Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein Lisa Rosgaard*, Agnieszka Zygadlo, Henrik Vibe Scheller, Alexandra Mant† and Poul Erik Jensen Plant Biochemistry Laboratory, Department of Plant Biology, The Royal Veterinary & Agricultural University, Frederiksberg, Denmark Subunit G of photosystem I (PSI-G) is one of the polypeptides that form the core of metaphyte PSI (reviewed in [1]). This intricate complex of more than 100 pigments and 14 polypeptides uses solar energy to transfer electrons from plastocyanin (PC) in the thylakoid lumen, across the thylakoid membrane to Keywords His-tag; membrane topology; photosystem I; Strep-tag; transgenic Arabidopsis Correspondence P. E. Jensen, Plant Biochemistry Laboratory, Department of Plant Biology, The Royal Veterinary & Agricultural University, 40, Thorvaldsensvej, DK-1871 Frederiksberg C, Denmark Fax: +45 35283333 Tel: +45 35283354 E-mail: peje@kvl.dk *Present address Novozymes A ⁄ S, Starch R & D, Laurentsvej 55, Bagsværd, Denmark †Present address Molecular Immunology Group, Cancer Sciences Division, Southampton General Hospital, Mailpoint 824, Tremona Road, Southampton, SO16 6YD, UK Note L. Rosgaard and A. Zygadlo contributed equally to this work (Received 9 May 2005, revised 14 June 2005, accepted 17 June 2005) doi:10.1111/j.1742-4658.2005.04824.x Subunit G of photosystem I is a nuclear-encoded protein, predicted to form two transmembrane a-helices separated by a loop region. We use in vitro import assays to show that the positively charged loop domain faces the stroma, whilst the N- and C-termini most likely face the lumen. PSI-G constructs in which a His- or Strep-tag is placed at the C-terminus or in the loop region insert with the same topology as wild-type photosys- tem I subunit G (PSI-G). However, the presence of the tags in the loop make the membrane-inserted protein significantly more sensitive to trypsin, apparently by disrupting the interaction between the loop and the PSI core. Knock-out plants lacking PSI-G were transformed with constructs enco- ding the C-terminal and loop-tagged PSI-G proteins. Experiments on thylakoids from the transgenic lines show that the C-terminally tagged ver- sions of PSI-G adopt the same topology as wild-type PSI-G, whereas the loop-tagged versions affect the sensitivity of the loop region to trypsin, thus confirming the in vitro observations. Furthermore, purification of PSI complexes from transgenic plants revealed that all the tagged versions of PSI-G are incorporated and retained in the PSI complex, although the C-terminally tagged variants of PSI-G were preferentially retained. This suggests that the loop region of PSI-G is important for proper integration into the PSI core. Our experiments demonstrate that it is possible to pro- duce His- and Strep-tagged PSI in plants, and provide further evidence that the topology of membrane proteins is dictated by the distribution of posit- ive charges, which resist translocation across membranes. Abbreviations Chl, chlorophyll; Fd, ferredoxin; FNR, ferredoxin-NADP + oxidoreductase; His-tag, hexa-histidine tag; LHCI, light harvesting complex associated with photosystem I; PSI, photosystem I; Lhcb1, major light harvesting complex apoprotein associated with photosystem II; PC, plastocyanin; Strep-tag, trp-ser-his-pro-gln-phe-glu-lys tag. 4002 FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS ferredoxin (Fd) on the stromal side. Reduced Fd can donate electrons via ferredoxin-NADP + oxidoreduc- tase (FNR) to produce NADPH, a central currency of chemical energy. Light energy is channelled to the PSI core by a peripheral antenna or light harvesting com- plex (LHCI), consisting of four members (Lhca1–4) of the chlorophyll a ⁄ b binding protein family. LHCI is bound along one side of PSI only, in the vicinity of the PSI-F and PSI-J subunits [2,3]. Apart from the asymmetry conferred by LHCI, PSI in both cyanobac- teria and plants is a relatively rounded, featureless structure when single particles are viewed by electron microscopy. PSI-G, which is absent from cyanobacterial PSI, shares  30% amino-acid identity with PSI-K in Arabidopsis [4]. Studies using knockout [5,6] and anti- sense [7] Arabidopsis lines have proposed that PSI-G plays a role in stabilizing the PSI core and the peri- pheral antenna, respectively. Additionally, PSI-G may be an important regulator of PSI activity [6,7]. PSI-K, on the other hand, appears to be important for sta- bilizing antenna proteins Lhca2 and -a3 [5,8]. Both proteins are encoded by the nuclear genome with N-terminal chloroplast transit (targeting) peptides, and are predicted to form two transmembrane a-heli- ces, separated by a charged loop region (Arabidopsis PSI-G: 6 positive and 7 negative charges; Arabidopsis PSI-K: 4 positive and 3 negative charges). Topology studies of barley PSI-K showed that the protein con- forms to the ‘positive-inside rule’ [9], by having the positively charged loop in the stroma, with N- and C-termini in the thylakoid lumen [10]. This finding agreed with the topology of cyanobacterial PSI-K, as determined by X-ray crystallography of Synechococcus elongatus PSI [11,12]. The crystal structure placed cyanobacterial PSI-K at the outside edge of the com- plex, a position that has recently been confirmed for metaphytes, with the publication of a 4.4 A ˚ crystal structure for Pisum sativum photosystem I [3]. In this structural model, PSI-G is located on the opposite edge of the PSI complex from PSI-K [3], which is in good agreement with biochemical evidence [5,7,13]. The homology between PSI-G and PSI-K, from which PSI-G probably arose by gene duplication [4], would suggest a ‘horseshoe’-like topology, with the loop facing the stroma and the N- and C-termini in the thylakoid lumen. This topology is also suggested by the structural model of PSI based on the 4.4 A ˚ crystal structure [3]. However, a resolution of 4.4 A ˚ does not reveal enough structural detail to determine the actual topology of a membrane protein and so far there is no biochemical evidence to support the proposition. We sought to determine the topology of PSI-G and to test the feasibility of rescuing Arabidopsis PSI com- plexes lacking PSI-G with tagged constructs. Successful introduction of a hexa-histidine (His)- or Strep-tagged PSI-G into PSI will pave the way for determining the polypeptide’s location within the complex by means of immunogold electron microscopy and single-particle analyses. It will also provide a useful orientation mar- ker for the otherwise very rounded PSI complex, and potentially act as an affinity tag for preparation of ultra-pure PSI particles. His-tags have already been used to purify active PSII both from Synechocystis 6803 [14] and Chlamydomonas reinhardtii [15] and to determine the location of PsbH in photosystem II (PSII) of C. reinhardtii [16]. We now report the expres- sion of His- and Strep-tagged plant PSI. Results A series of cassettes containing tagged variants of the full-length precursor of Arabidopsis PSI-G (acces- sion AJ245630) were generated by PCR. Strep- (WSHPQFEK) or His-tags were inserted in the loop region, between nucleotide positions 386 and 387, or at the extreme C-terminus of PSI-G (Fig. 1). These cassettes were both cloned into binary vectors under the control of the 35S promoter and terminator, and into vectors for in vitro transcription and translation. An Arabidopsis line (psag-1.4 [5], termed DG in this report), lacking PSI-G due to a transposon footprint in exon 1, was transformed with the different con- structs, but to test the ability of the tagged PSI-G to be correctly targeted and inserted into the thylakoid membrane, initial analyses were carried out in vitro. Fig. 1. Schematic representation of PSI-G and the recombinant ver- sions of PSI-G used in this study. The two transmembrane span- ning helices are indicated as filled boxes. The positively charged amino acids in PSI-G are indicated by +. Position of the His-tag (HHHHHH) and the Strep-tag (WSHPQFEK) in either the loop region or the C-terminus of PSI-G is indicated. HisT, PSI-G-HisTerm; StrepT, PSI-G-StrepTerm; HisL, PSI-G-HisLoop; StrepL, PSI-G-Strep- Loop. L. Rosgaard et al. Tagged photosystem I FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS 4003 Targeting of His- and Strep-tagged PSI-G constructs in vitro The loop region of PSI-G contains 6 positively charged amino acids; in agreement with the ‘positive inside rule’ [9], topology prediction servers such as TMHMM (http://www.cbs.dtu.dk/ [17]) predict PSI-G to have two transmembrane regions connected by a stromal loop, with the N- and C-termini in the thylakoid lumen. In order to test this topology prediction, wild- type and tagged PSI-G were transcribed and translated in vitro, then incubated with isolated, intact pea chlo- roplasts, as described in Experimental procedures. Analysis of chloroplast fractions postimport (Fig. 2) shows that all constructs are processed and imported by isolated chloroplasts. In each case, the full-length precursor protein (Fig. 2, lanes Tr) is processed to a smaller polypeptide, corresponding in size to mature PSI-G (Fig. 2, panels i, and iii–vi, lanes C). This pro- tein is inside the chloroplasts, because it is protected from thermolysin digestion (Fig. 2, lanes C+). As a control, full-length precursor proteins were digested with thermolysin, to ensure that the mature PSI-G seen in lanes C+ does not derive from PSI-G bound to the outside of the chloroplast. None of the precur- sor proteins yielded a mature-sized degradation prod- uct when incubated with thermolysin (Fig. 2, lanes Tr+). wild-type and all tagged PSI-G constructs frac- tionate with the thylakoid membrane (Fig. 2, lanes T), but differences become apparent when the thylakoid membranes are digested with trypsin, a protease that cleaves after arginine and lysine residues (6 of which are present in the loop of wild-type PSI-G). Wild-type PSI-G resists digestion (Fig. 2, panel i, lane T+), while a control protein, Lhcb1, is digested to a charac- teristic degradation product, DP (Fig. 2, panel ii, lane T+). Resistance to trypsin digestion suggests either that PSI-G’s positive charges (Fig. 1) are on the trans- side of the thylakoid, or that they are shielded from trypsin digestion on the cis-side of the membrane. The A B Fig. 2. Determination of the topology of PSI-G in the thylakoid membrane using in vitro import experiments. (A) Insertion of Arabidopsis thaliana wild-type PSI-G or tagged PSI-G into thylakoids. Shown are fluorograms of the fractions obtained from import of radioactive precursors into isolated, intact pea chloroplasts. The lanes correspond to: in vitro-translated precursor (Tr), thermolysin-treated precursor (Tr+), total, washed chloroplasts immediately post- import (C), thermolysin-treated chloroplasts (C+), stromal extract (S), thylakoids (T), and trypsin-treated thylakoids (T+). Panel i, wild-type PSI-G; panel ii Lhcb1; panel iii, PSI-G-HisTerm; panel iv, PSI-G-StrepTerm; panel v, PSI-G-HisLoop; panel vi, PSI-G-StrepLoop. DP indicates the charac- teristic degradation product yielded when membrane-inserted Lhcb1 is digested by trypsin. A set of degradation products yielded by trypsin digestion of thylakoidal PSI-G-HisLoop is denoted by an asterisk. (B) Insertion of Chlamydomonas reinhardtii PSI-G into thylakoids (Lanes as in panel A). Alignment of the loop region of Arabidopsis and Chlamydomonas PSI-G. Positively charged amino acids are shown in italics. Tagged photosystem I L. Rosgaard et al. 4004 FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS first scenario is consistent with a topology where the loop is in the thylakoid lumen, and the N-and C-ter- mini face the stroma, opposite to that of PSI-K. On the other hand, the second scenario implies a stromal loop, like that of PSI-K, but unusally inaccessible to trypsin – unlike PSI-K [10]. The two constructs tagged at the C-terminus, PSI-G-HisTerm and PSI-G-Strep- Term, are also resistant to trypsin digestion of the thylakoids (Fig. 2, panels iii and iv, lanes T+), but those tagged in the loop domain, PSI-G-HisLoop and PSI-G-StrepLoop, are degraded by trypsin (Fig. 2, panels v and vi, lanes T+). This strongly suggests that the positively charged loop domain in the latter two constructs is accessible to trypsin on the stromal side of the membrane and that placing the tags in the loop prevents PSI-G from adopting its normal conforma- tion in the membrane. Chlamydomonas PSI-G was imported into pea chloro- plasts to assess whether other PSI-G molecules show similar topological characteristics (Fig. 2B). Post- import analysis indicates a trypsin-sensitive loop facing the stroma, and therefore supports a topology in which PSI-G has a stromal loop (Fig. 2B, lane T+). An alignment of the Arabidopsis and Chlamydomonas PSI-G loop regions is also shown in Fig. 2B, from which it is evident that the algal loop contains a simi- lar distribution of positive charges, although fewer than Arabidopsis (4 instead of 6). Aside from the charge distributions, the loops exhibit enough variation to leave room for altered protein–protein interactions, which may explain why the Chlamydomonas loop region is exposed to trypsin in the in vitro assay. The in vitro import experiments suggested that the loop of Arabidopsis PSI-G faces the stroma. However, it was also clear that this loop must adopt an unusu- ally stable structure that is resistant to trypsin diges- tion under the standard conditions commonly used to determine the topology of thylakoid membrane pro- teins. To find out whether the in vitro behaviour was anomalous, a range of experiments was performed using thylakoid membranes isolated from wild-type Arabidopsis (Fig. 3A). wild-type thylakoids were incu- bated on ice with trypsin for defined periods, then the thylakoid proteins were separated by SDS ⁄ PAGE and analysed by immunoblotting using antibodies recogni- zing PSI subunits with known location and topology. Quantification of the signal showed that even after a 60 min incubation with trypsin, 60–70% of the PSI-G protein remains. Yet in the same sample, PSI-K, which is known to have a stromal loop, is completely diges- ted. On the other hand, the loop of PSI-O, which is protected in the thylakoid lumen, is unaffected by the trypsin treatment, while PSI-D, which is a stromal, extrinsic PSI subunit, is degraded to a smaller peptide by the trypsin treatment. In Fig. 3B, a similar experi- ment has been performed upon PSI complexes purified from sucrose gradients after solubilization of the thylakoid membrane using the detergent dodecyl- b-d-maltoside. Here, the solubilization of the complex from the membrane clearly renders the PSI-O subunit accessible to the protease but the PSI-G subunit still resists complete protease digestion. In fact, only when the highly active, nonspecific, proteinase K is used, is it possible to degrade PSI-G significantly (Fig. 3C). A C B Fig. 3. Protease treatment of thylakoid membranes and PSI com- plexes isolated from wild-type Arabidopsis. (A) Digestion of thyla- koid membranes over time. Immunoblot of thylakoid samples after 0, 30 and 60 min digestion with trypsin, probed with antibodies directed against PSI-G, PSI-K (intrinsic membrane protein, stromal loop), PSI-O (intrinsic membrane protein, luminal loop) and PSI-D (extrinsic membrane protein, stromal side). Each lane corresponds to 2 lg Chl. (B) Digestion of PSI complexes purified from wild-type Arabidopsis thylakoids after detergent solubilization and sucrose gradient centrifugation. Immunoblot of undigested (–) PSI com- plexes and complexes digested with trypsin for 30 min (+). Anti- bodies used as in part A. Each lane corresponds to 1 lg Chl. (C) Digestion of thylakoids (2 lg Chl) and PSI complexes (1 lg Chl) using trypsin and proteinase K. Immunoblots probed with antibod- ies directed against PSI-G and PSI-D. L. Rosgaard et al. Tagged photosystem I FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS 4005 These results support the notion that PSI-G adopts an unusually protease-resistant structure when associated with PSI in the thylakoid membrane. Importantly however, the observation that PSI-G in thylakoid membranes is partially degraded under conditions where a protease-susceptible subunit such as PSI-O, with a known lumenal loop resists degradation, strongly indicates that the PSI-G loop is stromal. Expression of Strep- and His-tagged PSI-G constructs in vivo To extend the in vitro import experiments to in vivo conditions, an Arabidopsis mutant in which the psaG gene has been disrupted by transposon insertion [5] was transformed with constructs encoding the tagged versions of PSI-G. DG plants germinate normally, but grow slightly smaller, paler and flower slightly later than wild type [5]. However, in our growth chambers, DG plants display a less pronounced phenotype. In total, c. 620 T 1 and T 2 plants from two separate trans- formation experiments were screened by immunoblot- ting, and approximately 50% of those transformed with a PSI-G construct (as opposed to an empty vec- tor), expressed PSI-G or its tagged counterpart. Thylakoids were prepared from pools of plants expressing similar levels of PSI-G, and analysed by immunoblotting, using antibodies to PSI-G and PSI-F, as an indicator of the relative content of PSI in the samples. Plants lacking PSI-G have 40% less PSI com- pared to wild-type [5,7]. Representative thylakoid pre- parations are shown in Fig. 4A. From the immunoblot it is clear that the steady state level of PSI-G, expressed as the PSI-G to PSI-F ratio, in all the transformed lines is lower than in the true wild type. This suggests that the expression of PSI-G and steady state level of PSI-G in all the transformed lines is suboptimal. High resolution SDS ⁄ PAGE shows that PSI-G bear- ing a His- or Strep-tag migrates more slowly than wild-type PSI-G, with all tagged constructs behaving similarly, typified in Fig. 4B. That these bands repre- sent PSI-G carrying the appropriate tag was confirmed by probing gel blots with an anti-hexa-His antibody or StrepTactin-HRP conjugated with horseradish peroxi- dase. The results for the tagged constructs are shown in Fig. 4C. Interestingly, both tags are recognized more efficiently in the context of the PSI-G loop region than at the C-terminus. Topology of PSI-G in vivo In order to examine the topology of PSI-G in vivo, samples of thylakoids from wild-type (empty vector) and transformed plants were treated separately with thermolysin and trypsin as described for the in vitro import analyses. PSI-G, and a control protein, Lhcb1, were then detected by immunoblotting (Fig. 5). Wild- type and C-terminally tagged PSI-G resist digestion by either protease whereas PSI-G-HisLoop and PSI- G-StrepLoop are sensitive to both proteases. Lhcb2 is, as expected, clipped by both proteases. The beha- viour of the wild-type and tagged constructs in vivo exactly parallels the in vitro results, and suggest that PSI-G carrying either a C-terminal or a loop His- or Strep-tag is able to insert into the thylakoid mem- brane with the same topology as wild-type PSI-G. The versions of PSI-G that carry a His- or a Strep- tag in the loop are sensitive to digestion by the pro- teases, whereas the C-terminally tagged versions remain as protease-resistant as the wild-type protein. Thus, the loop-tags disrupt the structure of the loop A B C Fig. 4. Tagged PSI-G is present in thylakoids of DG plants trans- formed with the various PSAG constructs. (A) Immunoblot of pooled thylakoids (0.5 lg Chl per lane) from lines expressing wild- type or tagged PSI-G, or lacking PSI-G (DG). PSI-F is detected as an indicator of PSI content. The ratio PSI-G ⁄ PSI-F is indicated under each lane (nd, not determined). (B) Comparison of the migration of wild-type and His-tagged PSI-G by high-resolution SDS ⁄ PAGE. (C) Immunodetection of His and Strep tags in PSI-G constructs. Tagged photosystem I L. Rosgaard et al. 4006 FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS and ⁄ or its interaction with other proteins such as the PSI core. Incorporation of tagged PSI-G into PSI Whilst it is evident that both C-terminally and loop- tagged PSI-G can insert into the thylakoid in vivo (Figs 4 and 5), it is possible that the tags hinder assem- bly into PSI complexes. Therefore, it was of interest to find out whether any of the tagged proteins are assem- bled into PSI complexes. We solubilized thylakoid membranes using dodecyl-b-d-maltoside and purified PSI complexes using sucrose gradient centrifugation. The purified PSI complexes were then analysed by immunoblotting, using antibodies against PSI-G and PSI-F (Fig. 6A). That PSI-G contained the appropri- ate tag was confirmed by probing gel blots with an antihexa-His antibody or StrepTactin-HRP conjugated with horseradish peroxidase (Fig. 6B). The results clearly indicate that both the C-terminally and loop-tagged versions of PSI-G are present in PSI, sug- gesting that all versions of PSI-G can be incorporated into the PSI complex. However, C-terminally His- and Strep-tagged PSI-G seem to incorporate to a higher degree than the loop-tagged versions of PSI-G. This may suggest that the loop of PSI-G is important for stable integration of the subunit into the PSI complex. A protein band smaller that the tagged versions of PSI-G is present in the lanes with the loop-tagged PSI, but is also seen faintly in the lanes with the terminally tagged PSI. The respective tags were only present in the upper band (Fig. 6B) and we have no reason to believe that the lower band is a degradation product of the tagged versions of PSI-G. Cross-contamination with wild-type PSI-G during the process of preparing thylakoids or PSI particles can also be ruled out as the double band could be detected in at least two inde- pendent preparations of both thylakoids and PSI parti- cles from the four lines carrying the tagged versions of PSI-G. The most likely explanation is therefore that the psaG transposon knock-out line used for the trans- formation experiments is unstable and apparently a fraction of the cells within the plant revert to wild type, giving rise to the wild-type-sized immuno-detect- able band. It seems that transformation of the trans- poson-tagged psaG knock-out line somehow increases this reversion rate. Fig. 5. Tagged PSI-G inserts into the thylakoid membrane in vivo. Immunoblot of thylakoids (2 lg Chl per lane) isolated from plant lines transformed with the various constructs and subsequently subjected to protease treatment. The lanes correspond to: untreated thylakoids (T), thylakoids treated with thermolysin (P1) and thylakoids treated with trypsin (P2). DP denotes the character- istic degradation product of membrane-inserted Lhcb1 digested by thermolysin or trypsin. A B Fig. 6. The tagged PSI-G subunit is incorporated into photosystem I. (A) Immunoblot of PSI complexes (1 lg Chl per lane) purified from thylakoids shown in Fig. 5. The ratio of PSI-G : PSI-F is shown beneath the lanes (nd, not determined). B: Immunoblot of PSI com- plexes (1 lg Chl per lane) purified from thylakoids and probed with Anti-Hexa-His tag or Anti-Strep tag Ig, as indicated alongside the panels. L. Rosgaard et al. Tagged photosystem I FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS 4007 Discussion We have successfully incorporated His- and Strep- tagged PSI-G into Arabidopsis PSI complexes in vivo.In achieving this, we have been able to collect multiple lines of evidence that PSI-G inserts into the thylakoid mem- brane with a stromal loop and its N- and C-termini facing the lumen. PSI-G is markedly protected from trypsin degradation, both in vitro and in vivo, which means that the positively charged loop region is not eas- ily accessible to protease from the stromal face of the membrane. By contrast, PSI-K is cleaved by trypsin into two fragments, representing the two transmembrane spans [10]. However, PSI-G constructs with a His- or Strep-tag in the loop region are sensitive to proteases, indicating that the loop region becomes more accessible, presumably by disrupting protein–protein interactions within PSI, or by altering the conformation of the loop. His-tags were employed in a topological study of the major light harvesting chlorophyll a ⁄ b binding apopro- tein, Lhcb1 [18]. Interestingly, fusion of a His-tag to the C-terminus, which must cross the thylakoid membrane during insertion, did not prevent Lhcb1 adopting its cor- rect topology. The most likely explanation of our own experimental observations is that the C-terminal His- and Strep-tags are also translocated across the thylakoid membrane, such that PSI-G has the same topology as PSI-K. This means that PSI-G obeys the ‘positive-inside rule’ [9], which states that the topology of membrane proteins is dictated by the distribution of positive charges, which resist translocation across membranes. Our findings provide the first biochemical evidence for the predictions made by Ben-Shem et al. [3] in the interpretation of their crystal structure of Pisum sativum PSI, in which the loop of PSI-G is suggested to face the stroma. The amount of PSI-G in the transformed knock-out line does not reach the level of the wild type. The lines expressing the tagged versions of PSI-G all accumulate significantly lower amounts of PSI-G than wild-type; however, the data do not allow us to conclude that the loop-tagged versions of PSI-G accumulate to a lesser extent than the C-terminally tagged versions, although there is a weak tendency. Even the line transformed with the wild-type version of PSI accumulates less PSI-G than wild type. This is a somewhat surprising result as the 35S promoter used in this study should ensure strong constitutive expression of the gene. A likely explanation for this is that the transposon-tagged psaG gene in the knock-out line used for the transforma- tion experiments still produces a psaG transcript, and together with the strong constitutive expression of tagged or wild-type psaG transcripts, causes cosuppres- sion and subsequent accumulation of less PSI-G protein. Preliminary experiments in which individual transformants were found to accumulate near-wild- type levels of PSI-G at the age of 7–8 weeks after ger- mination, show that the transformants lost expression 4–5 weeks later (results not shown). In conclusion, we have shown using both in vitro and in vivo methods, that PSI-G adopts a topology in the thylakoid membrane with the loop facing the stroma and its N- and C-termini facing the lumen. We have also shown that plants lacking PSI-G can be transformed with tagged versions of PSI-G, albeit limited by the expression level of PSI-G in the transformants. Finally, we have demonstrated that His- or Strep-tagged PSI can be made in planta. In future experiments, we will evalu- ate its use for quick purification of PSI and alignment of PSI particles during structural determination of PSI using electron microscopy and single particle analysis. Experimental procedures PSAG constructs Constructs encoding tagged variants of Arabidopsis PSAG (accession number AJ245630) were prepared by polymerase chain reaction, using the EST 279G1T7 (obtained from the ABRC, Ohio, USA and described in [7]) as a template. Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI-G-HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CA GTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-ter- minal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CA TTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined). Constructs containing a His- or Strep-tag in the loop region (PSI-G-HisLoop and PSI-G-StrepLoop) were prepared in three stages: a primary amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢- GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢. The two amplified fragments were used as a combined template for the tertiary amplification, using primers 5¢-GCGGAGCTCATGGCCACAAGCGCA Tagged photosystem I L. Rosgaard et al. 4008 FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS TCAGC-3¢ and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ for both PSI-G-HisLoop and PSI-G-Strep- Loop. Tagged PSAG constructs were cloned either into pGEM Ò 4Z (Promega GmbH, Germany) under the SP6 pro- moter, for in vitro transcription and translation, or into pPS48 [20] under the control of the 35S promoter and termi- nator. For each tagged variant and the wild-type PSAG,a cassette containing the PSAG construct flanked by the 35S promoter and terminator was excised and ligated into the binary vector pPZP111 [21], ready for transformation of Agrobacterium tumefaciens. All DNA constructs were fully sequenced to confirm their identities before experimental use. In vitro import assays PSAG constructs were transcribed in vitro using SP6 RNA polymerase, then translated in a Wheat Germ Lysate system (Promega GmbH, Germany), in the presence of [ 3 H]leucine (Amersham Biosciences, Denmark). Intact chloroplasts were isolated from pea seedlings, and in vitro import assays were carried out as described in [22]. Samples were analysed by Tricine-SDS ⁄ PAGE [23] and fluorography. Transformation of Arabidopsis with tagged PSAG constructs Wild-type plants were Arabidopsis thaliana, ecotype Colum- bia 0. The Arabidopsis PSI-G knock-out line (DG [5], Columbia 0 background) was generously provided by Dr. D. Leister, Max Planck Institute, Cologne, Germany. Prior to transformation, plants were screened for the pres- ence or absence of PSI-G by immunoblotting. Five DG plants per construct were subjected to Agrobacterium-medi- ated transformation, using the floral dip method [24]. Five wild-type plants were transformed with an empty pPZP111 vector. Seeds from transformed plants were surface-steril- ized in 5% (v ⁄ v) sodium hypochlorite, 0.02% (v ⁄ v) Triton X-100, washed with sterile water and plated on MS medium supplemented with 50 lgÆmL )1 kanamycin. Kanamycin- resistant seedlings were transferred to soil and subsequently analysed for the expression of PSAG and the tagged con- structs by immunoblotting. That individual transformants contained the correct construct was confirmed by PCR amplification of genomic DNA using primers complement- ary to the 35S promoter and terminator, followed by DNA sequencing of the amplicons. Immunoblot analysis of transgenic Arabidopsis For screening of the transformants, one mature leaf was excised from each individual plant, placed in an Eppendorf tube and frozen in liquid nitrogen. Frozen tissue was pulverized in 200 lL protein extraction buffer [PEB: 100 mm Tris ⁄ HCl, pH 8.0, 50 mm EDTA, pH 8.0, 250 mm NaCl, 0.7% SDS, 1 mm dithiothreitol, 1· Complete Protease Inhibitor Cocktail (Roche)], using a pestle. The sample was then incubated at 68 °C for 10 min, followed by centrifuga- tion at 15 000 g for 10 min at 4 °C. The supernatant was removed, transferred to a fresh tube, and its chlorophyll con- tent estimated by measuring light absorbance at 652 nm [25]. Protein equivalent to 2 lg chlorophyll was acetone-precipita- ted before being separated by SDS ⁄ PAGE and transferred to nitrocellulose. Antibodies employed were rabbit polyclonals against PSI-G, PSI-F and a monoclonal anti-His tag anti- body (Novagen, Merck Biosciences GmbH, Germany). The Strep tag was detected on blots using StrepTactin coupled to Horse Radish Peroxidase (Bio-Rad, Herlev, Denmark). Sam- ples equivalent to 0.125, 0.250 and 0.500 lg chlorophyll were analysed for quantitative immunoblot analysis of thylakoid PSI proteins. For immunoblotting of purified PSI particles, samples containing 0.5 and 1 lg chlorophyll were analysed. Isolation of thylakoid membranes and PSI particles from Arabidopsis Healthy leaves from typically 5–10 Arabidopsis plants were pooled. Thylakoid membranes were isolated according to [26]. PSI particles were isolated from thylakoids after solu- bilization with dodecyl-b-d-maltoside and sucrose density ultracentrifugation, as described in [8]. Trypsin treatment of thylakoids and PSI particles Thylakoid membranes equivalent to 2 lg Chl and PSI com- plexes equivalent to 1 lg Chl were treated with trypsin (Sig- ma, type XIII) on ice at 0.25 mgÆmL )1 final concentration. Thylakoid digestions were carried out in 10 mm Hepes ⁄ KOH, pH 8.0, 5 mm MgCl 2 (HM) and PSI diges- tions were carried out in 20 mm Tricine ⁄ NaOH, pH 7.5, 0.06% dodecyl-b-maltoside. PSI incubations were stopped by addition of soybean trypsin inhibitor (Sigma type I-S) to a final concentration of 1 mgÆmL )1 and boiling loading buf- fer. In the case of thylakoids, the samples were washed in 400 lL HM and the pellets resuspended in trypsin inhibitor and boiling loading buffer. Samples were loaded on SDS ⁄ PAGE gels for immunoblot analysis. Acknowledgements We thank the ABRC at Ohio State University for pro- viding ESTs and Lis Drayton Hansen for excellent technical assistance. We are grateful to Dr D. Leister for the gift of the Arabidopsis PSI-G knock-out line, Prof J D. Rochaix for the gift of the cDNA clone encoding Chlamydomonas PSI-G and to Dr A. Ben- Shem and Prof N. Nelson for sharing unpublished L. Rosgaard et al. Tagged photosystem I FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS 4009 data with us. The Danish National Research Founda- tion, the Danish Veterinary and Agricultural Research Council (23-03-0105) and the EU (Contract No HPRN-CT-2002–00248) are gratefully acknowledged. References 1 Jensen PE, Haldrup A, Rosgaard L & Scheller HV (2003) Molecular dissection of photosystem I in higher plants: topology, structure and function. Physiol Plant 119, 313–321. 2 Boekema EJ, Jensen PE, Schlodder E, van Breemen JFL, van Roon H, Scheller HV & Dekker JP (2001) Green plant photosystem I binds light harvesting complex I on one side of the complex. Biochemistry 40, 1029–1036. 3 Ben-Shem A, Frolow F & Nelson N (2003) Crystal structure of plant photosystem I. Nature 426, 630–635. 4 Kjærulff S, Andersen B, Skovgaard Nielsen V, Lindberg Møller B & Okkels JS (1993) The PSI-K subunit of photosystem I from barley (Hordeum vulgare L.): Evi- dence for a gene duplication of an ancestral PSI-G ⁄ K gene. J Biol Chem 268, 18912–18916. 5 Varotto C, Pesaresi P, Jahns P, Lessnick A, Tizzano M, Schiavon F, Salamini F & Leister D (2002) Single and double knock-outs of the genes for photosystem I subu- nits G, K and H of Arabidopsis. Effects on photosystem I composition, photosynthetic electron flow and state transitions. Plant Physiol 129, 616–624. 6 Zygadlo A, Jensen PE, Leister D & Scheller HV (2005) Photosystem I lacking the PSI-G subunit has a higher affinity for plastocyanin and is sensitive to photo- damage. Biochim Biophys Acta 1708, 154–163. 7 Jensen PE, Rosgaard L, Knoetzel J & Scheller HV (2002) Photosystem I activity is increased in the absence of the PSI-G. J Biol Chem 277, 2789–2803. 8 Jensen PE, Gilpin M, Knoetzel J & Scheller HV (2000) The PSI-K subunit of photosystem I is involved in the interaction between light-harvesting complex I and the photosystem I reaction center core. J Biol Chem 275, 24701–24708. 9 Gavel Y, Steppuhn J, Herrmann R & von Heijne G (1991) The ‘positive-inside rule’ applies to thylakoid membrane proteins. FEBS Letts 282, 41–46. 10 Mant A, Woolhead CA, Moore M, Henry R & Robinson C (2001) Insertion of PsaK into the thylakoid membrane in a ‘horseshoe’ conformation occurs in the absence of signal recognition particle, nucleoside triphosphates, or functional Albino3. J Biol Chem 276, 36200–36206. 11 Fromme P, Jordan P & Krauss N (2001) Structure of photosystem I. Biochim Biophys Acta 1507, 5–31. 12 Jordan P, Fromme P, Witt HT, Klukas O, Saenger W & Krauss N (2001) Three-dimensional structure of cyanobacterial photosystem I at 2.5 A ˚ resolution. Nature 411, 909–917. 13 Jansson S, Andersen B & Scheller HV (1996) Nearest- neighbor analysis of higher-plant photosystem I holo- complex. Plant Physiol 12, 409–420. 14 Bricker TM, Morvant J, Masri N, Sutton HM & Fran- kel LK (1998) Isolation of a highly active photosystem II preparation from Synechocystis 6803 using a histi- dine-tagged mutant of CP47. Biochim Biophys Acta 1409, 50–57. 15 Sugiura M, Inoue Y & Minagawa J (1998) Rapid and discrete isolation of oxygen-evolving His-tagged photo- system II core complex from Chlamydomonas reinhardtii by Ni 2+ affinity column chromatography. FEBS Lett 426, 140–144. 16 Bu ¨ chel C, Morris E, Orlova E & Barber J (2001) Locali- sation of the PsbH subunit in photosystem II: a new approach using labelling of His-tags with a Ni( 2+ )-NTA gold cluster and single particle analysis. J Mol Biol 312, 371–379. 17 Kosemund K, Geiger I & Paulsen H (2000) Insertion of light-harvesting chlorophyll a ⁄ b protein into the thyla- koid. Topographical studies. Eur J Biochem 267, 1138– 1145. 18 Krogh A, Larsson B, von Heijne G & Sonnhammer ELL (2001) Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J Mol Biol 305, 567–580. 19 Skerra A & Schmidt TGM (2000) Use of the Strep-tag and streptavidin for recombinant protein purification and detection. Methods Enzymol 326, 271–304. 20 Kay R, Shan A, Daly M & McPherson J (1987) Duplica- tion of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299–1302. 21 Hajdukiewicz P, Svab Z & Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25, 989–994. 22 Robinson C & Mant A (2002) Import of proteins into isolated chloroplasts and thylakoid membranes. In Molecular Plant Biology Volume Two: a Practical Approach (Gilmartin, P & Bowler, C, eds), pp. 123–146. Oxford University Press, Oxford, UK. 23 Scha ¨ gger & Von Jagow (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 166, 368–379. 24 Clough JC & Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J 16, 735–743. 25 Lichtenthaler HK (1987) Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol 148, 350–382. 26 Haldrup A, Naver H & Scheller HV (1999) The inter- action between plastocyanin and photosystem I is inefficient in transgenic Arabidopsis plants lacking the PSI-N subunit of photosystem I. Plant J 17, 689–698. Tagged photosystem I L. Rosgaard et al. 4010 FEBS Journal 272 (2005) 4002–4010 ª 2005 FEBS . Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein Lisa. C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CA GTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag