx

Ngày tải lên : 08/03/2014, 22:20

... BIAcore analysis of binding of IGF-I, IGF-II and mutant IGF analogue to rhIGF1R Data were analysed using BIAevaluation software 3.0 and ®tted to a Langmuir : binding model as outlined in Materials ... withdrawalinduced apoptosis in the rat pheochromocytoma PC12 cell line, a well-established model of neuronal apoptosis [18±20] This study clearly indicates that the binding af®nity of IGF analogues ... Materials and methods The dissociation constant (Kd) was determined from the calculation of kd/ka, where ka is the association rate and kd is the dissociation rate Relative Kd is equal to Kd of...

8
482
0

Đề tài " Quasilinear and Hessian equations of Lane-Emden type " docx

Ngày tải lên : 15/03/2014, 09:20

... that the usual p-capacity cap1, p used in the studies of the p-Laplacian [HKM], [KM2] plays a secondary role in the theory of equations of Lane-Emden type Relations between these and other capacities ... that of Theorem 2.3 in the quasilinear case using W 2k , k+1 in place of W1, p k+1 and Theorem 7.6 in place of Theorem 5.3 The proof of our next theorem on the existence of solutions for Hessian ... many fundamental results, and relations to other areas of analysis and geometry are presented The theory of fully nonlinear equations of Monge-Amp`re type which e involve the k-Hessian operator...

58
375
0

Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx

Ngày tải lên : 16/03/2014, 14:20

... puriﬁcation, characterization and structural analysis of charybdin, a novel 29-kDa type ribosome-inactivating protein, from bulbs of the white variety of C maritima agg Ribosome-inactivating protein from ... It is interesting to note that the C maritima agg bulbs contain extremely high quantities of the charybdin protein The initial extract contained mainly charybdin and very small amounts of other ... maritima agg caused problems during the characterization and crystallization of charybdin The yield of the puriﬁed protein was 150–200 mg protein per 100 g of bulbs Charybdin appeared as a single...

9
424
0

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Ngày tải lên : 23/03/2014, 09:20

... hydrolase family [18] The characteristics of serine hydrolases include a tertiary structure called the a ⁄ b-hydrolase fold and a catalytic triad consisting of a serine, aspartate and histidine ... hydrolases The ORF was annotated as a conserved hypothetical protein [16] The gene encodes a protein of 412 amino acids and has a calculated molecular mass of 46.5 kDa BLAST-P analysis revealed the ... London Supplementary material The following supplementary material is available online: Fig S1 Amino acid sequence alignment of EstD This material is available as part of the online article from...

11
460
0

Báo cáo khoa học: "Tractability and Structural Closures in Attribute Logic Type Signatures" pptx

Ngày tải lên : 23/03/2014, 19:20

... covering constraints are generated, and as small changes in a partial order of types can have drastic effects on other parts of the signature because of appropriateness, incremental compilation of ... remain in If the maximum number of features appropriate to any type is , and there are types in the signature, then the cost of this is dominated by the cost of expanding the products, , since ... and this is still intractable in the worst case The advantage of suspending subtype covering constraints is that other principles of grammar and proof procedures such as SLD resolution, parsing...

8
349
0

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Ngày tải lên : 24/03/2014, 03:21

... smelt AFP binds a single Ca2+ in the same way as the herring AFP [15] In comparison with other C-type lectins and herring AFP, smelt AFP appears to be a remarkably proteaseresistant protein in both ... disappearance of the monomer band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher ... EDTA instead of CaCl2 In the absence of added Ca2+, dimerization was again observed (Fig 5C) The molecular mass of smelt AFP determined by HPLC gel-ﬁltration analysis was 50 kDa (Fig 6) As the...

8
518
0

Báo cáo khoa học: Expression, puriﬁcation and characterization of the second Kunitz-type protease inhibitor domain of the human WFIKKN protein pot

Ngày tải lên : 31/03/2014, 01:20

... the apparent Km values vs the inhibitor concentration at which they were obtained In the case of chymotrypsin, plasmin, thrombin, tissue plasminogen activator and plasma kallikrein, the proteases ... observed in the case of plasmin, lung tryptase, plasma kallikrein, thrombin, urokinase, tissue plasminogen activator, pancreatic kallikrein, chymotrypsin or elastase Such a marked trypsinspeciﬁcity is ... [8–10]) Thermal unfolding of the protein was monitored at 203 nm at a heating rate of 60 °CÆh)1 Effect of the recombinant protein on the activity of proteases The activity of the proteases on synthetic...

7
292
0

Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

Ngày tải lên : 31/03/2014, 07:20

... situated in the catalytic domain; ﬁve of them are buried and four are situated in the active site tunnel, stacking against the cellulose chain The ﬂuorescence emission maximum and quantum yield are ... stabilizes the protein fold both at acidic and alkaline pH The Cel 7A pH mutant having a more alkaline pH optimum, was shown to have lowered thermostability both at acidic and alkaline pH demonstrating ... Cel 7A [3] Only minor structural changes were observed in the mutant, apart from the changed atoms of the mutated side chains In order to evaluate further the design of the mutations, it was of interest...

8
422
0

Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebraﬁsh (Danio rerio) potx

Ngày tải lên : 31/03/2014, 07:20

... gggaGGCGgggctt ttcatCCAAtca ctaaAATTacagtgt atcaatATGCtaata aacatatgTAATaata aggtAATTacaatga ttgattttAAATaaac ATAAtttttaaaca aATGCaaaaa aaatATTCaa cATGCcaatt aatCCAAtaac ccaCCAAtatc tcaCCAAttga ... tcaCCAAttga aggacCCAAtaaggga agcGATAtta taaaGATAaacaa taagaGATAatcgg attaCAATtg caaaCAATgc aagaCAATaa cgaaCAATtt caaaCAATtt TGACgttt aaTGACtaatt atTGACtgaaa ctgaGTCAg Ó FEBS 2003 localized to the adult ... TATTGTCGTTAGAACGCGTAATACGACTCACTA TAGGGA-3¢, 3¢-CATGTATAACAGCAATCTTGCGC ATTATGCTGAGTGATATCCCTCTAG-5¢, using T4 DNA ligase (Promega) Following precipitation, the DNA was resuspended in 15 lL of sterile,...

11
366
0

cross plane electronic and thermal transport properties of p type la0.67sr0.33mno3 lamno3 perovskite oxide metal semiconductor superlattices

Ngày tải lên : 06/05/2014, 08:53

... sense the acoustic signal and transmit to a lock -in amplifier that measured the amplitude and phase shift of the pressure signal The measured signal was then related to thermal properties of the sample ... A Asamitsu, M Tamura, and Y Tokura, “Interplane tunneling magnetoresistance in a layered manganite crystal,” Science 274, 1698 (1996) 30 Y Moritomo, A Asamitsu, H Kuwahara, and Y Tokura, “Giant ... scans of LSMO/LMO on STO show all four films peaks separated by 90 , confirming in- plane epitaxy for all layers of the superlattice In order to determine the degree of relaxation and strain in the...

8
461
0

Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Ngày tải lên : 18/06/2014, 18:20

... laboratory is developing a live attenuated virus vaccine for HPIV1 for intranasal administration to infants and young children The intranasal route of administration is needle-free and has the ... sequencing We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis We also thank Brad Finneyfrock and Marisa St Claire at Bioqual Inc for carrying out the primate studies ... shut-off temperature is ≤40°C Evaluation of replication of viruses in AGMs and efficacy against challenge AGMs in groups of two to four animals at a time were inoculated intranasally (i.n.) and intratracheally...

13
504
0

Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx

Ngày tải lên : 20/06/2014, 01:20

... laboratory is developing a live attenuated virus vaccine for HPIV1 for intranasal administration to infants and young children The intranasal route of administration is needle-free and has the ... sequencing We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis We also thank Brad Finneyfrock and Marisa St Claire at Bioqual Inc for carrying out the primate studies ... shut-off temperature is ≤40°C Evaluation of replication of viruses in AGMs and efficacy against challenge AGMs in groups of two to four animals at a time were inoculated intranasally (i.n.) and intratracheally...

13
520
0

báo cáo hóa học:" Factors associated with psychological and behavioral functioning in people with type 2 diabetes living in France" pptx

Ngày tải lên : 20/06/2014, 15:20

... during the last quarter of 2001 were extracted from this database Statistical Analysis All descriptive statistics were presented as means and standard deviations for continuous variables, and as ... from the health insurance system database) were first tested by using analysis of variance (in the case of categorical independent variables) or simple linear regression (in the case of continuous ... mean that factors were not included in the final multivariable model Underlining indicates the most important association with the DHP scores a Presence of myocardial infarction, angina or heart...

8
470
0