Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases Penny von Wettstein-Knowles1, Johan G Olsen2, Kirsten A McGuire1 and Anette Henriksen2 Genetics Department, Molecular Biology and Physiology Institute, Copenhagen University, Denmark Biostructure Group, Carlsberg Laboratory, Copenhagen, Denmark Keywords active site mutations; condensation reaction; fatty acid synthase; reaction mechanism; b-ketoacyl-ACP synthase Correspondence P von Wettstein-Knowles, Genetics Department, Molecular Biology and Physiology Institute, Copenhagen University, Øster Farimagsgade 2A, DK-1353 Copenhagen, Denmark Fax: +45 35322113 Tel: +45 35322180 E-mail: knowles@biobase.dk A Henriksen, Carlsberg Laboratory, Biostructure Group, Gamle Carlsberg Vej 10, DK-2500 Valby, Denmark Fax: +45 33274708 Tel: +45 33275222 E-mail: anette@crc.dk (Received 10 August 2005, revised December 2005, accepted 12 December 2005) doi:10.1111/j.1742-4658.2005.05101.x b-Ketoacyl-acyl carrier protein (ACP) synthase enzymes join short carbon units to construct fatty acyl chains by a three-step Claisen condensation reaction The reaction starts with a trans thioesterification of the acyl primer substrate from ACP to the enzyme Subsequently, the donor substrate malonyl-ACP is decarboxylated to form a carbanion intermediate, which in the third step attacks C1 of the primer substrate giving rise to an elongated acyl chain A subgroup of b-ketoacyl-ACP synthases, including mitochondrial b-ketoacyl-ACP synthase, bacterial plus plastid b-ketoacyl-ACP synthases I and II, and a domain of human fatty acid synthase, have a Cys-His-His triad and also a completely conserved Lys in the active site To examine the role of these residues in catalysis, H298Q, H298E and six K328 mutants of Escherichia coli b-ketoacyl-ACP synthase I were constructed and their ability to carry out the trans thioesterification, decarboxylation and ⁄ or condensation steps of the reaction was ascertained The crystal structures of wild-type and eight mutant enzymes with and ⁄ or without bound substrate were determined The H298E enzyme shows residual decarboxylase activity in the pH range 6–8, whereas the H298Q enzyme appears to be completely decarboxylation deficient, showing that H298 serves as a catalytic base in the decarboxylation step Lys328 has a dual role in catalysis: its charge influences acyl transfer to the active site Cys, and the steric restraint imposed on H333 is of critical importance for decarboxylation activity This restraint makes H333 an obligate hydrogen bond donor at Ne, directed only towards the active site and malonyl-ACP binding area in the fatty acid complex The formation of carbon–carbon bonds is a fundamental biochemical reaction A number of enzymes involved in various biosynthetic pathways accomplish this by different means Among these is a large family of enzymes involved in synthesis of fatty acids, waxes, flavins, natural drugs, and antibiotics making carbon– carbon bonds by use of the Claisen condensation principle Initially, an active site nucleophile induces a transesterification by nucleophilic attack on an acyl- thioester substrate In the second step, a b-carbanion thioester is generated by either proton abstraction or decarboxylation This strong nucleophile then attacks the carbonyl carbon of the first ester, resulting in a b-keto product (Scheme I) b-Ketoacyl-acyl carrier protein (ACP) synthase {3-oxoacyl-[acyl-carrier-protein] synthase (E.C 2.3.1.41)} I (KAS I) and KAS II from Escherichia coli represent a set of decarboxylating condensing enzymes, which we refer to as the CHH Abbreviations ACP, acyl carrier protein; KAS, b-ketoacyl-ACP synthase; WT–C8, KAS I–octanoyl complex FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 695 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al Scheme group because of the cysteine and two histidine activesite residues [1–3] Another group of decarboxylating condensing enzymes called CHN (N for asparagine), represented by KAS III and certain polyketide synthases [4–6], catalyze a similar three-step reaction with an active site composed of a cysteine nucleophile, a histidine and an asparagine Although CHN enzymes have a substantially altered active site structure and substrate-binding funnel, they are characterized by the same ababa-fold as the CHH enzymes Several conserved active site residues are important for the course of the b-ketoacyl-ACP synthase reaction in the CHH group of condensing enzymes These include: (a) the cysteine nucleophile (C163 in E coli KAS I), with a lowered pKa because of a position at the N-terminus of helix Na3 [3]; (b) two histidines (H298 and H333), promoting decarboxylation of malonyl and H333 also playing a role in the condensation reaction and for the pKa value of the nucleophile [7,8]; (c) a lysine (K328), required for decarboxylation and efficient transfer of the substrate to be elongated to C163 [7–9]; (d) an aspartate (D306) and a glutamate (E309), essential for decarboxylation [9]; (e) two threonines (T300 and T302), speculated to contribute to ACP binding during malonyl-ACP decarboxylation [2,3], and (f) a phenylalanine (F392), forming an oxyanion hole together with the backbone nitrogen of the nucleophile that promotes the transfer reaction [10] Although several studies, including crystal structures of both CHH and CHN enzymes [1,4,5,11,12] have contributed to the understanding of the role of conserved residues in the active site of CHH condensing enzymes, and analogies have been made with the reaction mechanism proposed for CHN condensing enzymes, a clear consensus about the exact role of the conserved residues in CHH enzymes has not emerged [1–5,8,9,12] In recent years, condensing enzymes have enjoyed substantial commercial interest The efficiency and precision with which these various enzymes carry out synthesis of rather complicated molecules such as ring systems [13] and wax components [14] are attractive 696 properties for drug synthesis research The fatty acid condensing enzymes have also come into focus as targets for new antibiotics [6,15–18] and in cancer treatment [19,20] A description of the exact role, electrostatic properties, and hydrogen bonding potentials of active site residues provides an optimized model of the ligand-binding potential of the active site, enabling differentiation between the active site properties of target enzymes to be made This study probes the roles of the active site histidines and lysine in the CHH condensing enzyme KAS I from E coli by use of crystal structures of active site mutants and biochemical characterization of the acyl transfer, decarboxylation and ⁄ or condensation steps of the reaction performed by these mutants The results establish that the CHH reaction mechanism is different from that of the CHN enzymes They reveal that: (a) K328 imposes steric restraints on H333 that are necessary for maintenance of the hydrogen bond network required for decarboxylation, and that its positive charge influences acyl transfer to the activesite cysteine; (b) H298 functions as a catalytic base in the decarboxylation reaction, and (c) H333 stabilizes the negative charge on C163 in the native enzyme, whereas in the intermediate fatty acyl complex it participates in the active site hydrogen bonding network by donation of a hydrogen bond Results Structure of KAS I and its C8 complex These structures were determined to ascertain whether the previously published structures of KAS I and KAS I–fatty acid complexes based on room temperature data and ester rather than thioester linkages (C163S mutant protein [3]) would cause erroneous interpretation of the stereochemistry in the active site The only significant differences, apart from the length of the fatty acids, in the active site between C163S–C12 and WT–C8 (KAS I–octanoyl complex) are (a) a slight rotation of H333 with maximal effect ˚ (0.4 A) at the Ne position (Fig 1) and (b) a cation detected octahedrally co-ordinated in the vicinity of the active site (Fig 2) Three of the six cation ligands are main-chain oxygen atoms, and three are the side-chain oxygen atoms of N296, E342 and S387 The glutamic acid and asparagine residues are conserved among known KAS I and KAS II sequences The serine residue is generally conserved, but can be a cysteine (in E coli KAS II [21,22]) or an asparagine (in Mycobacterium tuberculosis and Mycobacterium leprae KAS I and II [23,24]) FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al combinations of subunit pairs The two segments of the AC and BD dimer are involved in crystal packing at the AC interface, and the observed structural diversity is unlikely to be of biochemical significance The same is true for the mutated KAS I structures ˚ The distance between H333 Ne and C163 Sc is 3.2 A ˚ in the native and fatty acid complex, and 3.1 A respectively, and infers that H333 Ne donates a hydrogen bond to the nucleophile, although the Cys163 Cb–Cys163 Sc–His333 Ne angle is not optimal (87° and 96°, respectively) [25] The formation of the fatty acid complex is accompanied by the emergence of a welldefined water molecule within hydrogen bond distance of His333 Ne (Fig 3A,B) Structures of KAS I H298E and the H298E–C12 complex Fig Superimposition of the KAS I C163S-C12 (white, light colors) [3] and KAS I–C8 (gray, dark colors) active sites Red spheres are water molecules Blue atoms represent nitrogen, red represent oxygen, and green represents sulfur Figures 1, and are made in MOLSCRIPT [41] Fig The cation site as observed in both KAS I and mutant structures The color coding is as in Fig The two subunits of the KAS I homodimer have slightly larger than average discrepancies in the atomic ˚ positions in the segments 318–323 (r.m.s.d ¼ 0.7 A) ˚ and 367–373 (r.m.s.d ¼ 0.8 A) in an overall super˚ imposition (overall average r.m.s.d ¼ 0.3 A) In this respect the subunit pairs AC and BD have smaller r.m.s.d values between backbone atoms than other The overall structure of the H298E mutant is the same as that of the wild-type, but the active site substructure presents a few changes in amino acid side-chain orientations, as revealed by the superimposition of the two structures in Fig 3C As opposed to H298 (Fig 3A,B), E298 is involved in hydrogen bonds through both Oe atoms (Fig 3D,E) One side-chain oxygen is hydrogen ˚ bonded to F390 N (3.0 A), and the other to the Oc atom ˚ ) T300 is reoriented (Fig 3C,D,E) and of T300 (2.9 A cannot contribute to malonyl-ACP binding as proposed on the basis of the C163S structure [3] T302 does not change orientation (Fig 3D) The orientation of the conserved active site residues H333 and K328 are not affected by the H298E mutation (Fig 3C) H333 is hydrogen bonded to the backbone N of L335, making it a potential hydrogen bond donor to the active site, and probably lowers its pKa considerably K328 shares a bidentate hydrogen bond with E342 and is within hydrogen bond distance of the E298 backbone O (Fig 3D) The H298E–C12 structure (Fig 3E) is the same as that of H298E except that an extra water molecule appears well defined in the active site A water molecule in this position is also present in some of the subunits in the H298E structure, which is of considerably poorer quality (R ⁄ Rfree ¼ 21.7 ⁄ 27.2; Table [26]) The formation of the acyl–thioester bond in the H298E– C12 structure has no impact on the orientation of T300 (Fig 3D versus Fig 3E) Structures of KAS I H298Q and the H298Q–C12 complex The H298Q overall structure, including that of its active site, is similar to those of H298E and H298E–C12 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 697 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al Fig The active sites of the wild-type KAS I, its H298 mutants and their acyl complexes (A) Wild-type (B) WT–C8 (C) Superimposition of the wild-type (white, light colors) and H298E (orange, dark colors) (D) H298E (E) H298E–C12 (F) H298Q (G) H298Q–C12 (H) Superimposition of H298Q and H298Q–C12 In (A, B) and (D–G), water molecules (red spheres) within hydrogen bonding distance are indicated with dashed lines (H) Superimposition of H298Q (orange, dark colors) and H298Q–C12 (white, light colors) not including water molecules Figure prepared using PYMOL [42] The active site residue 298Q is involved in hydrogen bonds through both the Oe and the Ne atoms (Fig 3F) In this case the side-chain oxygen is hydro˚ gen bonded to F390 N (2.9 A), and the Ne to the Oc ˚ atom of T300 (3.0 A) H333 and K328 have insignificant variations in orientations, but the position of the 390–394 backbone is shifted The largest effect is seen 698 ˚ for residue F390, which is shifted by  0.9 A (Fig 3H) The formation of the H298Q–C12 complex (Fig 3G) induces side-chain reorientation of residue 298Q (Fig 3H), a shift in the position of the 390–394 backbone (Fig 3H) to that found in the H298E ⁄ H298E–C12 structures, and a side-chain reorientation FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis 12804 19.6 0.3 0.015 1.7 13071 17.2 0.2 0.005 1.2 d Rmerge ¼ S|I – < I > | ⁄ SI, with I being the intensity of the measured reflection and < I > the mean intensity of that reflection b Outer resolution shell c Rfactor ¼ S(|Fo| – |Fc|) ⁄ S|Fo| is the same as Rfactor, but calculated with the 5% of the total number of observations not used in the refinement e As determined from a Luzzati plot [26] WT, wild-type a 0.005 1.2 0.005 1.2 0.012 1.5 0.006 1.2 0.006 1.2 0.006 1.2 0.005 1.1 12825 25.7 0.3 12722 18.6 0.3 13012 20.3 0.2 12941 17.3 0.2 9492 18.0 0.3 12929 17.7 0.2 13003 17.5 0.2 Rfree 29.9–2.00 6.1 (14.3)b 11.2 3.5 90.8 (90.1)b 17.8 ⁄ 22.7 106579 37.9–2.00 9.2 (19.3)b 6.1 4.3 98.1 (92.8)b 17.1 ⁄ 20.6 216172 29.8–1.70 6.5 (19.8)b 10.3 2.7 96.8 (86.8)b 18.1 ⁄ 20.8 180614 31.6–2.00 8.6 (25.0)b 6.6 5.8 98.1 (96.9)b 19.6 ⁄ 22.9 117097 32.5–2.20 10.7 (15.5)b 5.0 2.9 88.2 (72.7)b 21.7 ⁄ 27.2 79506 116.4–1.95 8.6 (25.2)b 6.8 4.5 94.8 (80.7)b 18.9 ⁄ 21.8 121622 26.1–1.86 6.2 (23.0)b 9.5 4.3 96.1 (75.2)b 20.4 ⁄ 23.4 144860 29.7–1.9 12.4 (53.4)b 4.4 2.2 89.9 (60.8)b 21.7 ⁄ 25.6 124549 15.0–2.40 7.6 (17.9)b 8.4 6.6 91.2 (80.3)b 19.3 ⁄ 23.1 62307 ˚ Resolution (A) Rmergea (%) Average I ⁄ rI Average redundancy Completeness Rfactorc ⁄ Rfreed (%) Number of reflections used in the refinement Number of nonhydrogen atoms ˚ Mean B-factor (A2) Cross validated estimated maximum ˚ coordinate error (A)e ˚ R.m.s.d bond lengths (A) R.m.s.d bond angles (°) WT Table Data collection and refinement statistics WT–C8 H298Q H298Q–C12 H298E H298E–C12 K328R K328A–C12 K328A P von Wettstein-Knowles et al of T300 to that resembling the orientation found in the structure of the native enzyme and the WT–C8 complex (Fig 3A,B,G) A water molecule is found between H333 Ne and F390 N in three of the four subunits of H298Q–C12 (Fig 3G) It is not possible to unambiguously determine the hydrogen bonding pattern in the active site of the H298Q complex, but dotted lines have been included to atoms within hydrogen bonding distance in Fig 3G Structure of KAS I K328A The overall structure of the K328A mutant is the same as that of the wild-type (Fig 3A), but the active site substructure has changed (a) In the absence of the K328 side chain, a solvent molecule occupies the position of the K328 Nf atom (Fig 4A) The hydrogen bonds and distances imply that the properties of the solvent molecule are similar to the properties of the Nf atom (compare Fig 3A and Fig 4A) (b) Relief of the steric constraints normally imposed on H333 by the side chain of K328 results in an altered rotamer conformation in the mutant (Fig 4A) The changed H333 ˚ position facilitates formation of a 3.1 A hydrogen bond to the solvent molecule, and contrary to the situation in the wild-type, H333 Nd does not accept a hydrogen bond from the L335 backbone nitrogen (Fig 4A) Unambiguous determination of which H333 N will carry the proton is therefore not possible unless the solvent molecule hydrogen bonded to H333 Nd is an ammonium ion Moreover, the hydrogen bond dis˚ tance between H333 Ne and C163 Sc (3.2 A) in the ˚ found in the wildmutant is very similar to the 3.3 A type and infers that H333 Ne donates a hydrogen bond to the nucleophile, although the Cys163 Cb–Cys163 Sc–His333 Ne angle (79°) is less favorable than in the wild-type (87°) [25] Thus, we have introduced an ammonium ion at this solvent site in our model, an assignment that is further justified by the fact that the crystals were obtained in the presence of 1.9 m (NH4)2SO4 Structure of the KAS I K328A–C12 complex Electron density calculated using phases derived from the K328A polypeptide structure revealed electron density corresponding to a fatty acid bound to all four C163 residues in the asymmetric unit The fatty acid residues were included in the model and refined The structure is similar to the WT–C8 complex structure, but with the removal of the lysine side chain, H333 relaxes to a new rotamer conformation (Fig 4B) and interacts via Nd with a solvent mole- FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 699 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al A B Fig Hydrogen bonding patterns in the active sites of KAS I K328A (A) The hydrogen bonding pattern in K328A resembles the pattern observed in the wild-type, except for rotation of the H333 side chain A solvent molecule is located at a position corresponding to the wild-type K328 Nf position The solvent molecule is proposed to be a NH4+ ion and is represented by a blue sphere (B) In the K328A–C12 complex, the hydrogen bond pattern changes, and the solvent molecule found hydrogen bonded to H333 Nd has been modeled as a water molecule Water molecules are represented by red spheres cule as in the unbound K328A structure Interestingly, the water ⁄ ion structure around H298 changes when the fatty acid is bound to K328A (Fig 4B), in contrast with the wild-type case (Fig 3B) Contrary to the situation in K328A (Fig 4A), any suggestions as to the nature of the solvent molecule found between E342 and H333 cannot be justified, because position and potential hydrogen bonds are shifted (Fig 4B) A water molecule has been included in the model at this position Structure of KAS I K328R Four subunits arranged in two dimers, AB and CD, form the KAS I asymmetric unit in the P212121 space group obtained in all KAS I crystallization experiments so far [3,11] The relatively good quality of the K328R diffraction data makes it possible to determine the structure of each K328R subunit independently In K328R, subunits A and C have identical orientation of active site residues with a rotated H333 (Fig 5A), corresponding to the situation in K328A (Fig 4A) Ng1 and Ng2 of R328 interact with E342 by forming a salt bridge K328 makes a 700 similar interaction with E342 in the wild-type enzyme (Fig 3A) R328 also interacts with H333 by donating a hydrogen bond from Ne to H333 Nd (2.7– ˚ 2.9 A) (Fig 5A) The situation is a bit different for subunits B and D This pair of subunits also shares orientation of active site residues although with a higher positional r.m.s.d than found between subunits A and C Surprisingly, R328 interacts with H333 via Ng1 rather than via Ne (Fig 5B) The H333 rotamer falls between the wild-type orientation and the orientation observed in K328A, with Nd being oriented more towards the backbone N of residue 335 (on average the H333 Nd–L335 N distance ˚ ˚ is 3.9 A in subunit A and C versus 3.5 A in subunit B and D) Nevertheless, the shortest interatomic distance from H333 Nd to R328 Ng1 is on average ˚ 2.9 A with the average H333 Ne–C163 Sc distance ˚ being 3.2 A As only the K328R mutant shows variation in the orientation of residue 328, whereas all structures have variations in the 318–323 and 367–373 fragments, this difference in residue 328 orientation is significant and cannot be ascribed to propagation of the crystal-packing effects observed in fragments 318–323 and 367–373 FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al A B Fig The active sites of the K328R mutant protein (A) Active site of the C monomer; (B) active site of the D monomer Dotted lines represent possible hydrogen bonds or salt bridges A W indicates the water molecule found to interact with R328 Ng in the C and D monomer Decarboxylation of malonyl-ACP by wild-type and mutant KAS I proteins The ability of the wild-type and mutant KAS I proteins to form acetyl-ACP from malonyl-ACP (Scheme 1) was measured by visualizing the decarboxylation of [2-14C]malonyl-ACP to [2-14C]acetyl-ACP In the assay, the substrate is synthesized from radiolabeled malonylCoA and ACP by malonyl-CoA–ACP transacylase before the addition of the KAS protein to be tested The amount of labeled substrate generated was independent of pH over the tested range (3–8), generating adequate substrate for the decarboxylation reaction, as illustrated in Fig 6A for pH 6.8 and 4, lanes and 10, respectively Figure 6A (lanes 2–5) illustrates for the wild-type enzyme the rapid decrease in the malonylACP substrate and the much slower appearance of the product acetyl-ACP at pH 6.8 in assays from to 30 in length Analogous results were obtained at pH and Reducing the pH to results in slower loss of the malonyl-ACP substrate (compare Fig 6A, lanes and 6), and only at 30 can the acetyl-ACP product be detected (Fig 6A, lanes 6–9) At pH loss of the malonyl-ACP substrate was first visible in the 30 assay (lane 14) A previous study comparing decarboxylation activities of the E coli enzymes revealed that, in contrast with KAS I, no acetyl-ACP was recovered in KAS II assays even after 30 at pH 6.8 [9,27] That the KAS II enzyme was active in decarboxylation was confirmed in elongation assays that resulted in the synthesis of long-chain acyl-ACPs We suggested [9] that perhaps the acetyl carbanion resulting from this decarboxylation was transferred directly to the activesite cysteine, as happens in the synthesis of triacetic acid lactone, which is a derailment product in E coli [28] and humans [10], but the natural product of the chalcone synthase related enzyme in Gerbera hybridia [29] Triacetic acid lactone would not be precipitated in our assay designed to visualize acyl-ACPs The lag FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 701 Histidines and lysine in KAS I ⁄ KAS II catalysis A P von Wettstein-Knowles et al pH 6.8 pH pH 5 10 30 10 30 10 30 10 11 12 13 14 Mal-ACP Ac-ACP B WT H298E 5.0 2.5 7.2 3.6 7.2 3.6 µM C H298Q Mal-ACP Ac-ACP Fig Decarboxylation activities of the wild-type KAS I and H298 mutants Reactions were carried out as detailed in Experimental procedures (A) Time courses (0–30 min) of [2-14C]malonyl-ACP (Mal-ACP) decarboxylation to acetyl-ACP (Ac-ACP) by lM wild-type at pH 6.8, and The amount of labeled malonyl substrate generated at pH 6.8 and and present at the start of the reactions are shown at time in lanes and 10, respectively (B) Decarboxylation at pH 6.8 by two different amounts of wild-type, H298E and H298Q proteins in 30 assays The amount of labeled substrate present at the start of the reactions is shown in the first lane C is a standard consisting of malonyl-ACP and acetyl-ACP (lane 8) WT, wild-type periods observed between malonyl-ACP disappearance and acetyl-ACP appearance in the present experiments rule out the triacetic acid lactone hypothesis, as triacetic acid lactone cannot breakdown to give acetyl-ACP Either the acetyl carbanion has a significant lifetime in the absence of an acyl acceptor or it is transferred to an unknown, nonprecipitable intermediate before formation of acetyl-ACP Additional studies will be required to unravel this unexpected phenomenon In the present experiments, loss of substrate gives an unambiguous picture of the enzyme’s ability to decarboxylate the extender substrate At pH 6.8 in 30 assays, the H298E mutant evinced only a slight decrease in the malonyl-ACP substrate unaccompanied by formation of acetyl-ACP (Fig 6B, lanes and 5), which can be compared with the wild-type activity (lanes and 3) The H298E activity is about the same as that exhibited by the wild-type enzyme at pH in assays approaching 30 in length (Fig 6A, lanes and 9), or better than the wild-type activity at pH in 30 assays (Fig 6A, lane 14) At and below pH 5, H298E was inactive even in 60 assays, as was H298Q in the pH range tested (pH 6–8; Fig 6B, lanes and 7) Thus, H298E is able to decarboxylate at pH 6.8, albeit with a much reduced efficiency compared with the wild-type, whereas H298Q appears to be totally inhibited The decarboxylase assays with the K328 mutants were carried out at pH 6.8 The amount of labeled substrate at the start of the 10 or 30 reaction is shown in Fig 7A, lane 3, and Fig 7B, lane 1, 702 A C163A 10 10 µM 0.8 0.1 8.6 4.3 2.2 9.7 4.9 WT 30 K328H 30 K328R 30 2.2 8.7 4.3 2.2 10 11 12 Mal-ACP Ac-ACP 8.7 4.3 2.2 7.1 3.6 1.8 8.7 4.3 2.2 8.7 4.3 2.2 10 11 12 13 B K328I K328F µM K328E K328A Mal-ACP Ac-ACP Fig Decarboxylation activity of mutant K328 KAS I proteins The concentration (lM) of KAS added per 100 lL assay is shown as well as the assay time (min) The reaction was carried out as detailed in Experimental procedures After resolution of the ACP species by electrophoresis on conformationally sensitive 13.3% polyacrylamide ⁄ M urea gels, the proteins were blotted to a poly(vinylidene difluoride) membrane followed by autoradiography (A) Wild-type and basic mutant KAS I proteins compared with the very active C163A mutant protein Lane represents the amount of labeled substrate at the start of the 10 reaction (B) The bulky and acidic mutant proteins compared with the inactive K328A protein Lane represents the amount of labeled substrate at the start of the 30 reaction WT, wild-type respectively The wild-type protein accomplished essentially 100% formation of acetyl-ACP in 30 assays even at the lowest protein concentration of 2.2 lm (Fig 7A lanes 4–6) [9], although no conversion could be detected in 10 assays using 0.3 lm wild-type protein In analogous assays with the C163A mutant, by comparison, acetyl-ACP was readily formed FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al (Fig 7A, lanes and 2), whereas hardly any activity could be detected, either as loss of the malonyl substrate or accumulation of the acetyl product, for the six lysine mutants (data not shown) In the 30 assays, however, the two basic mutants, K328H and K328R, and the bulky mutant, K328F, evinced some activity (Fig 7A, lanes 7–12, and Fig 7B, lanes 2–4) By comparison, the acidic mutant K328E and to a lesser extent the bulky mutant K328I appear totally decarboxylation deficient (Fig 7B, lanes 5–10), which is characteristic for K328A (lanes 11–13) as shown previously in 10 assays [9] Only trace amounts of label are seen in the position characteristic of acetylACP in the K328I and K328E lanes That more substrate appeared to be present in some of the assay lanes than at the start of the assay (Fig 7B, lane 1) results from the continued activity of the malonylCoA–ACP transacylase To summarize, the K328 isoleucine, glutamic acid and alanine mutants appear to totally lack decarboxylation activity, whereas the histidine, arginine and phenylalanine mutants are active, although less efficient than the wild-type Transfer of fatty acid from ACP to the wild-type and K328 mutant KAS I protein The initial step in the Claisen condensation carried out by a CHH group enzyme is transfer of the acyl substrate from the phosphopantetheine arm of ACP to its active site cysteine (Scheme 1) With the use of ACP carrying 3H-labeled myristate (C14 fatty acid), this transfer can be readily monitored with the aid of a size-exclusion column and scintillation counting of the fractions We have previously shown [9] that, under saturation conditions, wild-type KAS I transfers 42% of the labeled myristate, whereas 100% transfer is accomplished by KAS II under the same conditions [9] That additional transfer to wild-type KAS I does not occur has been attributed to inhibition by free ACP released during the reaction [9] The K328A mutant, in comparison with the wild-type, exhibits very unusual, apparent sigmoidal kinetics for the transfer reaction [9] Thus, although in 10 assays the transfer efficiency is only 68% of that characterizing the wild-type, transfer continues until all the myristate is bound to K328A, revealing that, in this mutant, ACP does not inhibit transfer To probe the basis for the noted difference in transacylation between the wild-type and K328A [9], transfer to five additional K328 mutants was investigated The results presented in Table were obtained using about the same amount of protein per assay that Table Transfer of [3H]myristate from ACP to wild-type and Lys328 mutant KAS I proteins The percentage myristic acid (C14) transferred from C14–ACP to the specified KAS proteins was determined at 10, 60 and ⁄ or 120 at 22 °C and ⁄ or °C, using  lg protein, at which concentration maximum transfer to wildtype occurs WT, Wild-type; –, not measured; tr, < 0.1% of wildtype activity % transfer per lg KAS protein 22 °C KAS I WT K328A K328H K328R K328E K328F K328I a % transfer 22 °C, 10 42.5 30.1b 94.7b 86.9b 12.1b 34.9c 45.1c b 10 60 120 10 6.4 4.1 15.8 14.5 2.0 5.8 7.5 a Sensitive to ACP; determined °C 6.3 13.4 16.0 14.7 4.2 7.5 8.5 – – – – 8.5 8.3 9.3 6.2 tr 8.8 5.1 tr tr tr not sensitive to ACP; c sensitivity to ACP not resulted in maximum transfer by the wild-type The transfer efficiencies of the mutant proteins relative to that of the wild-type can be deduced by dividing the percentage transfer per lg KAS protein found for the mutants by that characterizing the wild-type On this basis the mutants exhibit marked differences from the wild-type in transfer efficiency in the 10 assays The basic mutants K328H and K328R are more efficient (247% and 227%), the acidic mutant K328E is less efficient (31%), and the bulky mutants K328F and K328I are similar to the wild-type (91% and 117%) Increasing the assay time resulted in an increase in transfer to the acidic and bulky mutants, so that by 120 all three were somewhat more efficient than the wild-type (130–145%) That the acidic and basic mutant enzymes accept myristate more readily than the wild-type is in accord with the observation that they, like K328A, are insensitive to ACP inhibition This infers that the bulky mutants are unlikely to be inhibited by ACP as they also accept more myristate than the wild-type Detailed analyses of the bulky mutants revealed apparent sigmoidal kinetics for transfer (data not shown), but with much lower slopes than that characterizing the K328A mutant [9] In these assays, when maximum transfer was reached, the transfer efficiencies were similar to that of the wildtype (99% and 118%) Whereas carrying out the assays on ice had no effect on the wild-type, the transfer efficiencies of the mutant proteins were impeded at the lower temperature (Table 2) Although the K328H and K328R mutants had considerable activity at °C (142% and 82% of FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 703 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al that of the wild-type), this was only 58% and 35% of their activity at 22 °C At best, a trace of activity (< 0.1% of that of the wild-type) was detected for the other four mutants For all six mutants, adding of additional KAS protein to the assay resulted in increased transfer, albeit with lower efficiencies For example, 12 lg K328F and K328I gave 7.3% and 17.9% transfer, respectively The K328A mutant exhibited only 4% transfer with 15.7 lg protein in a 30 assay, and K328E 10% with 68 lg in a h assay Combined, these results indicate that a positively charged residue at position 328 is an important factor for efficient transacylation activity, especially at °C Elongation activity of the wild-type and K328 mutant KAS I proteins The transfer and decarboxylation partial reactions characterizing the six K328 mutants, as described above, differ from their respective wild-type partial reactions To determine if the mutants were nevertheless able to carry out the Claisen condensation (Scheme 1), their ability to restore activity to elongation defective protein extracts of the CY244 KAS I ⁄ KAS II double mutant E coli strain was determined As shown in Fig 8, extracts of this strain are unable to extend radiolabeled acetate (lane 5) in 30 assays at 42 °C Addition of wild-type KAS I resulted in synthesis of long-chain saturated and unsaturated fatty acyl-ACPs in a protein concentration-dependent manner (lanes 2–4) Although the basic mutant proteins WT M 0.55 0.14 µg KAS K328R K328H 0.015 1.11 0.55 0.14 1.11 0.55 0.14 10 11 C# 12 18:1 14 16 18 Fig Ability of the wild-type and mutant K328 KAS I proteins to enable synthesis of fatty acyl-ACPs by soluble protein extracts of the E coli mutant strain CY244 under restrictive conditions The reaction was carried out as described in Experimental procedures for 30 at 42 °C with 0.015–1.11 lg KAS protein per assay After resolution of the ACP species by electrophoresis on conformationally sensitive 13.3% polyacrylamide ⁄ M urea gels, the proteins were blotted to a poly(vinylidene difluoride) membrane followed by autoradiography Addition of up to 1.11 lg K328F, K328I, K328E and K328A mutant proteins gave the same result as when no KAS protein (O) was added M ¼ marker, 14C16-ACP WT, wild-type 704 K328H and K328R were able to form saturated acylACPs, more than 70 times as much protein was required (lanes 6–11) These results demonstrate that, despite the failure to recover the acetyl-ACP extender unit in the decarboxylase assays, this substrate is successfully formed and available for the condensation step By comparison, none of the other four mutants were capable of elongating the acetyl-CoA primer substrate, i.e the same picture was obtained in gels as shown for the CY244 extract in the absence of functional KAS I protein (lane 5) even when 1.11 lg mutant protein was used This implies that, although K328F decarboxylation activity was equivalent to that characterizing K328H and K328R, its modified transfer activity prohibited condensation at a level that could be detected in our assay Discussion The conserved cation-binding site A possible cation site was discovered close to the active site This binding site is unaffected by the H298 mutations and is conserved in all published KAS I and KAS II sequences The nature of the bound cation has been determined based on the refined B-factors, the electron density level, and the hydrogen bond distances Models of NH4+, Na+ and K+ were constructed, and the NH4+ model best fitted the observed electron density The cation site can be detected in all published CHH class structures [2,3], but has only been described as a cation site in the crystal structure of Streptococcus pneumoniae KAS II [30] and in the structure of mitochondrial KAS from Arabidopsis thaliana [31] The crystals of S pneumoniae KAS II were grown in the presence of 250 mm magnesium acetate and revealed a magnesium ion in this site, whereas the cation in the mitochondrial KAS structure grown in 1.6 m (NH4)2SO4 was interpreted as potassium Our crystallization conditions included an ammonium ion concentration of 1.9 m, which probably influences the nature of the cation under crystallization conditions The function of the ion is presumably to fix E342 in the optimal position and induce the correct pKa of this residue Altered transfer kinetics At least four factors play a role in transfer kinetics under the assay conditions tested: firstly, the ability of the enzyme to attract acyl-ACP, secondly the nucleophilicity of C163, thirdly the degree to which the enzyme stabilizes the acyl–enzyme complex, and finally the FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al sensitivity of KAS I to ACP Thus far, the last of these is the only factor identified that can explain why not all of the wild-type enzyme in an assay actually reacts with acyl-ACP to form the fatty acid–enzyme complex [9] The reaction is irreversible under the present conditions [9] Interestingly, all the K328 mutants exhibited a higher efficiency of transfer than the wild-type The significance of this observation is not immediately apparent, as transfer by the four tested lysine mutants (Ala, His, Arg, Glu) is not influenced by free ACP whereas transfer by the wild-type is A future introduction of analogous mutants in KAS II, a CHH group enzyme not inhibited by ACP [9], would not only make it possible to distinguish between reaction rate and ACP inhibition effects, but conceivably also correlate ACP inhibition with structural properties The observed consistent substructural differences between subunits within the asymmetric unit of the crystals studied may imply the presence of co-operativity between active sites [3] The possibility that the K328 mutants have altered co-operativity cannot be excluded If true, the resulting effect may be reflected in the acyl-transfer kinetics of the various mutants The proposed model for transfer of the acyl chain from ACP to KAS III, a CHN group enzyme, consists of two steps: specific, albeit weak, binding of ACP to the docking site followed by a conformational change in ACP proposed to inject the acyl chain into the substrate-binding pocket [32] If a similar mechanism is involved in the KAS I reaction then an intermediate ACP-acyl–KAS I crystal complex remains to be defined Such intermediate structures should assist in interpreting the sigmoidal kinetics of the transfer characterizing the K328A, K328I and K328F mutants as well as the observed transfer efficiencies Decarboxylation Several theories have been proposed for the decarboxylation mechanism of the CHH family of condensing enzymes Huang et al [1] initially inferred that the E coli KAS II residue equivalent of KAS I His298 was positively charged, the charge guiding the localization of malonyl-ACP and stabilizing the formation of the carbanion intermediate The conserved K328 was thought to play a structural rather than functional role Moche and coworkers [2] later found that the proximity between the conserved lysine and the H298 ˚ equivalent in the 1.5 A resolution structure of KAS II from Synechocystis sp., in which no water molecule is found between H298 and K328, indicated that H298 was unsuitable as proton acceptor Olsen et al [3] suggested that K328 was functional in catalysis through its interaction with H298 This model hypothesized that hydroxide ion like properties of the solvent molecule, found between K328 and H298 Nd in KAS I and most KAS II structures, enabled His298 to function as a general base in decarboxylation Price et al [12] proposed that decarboxylation followed similar mechanisms in CHH and CHN enzymes, and that both active site histidines donated a hydrogen bond to the malonyl-ACP thioester oxo group, hence no acid-base catalysis Subsequently, Witkowski and coworkers [8] proposed a decarboxylation mechanism whereby the rat fatty acid synthase equivalent of KAS I H333 is protonated and acts as a catalytic acid in decarboxylation, whereas the KAS I H298 equivalent donates a hydrogen bond to the malonate carboxylate group in the same process This mechanism includes a nucleophilic attack by a water molecule on C3 of the malonyl residue and the formation of bicarbonate as a reaction product While this manuscript was in preparation, White et al [33], in a review covering type II fatty acid synthesis, postulated that His298 is a general base activating a water molecule for nucleophilic attack on the carboxylate group of malonyl-ACP, and H333 stabilizes charge relocalization by hydrogen bond donation As is most obvious from the present structural studies, the role of H333 changes from a dual one in native enzymes, namely, stabilizing the negative charge of C163 and donating a hydrogen bond to an active site water molecule, to only the latter in acyl–KAS complexes This is revealed by the better defined active site water molecule in the structures of fatty acyl complexes than in the native structures The stereochemical effect of K328 on His333 is critical This functionality of K328 derives from its aliphatic side chain imposing steric constraints on H333 so that it is an obligate proton donor at Ne The crystal structures of K328 ⁄ K328A–C12 and K328R and the results of the decarboxylation assays of the ‘bulky’ mutants all point to the orientation of H333 and its hydrogen bond donor properties as being the cornerstone of obtaining and ⁄ or retaining residual decarboxylase activity The emerging picture of well-defined water molecules hydrogen bonded to H333 Ne in the fatty acid complexes and the critical influence that the orientation of H333 has on decarboxylation shows that H333 is an obligate hydrogen bond donor at Ne, directed only towards the active site and malonyl-ACP binding area in the fatty acid complex The hydrogen bond between the L335 backbone nitrogen and H333 Nd makes it unlikely that H333 participates in catalysis as an acid or base Compared with the role of H333, that of H298 has been an enigma, especially in decarboxylation FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 705 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al Recently, bioinformatics and biochemical studies have substantiated the notion that the two active site histidines in CHH condensing enzymes have chemically different roles in catalysis [8,34] H298Q mimics the nonprotonated state of H298 by having the ability to both donate and accept a hydrogen bond, but does not mimic its ability to act as a Brønsted base at physiological pH values H298E mimics the nonprotonated state of H298 by having the ability to act as a base That H298E appears to be totally lacking in decarboxylase activity below pH as does the H298Q enzyme at all investigated pHs, whereas the wild-type enzyme retains a vestige of activity at pH demonstrates that decarboxylase activity depends on the presence of a base at position 298 This observation conflicts with the reaction mechanism proposed by Davies et al [5] based on the structure of the CHN enzyme E coli KAS III and the interpretation of the structure of the E coli KAS I– ˚ thiolactomycin complex [12], assuming a A movement of H298 on malonyl-ACP binding The structures of H298 mutants suggest that the structural changes adopted on acyl transfer, permitting proper binding of malonyl-ACP and decarboxylation, are restricted to blockage of the C163 ⁄ F392 oxyanion hole by the thioester [10] and a change in the hydrogen bond potential of H333 We have previously hypothesized that K328 is essential for the catalytic properties of H298 [3] That the K328A mutant appeared unable to decarboxylate [9] supports this hypothesis, but the present observations that K328E and K328I are similarly deficient whereas the two basic mutants, K328H and K328R, and the bulky mutant, K328F, showed some activity reveals that the positive charge of the lysine is not absolutely required for decarboxylation That the orientation of the conserved K328 is completely unaffected by the H298 mutations and the binding of acyl thioesters implies that the mutual interaction between H298 and K328 is not of structural character Residues corresponding to K328 are absent from the CHN group of enzymes, but in CHH enzymes K328 is conserved, as are the cation site and E342, which are linked to H298 Possibly the positive charge of K328 is of significance for optimal decarboxylation efficiency through the interactions with conserved E342 and the cation site, but the present combined structural and kinetic study only identifies an effect of a positive charge at the K328 position on the transfer reaction An interesting aspect of the H298E mutation is the orientation of the T300 ⁄ T302 side chains Both have been implicated in the binding of ACP [2], probably by donating hydrogen bonds to one of the carbonyl oxygens in malonyl-ACP, thereby stabilizing charge 706 relocalization during catalysis [3] One reason for the low decarboxylation activity of H298E could well be the reorientation of T300 in both the native and the acyl-bound enzyme, resulting in a lower affinity for the substrate and inadequate stabilization of charge relocalization for decarboxylation Experimental procedures Cloning The pQE30-fabB plasmid used for mutagenesis and expression of E coli KAS I has been described The mutagenesis procedure for making the K328 mutant detailed previously [9] was used to construct seven additional mutants using the following primers plus their complements: H298E, CGATTACCTGAACTCCGAGGGTACTTCGA CTCCG H298Q, CGATTACCTGAACTCCCAGGGTACTTCGAG TCCG K328H, (5¢-GGCGATTTCTGCAACCCACGCCATGAC CGGTCAC-3¢) K328R, (5¢-GGCGATTTCTGCAACCCGTGCCATGAC CGGTCAC-3¢) K328E, (5¢-GGCGATTTCTGCAACCGAAGCCATGA CCGGTCAC-3¢) K328I, (5¢-GGCGATTTCTGCAACCATTGCCATGAC CGGTCAC-3¢) K328F, (5¢-GGCGATTTCTGCAACCTTCGCCATGAC CGGTCAC-3¢) Confirmation that the desired mutants had been obtained was achieved by complete sequencing of the initial transformants in XL1-Blue cells Expression, purification and activity assay Wild-type and mutant His-tagged KAS I proteins were purified as detailed previously [9] except that only the lysozyme and sonication step was used to open the cells The resulting protein had an added N-terminal sequence consisting of M-R-G-S, a His tag of six residues followed by G-S Three assays were carried out on the purified enzymes (a) The acyl transferase assay measures the ability of a KAS protein to accept a fatty acid substrate from the ACP To 48 lL containing 50 mm potassium phosphate buffer (pH 6.8), 0.5 mgỈmL)1 thyroglobulin and 0.2 lm [3H]myristoyl-ACP (6000 cpm) is added 12 lL KAS protein (0.3–24 lg) in storage buffer [9] Incubations last 10–120 at 20–22 °C Under these conditions, percentage transfer per is linear from to lg per assay The maximum percentage transfer is 42, and increasing the concentration beyond lg wild-type KAS I per assay does not increase the percentage transfer In the present experiments, a molecular ratio of 10 : KAS to acyl-ACP was used Previous work has shown that transfer is FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al not an equilibrium reaction, i.e the bound acyl chain is not released from the enzyme One of the factors contributing to this phenomenon is inhibition by the free ACP released [9] The reaction mixture was resolved into [3H]myristoyl-ACP and [3H]KAS by size-exclusion chromatography, and the fractions subjected to liquid scintillation using either a Beckman L#1701 or an LKB-Wallac 1219 Rackbeta instrument Sensitivity of the transfer reaction to ACP was tested by adding 0.17 lm (10 pmol per assay) ACP before addition of KAS as described previously [9] Assays were carried out in triplicate, and the mean values in the presence and absence of ACP compared (b) The decarboxylase assay measures the ability of KAS protein to decarboxylate the donor substrate malonyl-ACP, forming the acceptor primer acetyl-ACP [14C]Malonyl-ACP was generated from 12 lm ACP and 10.1 lm [14C]malonyl-CoA (10 000 dpmỈnmol)1) using malonyl-CoA–ACP transacylase [9] in 25 mm potassium phosphate buffer (pH 6, 6.8 or 8) or in 50 mm sodium citrate buffer (pH 3, or 5) To this reaction mixture was added 0.1–11 lm monomer of the wild-type or mutant protein in the buffer used to generate the malonyl-ACP substrate After 1–60 at 25 °C, the radiolabeled product and substrate were precipitated and resolved using m urea 13.3% polyacrylamide before electroblotting to poly(vinylidene difluoride) membrane and autoradiography Additional details are given in [9] (c) The elongation assay measures the ability of a purified KAS I protein preparation to restore elongation activity to a crude protein extract from the E coli CY244 strain that is defective in both the fabB and fabF genes [35] The temperature sensitive fabB15 allele determines an A329V mutation in KAS I (GenBank AJ012163), and the fabF1 allele encodes two mutations, S220N and G262M, that inactivate KAS II [21] Soluble protein extracts of CY244 were prepared as described [36], and protein concentrations determined using the BCA reagent as recommended by Pierce The 100 lL reaction mixture prepared on ice contained 10 lm ACP, mm NADH, mm NADPH, 10 lm acetyl-CoA, 60.8 lm [2-14C]malonyl-CoA (1670 dpmỈnmol)1), 50 mm potassium phosphate (pH 6.8) buffer, 40 lg CY244 soluble protein and 0.015–1.11 lg purified KAS protein After 30 at 42 °C, the acyl-ACPs were precipitated and analyzed as described above except that m urea ⁄ polyacrylamide gels were used [1-14C]Palmitoyl-ACP (1250 cpm) was included on the gels as standard Expression, purification and crystallization After induction the cells were opened by five freeze ⁄ thaw cycles The insoluble fraction was sedimented by centrifugation at 4000 g for 90 min, and the supernatant loaded on to a 1-mL HiTrap chelating column (Amersham-Pharmacia) in buffer A containing 30 mm sodium phosphate, 500 mm NaCl, and 50 mm imidazole (pH 7.4) The protein was eluted in a linear gradient of 0–100% buffer B (as buffer A plus 500 mm imidazole) in 10 column volumes The protein was eluted as a single peak at 25–30% buffer B The peak fraction was desalted into buffer C containing 25 mm Trizma, mm EDTA and mm dithiothreitol, pH 8.0, using a HiPrep 26 ⁄ 10 Sephadex G-25 column After this, the protein was loaded on to an anion-exchange column, Mono Q 10 ⁄ 10, in buffer C and eluted in a linear gradient of 0–100% buffer D (as buffer C with m NaCl) The protein was eluted as two peaks at 12% and 16% buffer D, of which the earliest (low salt) peak was two to three times as large as the other The low salt peak was desalted into buffer C and concentrated to  14.0 mg proteinỈmL)1, as calculated from the theoretical extinction coefcient (e280 ẳ 24180 m)1ặcm)1 and a molecular mass of 44 011.8 Da Although the extinction coefficient and molecular mass refer to the His-tagged KAS I construct, the same values have been applied to all samples An Amicon Centriprep YM-3 device was used to concentrate the solution The protein was crystallized in hanging drop experiments at 294 K with reservoirs containing 2% (w ⁄ v) poly(ethylene glycol) 400, 100 mm bis-Tris propane (pH 6.5) and 1.9 m (NH4)2SO4 (resulting pH 7.4) Crystals of the H298E, H298Q and K328A dodecanoyl complexes were formed by adding lL 65.8 mm dodecanoylCoA (Sigma) to crystals in the mother liquor, and incubating for 24 h The WT–C8 complex was formed by the same procedure using 100 mm octanoyl-CoA (Sigma) The mutants and their fatty acid complexes crystallized in the same space group and with similar cell dimensions as the wild-type at cryo-temperatures In contrast with the other enzymes, K328A is unstable and starts precipitating in an amorphous form after three to four days at 277 K Data collection Diffraction data from the H298E, H298Q and K328R mutants was collected at the MAXLAB, Lund, Sweden at beam line I711 A D/ ¼ 0.2 ° was used The data collection strategy option in Mosflm [37] was used to determine the optimal / angle span K328A crystal diffraction data were collected at the ESRF in Grenoble, France at the ID14.4 ˚ beam line (k ¼ 0.97 A) on a single crystal The crystal to detector distance was 150 mm (D/ ¼ 0.25 °) With these settings spot overlap was not a problem The K328A–C12 complex data were recorded from a single crystal at the ˚ ESRF ID29 beam line (k ¼ 0.91 A) The crystal was translated vertically three times during data collection to avoid the radiation damage that was readily observable in the diffraction pattern The data were collected using D/ ¼ 0.50 ° for the first and last run and 0.3 ° for the second run Wild-type and WT–C8 complex data were collected on single crystals on an in-house Rigaku RU300 generator with rotating Cobber anode, osmic mirrors, and an R-AXIS IV++ image plate system These data were collected with a crystal to detector distance of 150 mm and a D/ ¼ 0.2 ° Before data collection, the crystals were cooled to 100 K in a stream of gaseous N2 after a incubation in a FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 707 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al cryo-protectant containing 28% (v ⁄ v) glycerol, 2% (w ⁄ v) poly(ethylene glycol) 400, 100 mm bis-Tris propane, pH 6.5, and 1.9 m (NH4)2SO4 All crystals were annealed, after which the mosaicity decreased from  0.8 ° to 0.2 ° The mosflm and scala programs [38] were used for data integration and scaling Statistics are provided in Table Structure solution The temperature of 100 K used for these data collections as opposed to room temperature as used for previous data collections (pdb accession number 1EK4) resulted in cell parameter changes for the a, b and c axes of 1.0, ˚ 4.3, and 3.3 A, respectively, for the wild-type structure It was not possible to obtain the correct molecular orientations directly by rigid body refinement A molecular replacement was carried out for the H298E and K328A mutant proteins with the program AMoRe [39] by using the KAS I C163S dimer as search model [11] Water molecules, ions and substrate were excluded from the search model Initial phases for electron-density calculations were derived from the C163S model, again excluding water and ions, except that phases for electron-density calculations for the K328A–C12 complex and the K328R mutant were derived from the KAS I K328A model, again excluding water molecules and ions Noncrystallographic symmetry matrices were determined after rigid body refinement in cns version 1.1 [26], and the relevant amino acid substitutions made according to the resulting 2|Fo| – |Fc| electron density Water molecules were added to the models using the automated procedure in cns The peak search was performed in a 2|Fo| – |Fc| map using a 1.2 r peak height cut-off and distance constraints based on hydrogen bonding distance potential Water molecules were then inspected individually by eye in the graphics program O [40] Additional refinement was performed in cns using maximum likelihood refinement on amplitudes with simulated annealing and restrained individual B factor refinement A noncrystallo˚ graphic symmetry restraint value of 50 kcalỈmol)1ỈA)2 gave the lowest value for Rfree for the initial refinements For all but the K328A structures, the noncrystallographic symmetry restraints were omitted in the last refinements because of a slight fall in Rfree by this procedure One ammonium ion and a dodecanoyl residue per subunit were added to the H298E–C12 and H298Q–C12 models In the wild-type and H298E and H298Q mutant protein structures, an ammonium ion was added to each of the four subunits One ammonium ion and an octanoyl residue were added to each subunit in the WT–C8 model Two ammonium ions per subunit were included in the K328A model and one ammonium ion and a dodecanoyl residue per subunit were added to the K328A–C12 model In the K328R mutant protein structure, an ammonium ion was added to each of the four subunits Corrections of the models by 708 visual inspection interspaced by additional rounds of refinement gave the statistics shown in Table Acknowledgements This work was supported by grants from the Novo Nordisk Foundation and the Danish Natural Science Research Council through DANSYNC and grant 21-01-0622 Dr Andy Thompson (ID29, ESRF), Dr Sean McSweeney (ID14.4 also ESRF) and Dr Yngve Cerenius (I711, MAXLAB) are acknowledged for their assistance with data collection We thank Annette Kure Andreassen, Marianne Mortensen and Augusta Palsdottir for outstanding technical assistance References Huang W, Jia J, Edwards P, Dehesh K, Schneider G & Lindqvist Y (1998) Crystal structure of b-ketoacyl-acyl carrier protein synthase II from E coli reveals the molecular architecture of condensing enzymes EMBO J 17, 1183–1191 Moche M, Dehesh K, Edwards P & Lindqvist Y (2001) The crystal structure of b-ketoacyl-acyl carrier protein ˚ synthase II from Synechocystis sp at 1.54 A resolution and its relationship to other condensing enzymes J Mol Biol 305, 491–503 Olsen JG, Kadziola A, von Wettstein-Knowles P, Siggaard-Andersen M & Larsen S (2001) Structures of b-ketoacyl-acyl carrier protein synthase I complexed with fatty acids elucidate its catalytic machinery Structure 9, 233–243 Qiu X, Janson CA, Konstantinidis AK, Nwagwu S, Silverman C, Smith WW, Khandekar S, Lonsdale J & Abdel-Meguid SS (1999) Crystal structure of b-ketoacyl-acyl carrier protein synthase III A key condensing enzyme in bacterial fatty acid biosynthesis J Biol Chem 274, 36465–36471 Davies C, Heath RJ, White SW & Rock CO (2000) The ˚ 1.8 A crystal structure and active site architecture of b-ketoacyl-acyl carrier protein synthase III (FabH) from Escherichia coli Structure 8, 185–195 Scarsdale JN, Kazanina G, He X, Reynolds KA & Wright HT (2001) Crystal structure of the Mycobacterium tuberculosis b-ketoacyl-acyl carrier protein synthase III J Biol Chem 276, 20516–20522 Siggaard-Andersen M, Bangera G, Olsen JG & von Wettstein-Knowles P (1998) Defining the functions of highly conserved residues in b-ketoacyl-ACP synthases ` ` In Advances in Plant Lipid Research (Sanchez, J, Cerda Olmedo, E & Martı` nez-Force, E, eds), pp 67–70 Universidad de Sevilla, Secretariado de Publicaciones, Sevilla Witkowski A, Joshi AK & Smith S (2002) Mechanism of the b-ketoacyl synthase reaction catalyzed by the FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al 10 11 12 13 14 15 16 17 18 19 20 21 22 animal fatty acid synthase Biochemistry 41, 10877– 10887 McGuire KA, Siggaard-Andersen M, Bangera MG, Olsen JG & von Wettstein-Knowles P (2001) b-Ketoacyl-[acyl carrier protein] synthase I of Escherichia coli: aspects of the condensation mechanism revealed by analyses of mutations in the active site pocket Biochemistry 40, 9836–9845 Witkowski A, Joshi AK, Lindqvist Y & Smith S (1999) Conversion of a b-ketoacyl synthase to a malonyl decarboxylase by replacement of the active-site cysteine with a glutamine Biochemistry 38, 11643–11650 Olsen JG, Kadziola A, von Wettstein-Knowles P, Siggaard-Andersen M, Lindquist Y & Larsen S (1999) The X-ray crystal structure of b-ketoacyl [acyl carrier protein] synthase I FEBS Lett 460, 46–52 Price AC, Choi K-H, Heath RJ, Li Z, White SW & Rock CO (2001) Inhibition of b-ketoacyl-acyl carrier protein synthases by thiolactomycin and cerulenin Structure and mechanism J Biol Chem 276, 6551–6559 Shen B (2003) Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms Curr Opin Chem Biol 7, 285–295 Kunst L & Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax Prog Lipid Res 42, 51–80 Mdluli K, Slayden RA, Zhu Y, Ramaswamy S, Pan X, Mead D, Crane DD, Musser JM & Barry CE III (1998) Inhibition of a Mycobacterium tuberculosis b-ketoacyl ACP synthase by isoniazid Science 280, 1607–1610 Heath RJ, White SW & Rock CO (2001) Lipid biosynthesis as a target for antibacterial agents Prog Lipid Res 40, 467–497 Jones AL, Herbert D, Rutter AJ, Dancer JE & Harwood JL (2000) Novel inhibitors of the condensing enzymes of the type II fatty acid synthase of pea (Pisum sativum) Biochem J 347, 205–209 Schaeffer ML, Agnihotri G, Volker C, Kallender H, Brennan PJ & Lonsdale JT (2001) Purification and biochemical characterization of the Mycobacterium tuberculosis b-ketoacyl-acyl carrier protein synthases KasA and KasB J Biol Chem 276, 47029–47037 Rendina AR & Cheng D (2005) Characterization of the inactivation of rat fatty acid synthase by C75: inhibition of partial reactions and protection by substrates Biochem J 388, 895–903 Alli PM, Pinn ML, Jaffee EM, McFadden JM & Kuhajda FP (2005) Fatty acid synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice Oncogene 24, 39–46 Magnuson K, Carey MR & Cronan JE Jr (1995) The putative FabJ gene of Escherichia coli fatty acid synthesis is the FabF gene J Bacteriol 177, 3593–3595 Siggaard-Andersen M, Wissenbach M, Chuck J-A, Svendsen I, Olsen JG & von Wettstein-Knowles P (1994) The fabJ-encoded b-ketoacyl-[acyl carrier 23 24 25 26 27 28 29 30 31 32 33 34 35 protein] synthase IV from Escherichia coli is sensitive to cerulenin and specific for short-chain substrates Proc Natl Acad Sci USA 91, 11027–11031 Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE III, et al (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence Nature 393, 537–544 Cole ST, Eiglmeier K, Parkhill J, James KD, Thomson ´ NR, Wheeler PR, Honore N, Garnier T, Churcher C, Harris D, et al (2001) Massive gene decay in the leprosy bacillus Nature 409, 1007–1011 McDonald IK & Thornton JM (1994) Satisfying hydrogen bonding potential in proteins J Mol Biol 238, 777–793 Brunger AT, Adams PD, Clore GM, DeLano WL, Gros ¨ P, Grosse-Kunstleve RW, Jiang J-S, Kuszewski J, Nilges M, Pannu NS, et al (1998) Crystallography & NMR system: a new software suite for macromolecular structure determination Acta Crystallogr D 54, 905–921 von Wettstein-Knowles P, Olsen JG, McGuire KA & Larsen S (2000) Molecular aspects of b-ketoacyl synthase (KAS) catalysis Biochem Soc Trans 28, 601–607 Yalpani M, Willecke K & Lynen F (1969) Triacetic acid lactone, a derailment product of fatty acid biosynthesis Eur J Biochem 8, 495–502 Eckermann S, Schroder G, Schmidt J, Strack D, Edrada ă RA, Helariutta Y, Elomaa P, Kotilainen M, Kilpelainen ă I, Proksch P, Teeri TH & Schroder J (1998) New pathă way to polyketides in plants Nature 396, 387–390 Price AC, Rock CO & White SW (2003) The 1.3-Angstrom-resolution crystal structure of b-ketoacyl-acyl carrier protein synthase II from Streptococcus pneumoniae J Bacteriol 185, 4136–4143 Olsen JG, Rasmussen AV, von Wettstein-Knowles P & Henriksen A (2004) Structure of the mitochondrial b-ketoacyl-[acyl carrier protein] synthase from Arabidopsis and its role in fatty acid synthesis FEBS Lett 577, 170–174 Zhang Y-M, Rao MS, Heath RJ, Price AC, Olson AJ, Rock CO & White SW (2001) Identification and analysis of the acyl carrier protein (ACP) docking site on b-ketoacyl-ACP synthase III J Biol Chem 276, 8231– 8238 White SW, Zheng J, Zhang Y-M & Rock CO (2005) The structural biology of type II fatty acid biosynthesis Annu Rev Biochem 74, 791–831 Dawe JH, Porter CT, Thornton JM & Tabor AB (2003) A template search reveals mechanistic similarities and differences in b-ketoacyl synthases (KAS) and related enzymes Proteins 52, 427–435 Ulrich AK, de Mendoza D, Garwin JL & Cronan JE Jr (1983) Genetic and biochemical analyses of Escherichia coli mutants altered in the temperature-dependent FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS 709 Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al regulation of membrane lipid composition J Bacteriol 154, 221–230 36 Yasuno R, von Wettstein-Knowles P & Wada H (2004) Identification and molecular characterization of the b-ketoacyl-[acyl carrier protein] synthase component of the Arabidopsis mitochondrial fatty acid synthase J Biol Chem 279, 8242–8251 37 Leslie A (1999) MOSFLM MRC Laboratory of Molecular Biology, Cambridge, UK 38 Collaborative Computing Project, number (1994) The CCP4 suite: programs for protein crystallography Acta Crystallogr D 50, 760–763 710 39 Navaza J (2001) Implementation of molecular replacement in AMoRe Acta Crystallogr D 57, 1367–1372 40 Jones A, Zou JY, Cowan SW & Kjeldgaard M (1991) Improved methods for building protein models in electron density maps and the location of errors in these maps Acta Crystallogr A 47, 110–119 41 Kraulis PJ (1991) MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures J Appl Crystallogr 24, 946–950 42 DeLano WL (2002) The PyMOL molecular graphics system http://www.pymol.org FEBS Journal 273 (2006) 695–710 ª 2006 The Authors Journal compilation ª 2006 FEBS ... model of the ligand-binding potential of the active site, enabling differentiation between the active site properties of target enzymes to be made This study probes the roles of the active site histidines. . .Histidines and lysine in KAS I ⁄ KAS II catalysis P von Wettstein-Knowles et al Scheme group because of the cysteine and two histidine activesite residues [1–3] Another group of decarboxylating... co-ordinated in the vicinity of the active site (Fig 2) Three of the six cation ligands are main-chain oxygen atoms, and three are the side-chain oxygen atoms of N296, E342 and S387 The glutamic acid