Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx

Fatty acid desaturases from the microalga Thalassiosira pseudonana Thierry Tonon1,*, Olga Sayanova2, Louise V Michaelson2, Renwei Qing1,†, David Harvey1, Tony R Larson1, Yi Li1, Johnathan A Napier2 and Ian A Graham1 CNAP, Department of Biology, University of York, Heslington, York, UK Rothamsted Research Institute, Harpenden, UK Keywords desaturases; long chain polyunsaturated fatty acids; sphingolipids; Thalassiosira pseudonana; yeast expression Correspondence I A Graham, Department of Biology (area 7), University of York, PO Box373, UK Fax: +44 1904 328762 Tel: +44 1904 328750 E-mail: iag1@york.ac.uk Present addresses *UMR 7139, CNRS-GOEMAR-UPMC, Station Biologique, BP 74, 29682 Roscoff cedex, France  College of Life Science, Sichuan University, Chengdu, China Note The sequences reported in this paper have been submitted to GenBank database under the accession number AY817152 (TpdesO), AY817153 (TpdesA), AY817154 (TpdesB), AY817155 (TpdesI) and AY817156 (TpdesK) Analysis of a draft nuclear genome sequence of the diatom Thalassiosira pseudonana revealed the presence of 11 open reading frames showing significant similarity to functionally characterized fatty acid front-end desaturases The corresponding genes occupy discrete chromosomal locations as determined by comparison with the recently published genome sequence Phylogenetic analysis showed that two of the T pseudonana desaturase (Tpdes) sequences grouped with proteobacterial desaturases that lack a fused cytochrome b5 domain Among the nine remaining gene sequences, temporal expression analysis revealed that seven were expressed in T pseudonana cells One of these, TpdesN, was previously characterized as encoding a D11-desaturase active on palmitic acid From the six remaining putative desaturase genes, we report here that three, TpdesI, TpdesO and TpdesK, respectively encode D6-, D5- and D4-desaturases involved in production of the health beneficial polyunsaturated fatty acid DHA (docosahexaenoic acid) Furthermore, we show that one of the remaining genes, TpdesB, encodes a D8-sphingolipid desaturase with strong preference for dihydroxylated substrates (Received 13 March 2005, revised 22 April 2005, accepted May 2005) doi:10.1111/j.1742-4658.2005.04755.x The algae, as a group, represent the third largest aquaculture crop (after freshwater fish and molluscs) in the world today [1,2] In recent years, considerable attention has been directed at marine microalgae for the production of oils and fatty acids, in particular the use of algal oils containing long chain polyunsaturated fatty acids (LCPUFAs) The most prominent of these are the health beneficial omega-3 eicosapentaenoic acid (EPA, 20:5D5,8,11,14,17) and docosahexaenoic acid (DHA, 22:6D4,7,10,13,16,19) Among the alga groups identified as producers of high levels of LCPUFAs, diatoms are able to produce and accumulate EPA and DHA in triacylglycerols (TAGs) [3] For biotechnological applications, these organisms are regarded as Abbreviations ARA, arachidonic acid; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid; EST, expressed sequence tag; FAME, fatty acid methyl ester; gDNA, genomic DNA; LCB, long chain base; LCPUFA, long chain polyunsaturated fatty acid; PUFAs, polyunsaturated fatty acids; RACE, rapid amplification of cDNA ends; TAG, triacyglycerol; Tpdes, Thalassiosira pseudonana desaturase FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3401 Microalgal front-end desaturases potentially good sources for the cloning of genes encoding the enzymes required for LCPUFA biosynthesis Different routes of LCPUFA synthesis have developed in nature The production of EPA and DHA in marine bacteria and some marine fungi relies on anaerobic polyketide synthase systems, which are encoded by several large polypeptides [4] More generally, biosynthesis of these fatty acids requires aerobic desaturases and elongases that catalyse a consecutive series of desaturation and elongations of the fatty acyl chain to generate EPA and DHA from a-linolenic acid (18:3D9,12,15) Besides the main routes leading to DHA via D6-desaturation, some algae display an alternate pathway for C20-PUFA production involving a D9-elongase [5] and a D8-desaturase [6] To date, at least one enzyme corresponding to each of the front-end desaturases and elongases necessary to convert a-linolenic acid to EPA has been isolated from diverse origins [7] ‘Front-end’ desaturation can be defined as desaturation between a pre-existing double bond and the C-terminal end of a fatty acid, as opposed to the much more prevalent (in plants) methyl-directed desaturation Reconstitution of EPA biosynthesis has been achieved in yeast [8,9] and in plants [10,11], with encouraging levels of C20LCPUFA production Moreover, the D4-desaturase gene encoding the last step in DHA biosynthesis has recently been isolated from a number of marine organisms [12–14] The final elongation step [of C20 polyunsaturated fatty acids (PUFAs) to C22] catalysed by a D5-elongase was the last outstanding step remaining to be functionally characterized at the molecular level Very recently, characterization of such an activity has been described in the microalgae Pavlova lutheri [15], Ostreococcus tauri and Thalassiosira pseudonana [16] These novel fatty acid elongases were used to successfully reconstitute DHA synthesis in yeast Therefore, all the activities are now available to engineer plants to produce this nutritionally important fatty acid However, all these enzymes have been isolated from a diverse array of organisms, for instance several marine microalgal species For the purposes of metabolic engineering and in order to achieve optimal synthesis in a heterologous host, it may be advantageous to use a complementary set of desaturase and elongase enzymes from the same organism This may be particularly relevant for the metabolic engineering of a compound such as DHA in a heterologous host such as linseed which would require the introduction of three desaturase and two elongase steps in order to convert the endogenous fatty acid a-linolenic acid to DHA Gene discovery-based strategies such as targeted expressed sequence tag (EST) databases or PCR 3402 T Tonon et al amplification using degenerate primers typically not provide sufficient coverage to enable identification of complete sets of genes for a particular process from a single organism Bioinformatics-based analysis of complete genome sequences potentially allow an exhaustive approach to gene discovery from a single organism if the process in question is sufficiently understood in terms of enzymes and other proteins involved at the biochemical level Such a situation now exists for discovery of genes involved in PUFA biosynthesis following the completion of the genome sequence of the EPA and DHA producing diatom T pseudonana [17] Levels of EPA and DHA in this organism are in the range of 17 and 5%, respectively, when in the exponential phase of growth [3] Two elongases involved in LCPUFA biosynthesis from T pseudonana have been recently characterized [16] and analysis of a draft genome sequence of this organism prior to publication of the complete genome sequence revealed the presence of a family of putative front-end desaturases that are obvious candidates for enzymes involved in the synthesis of EPA and DHA [18] However, rather surprisingly, the first of these genes to be functionally characterized was found to encode a cytochrome b5 fusion desaturase exhibiting D11-desaturase activity Here we report the cloning and characterization of the three desaturases involved in DHA synthesis, i.e a D6-, a D5- and a D4-desaturase Moreover, heterologous expression of an additional cytochrome b5 fusion desaturase has allowed the identification of a new D8-sphingolipid desaturase from Thalassiosira Results Phylogenetic and expression analysis of T pseudonana genes with similarity to front-end desaturases A recent phylogenetic analysis of the draft genome sequence of T pseudonana [18] reported the presence of 12 sequences showing significant similarity to functionally characterized front-end desaturases, i.e a fused cytochrome b5 binding domain at their N-terminus and three histidine boxes [19] Now that contigs have been built for the entire genome and most assigned to 24 nuclear chromosomes [17], we re-examined these 12 putative desaturase sequences based on cDNA characterization and genome analysis In our previous analyses, two partial desaturase coding sequences present near the ends of two distinct contigs were designated as unique genes, TpdesB and TpdesD TpdesB encoded an N-terminus region and TpdesD encoded a C-terminus region Our subsequent cDNA FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS T Tonon et al analysis of these sequences has revealed that they actually represent a single gene present on chromosome that is from now on referred to as TpdesB Comparison of the full-length TpdesB cDNA with the genomic sequence demonstrated that no introns are present in the gene The TpdesB ORF gives a predicted protein of 493 amino acids A further annotation update relates to TpdesH which, based on EST sequence analysis, appears to contain three characteristic histidine boxes but lacks the N-terminal cytochrome b5 domain TpdesL is a close homolog of TpdesH that also lacks the cytochrome b5 domain Both these genes share higher overall sequence similarity with putative proteobacterial desaturases that typically contain three histidine boxes but also lack the cytochrome b5 fusion A Microalgal front-end desaturases domain; for this reason they were excluded from the functional analysis described in this present study Based on information contained in the GenBank database we have allocated 10 of the 11 T pseudonana Tpdes sequences to specific chromosomes (Fig 1A) These 10 Tpdes sequences are distributed among six of the 24 chromosomes, with three sequences on chromosome 5, two on chromosomes and 6, and one each on chromosomes 3, and 21 Material used to sequence the T pseudonana genome was derived from a single diploid founder and this revealed the presence of two haplotypes with on average 0.75% polymorphism at the nucleotide level [17] However, the Tpdes genes occupy distinct chromosomal positions and therefore even the pairings with highest sequence similarity such B Fig Evolutionary relationship of T pseudonana putative desaturases (TpDES) with known front end desaturases and expression analysis of corresponding genes T pseudonana sequences were arbitrarily designated TpDESA to TpDESO (A) The phylogenetic tree of TpDES and functionally characterized front-end desaturases was established using the PHYLIP 3.5c software package and based on 148 alignable amino acid residues [18] Percentage bootstrap values above 60 are indicated above the nodes Chromosome location and availability of cDNAs for each gene is shown after the gene name (B) For RT-PCR based gene expression analysis, cells were harvested at various time of incubation and growth stage monitored by measuring the percentage of nitrogen degraded (inset table) PCR analysis was performed with gene specific primers on undiluted (lane 1) and five-fold serial dilutions (lanes 2–4) of cDNA Size of the expected cDNA amplified fragment is indicated in brackets below the gene name Inset PCR products from genomic DNA are shown in order to validate the TpdesG and TpdesM primer pairs M, DNA molecular size ladder FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3403 Microalgal front-end desaturases as TpdesO-TpdesM, TpdesN-TpdesG and TpdesHTpdesL are not due to haplotype variation The phylogenetic tree of TpDES sequences was re-constructed with the updated Tpdes sequences noted above in combination with front-end desaturases from a range of organisms The resulting tree shows three major groupings containing TpDES sequences (Fig 1A) The first group, containing TpDESL, TpDESH and four proteobacterial sequences, is characterized by the lack of a fused cytochrome b5 domain None of these genes have been functionally characterized and we did not include TpDESL or TpDESH in our functional analysis The remaining nine Tpdes genes show significant similarity to other functionally characterized desaturases As a first step to characterizing the Tpdes genes we analysed temporal expression analysis throughout the growth phases of the algal cell culture using semiquantitative RT-PCR (Fig 1B) The second phylogenetic group contains TpDESO, TpDESM, TpDESK, TpDESG and TpDESN together with previously characterized D5- and D4-desaturases TpDESO and TpDESM group with the diatom Phaeodactylum tricornutum D5-desaturase PtDEL5 (Fig 1A) Comparison of genomic sequences of TpDESO and TpDESM showed 72% identity, and one intron could be detected in each sequence RT-PCR analysis revealed that of these two genes only TpdesO is transcribed (Fig 1B) The TpdesO ORF is 1425 bp long and encodes a protein of 474 amino acids Alignment with the corresponding genomic sequence confirmed the presence of a 99 bp intron in the TpdesO gene The amino acid sequence of PtDEL5 and TpDESO exhibited 63% identity, suggesting that TpDESO could catalyse the D5-desaturation step in the PUFA biosynthetic pathway The TpDESK gene sequence forms a subgroup with functionally characterized D4-desaturases from Thraustochytrium sp and Euglena gracilis (Fig 1A) TpDESK is expressed at a low level relative to TpdesO during the exponential phase of growth TpDESN and TpDESG not group with functionally characterized front-end desaturases from other organisms TpDESN has already been characterized as a 16:0 specific D11-desaturase [18] Alignment of the TpdesG genomic sequence with other desaturases showed that although it contains a cytochrome b5 domain and three histidine boxes a start methionine cannot be determined by in silico analyses alone, indicating that it may represent a pseudogene RT-PCR based expression analysis suggested that the gene is not expressed during the growth phase and we have not investigated it further In the third major group, TpDESE, TpDESI, TpDESB and TpDESA are separated on four branches (Fig 1A) 3404 T Tonon et al The TpdesE ORF is incomplete in the draft genome sequence in comparison to other desaturases, and 5¢-RACE experiments failed to produce full-length cDNA for this gene despite the fact that it shows relatively high mRNA expression levels throughout the growth phases TpdesI is similarly highly expressed and the corresponding full length amino acid sequence has 70% sequence identity and groups with the Phaeodactylum tricornutum PtDEL6 D6-desaturase TpdesI contains an intron of 149 bp, and the corresponding cDNA contains a 1455 bp ORF giving a predicted polypeptide of 484 amino acids The remaining two TpDES sequences, TpDESB and TpDESA, showed only 25% identity at the amino acid level Comparison of TpdesA genomic and cDNA sequences revealed that the gene contains three introns of 84, 88 and 68 nucleotides The 1548 bp cDNA of TpdesA gives a predicted polypeptide of 515 amino acids No function could be predicted for these enzymes from comparison of their primary structure with other front-end desaturases as they not cluster with any functionally characterized desaturases with significant confidence Incorporation of intron presence and positional information in genomic sequences does not shed any further light on the phylogenetic relationship of the cytochrome b5 containing T pseudonana desaturase genes TpdesB and TpdesN not contain introns, TpdesK, TpdesO and TpdesI each have a single intron and TpdesA contains three introns Full-length cDNAs are not available for TpdesG and TpdesE therefore definite information on intron position is not available for these two genes Intron ⁄ exon junction is not conserved between any pair of the Tpdes genes analyzed and our analysis suggests that introns appear to have evolved independently in each case Characterization of PUFAs front-end desaturases To establish the function of the different putative front-end desaturases, the full-length cDNAs of TpdesA, TpdesB, TpdesI, TpdesK and TpdesO were cloned into the vector pYES2, under the control of an inducible galactose promoter, to produce the constructs pYDESA, pYDESB, pYDESI, pYDESK and pYDESO They were first expressed in the Saccharomyces cerevisiae strain Invsc1 (or W303A1 for pYDESK) Transformants were incubated in the presence of a range of potential fatty acid substrates (18:2D9,12, 20:2D11,14, 20:3D11,14,17, 20:3D8,11,14, 18:3D9,12,15, D8,11,14,17 D7,10,13,16 D7,10,13,16,19 , 22:4 , 22:5 ) of desatu20:4 rases involved in the PUFA biosynthesis pathway After addition of such substrates, no new peaks were detected for pYDESA and pYDESB, indicating that FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS T Tonon et al Fig GC analysis of FAMEs from yeast transformed with the empty plasmid pYES2 or the plasmid containing TpDESI Yeast cells transformed with either pYES2 (bottom chromatogram) or pYDESI (top chromatogram) were induced for six days in the presence of 18:2D9,12 and 18:3D9,12,15 exogenously fed before sampling for fatty acid analysis New fatty acids are underlined I.S., internal standard (17:0) The experiment was repeated twice and results of a representative experiment are shown these desaturases were not involved in production of LCPUFAs However, comparison of fatty acid profiles derived from yeast transformed with pYES2 and pYDESI showed two new peaks in the TpdesI transformants even in the absence of exogenous fatty acids in the medium These new peaks corresponded to 16:2D6,9 and 18:2D6,9 (Fig 2) These fatty acids are produced by D6-desaturation of 16:1D9 and 18:1D9, respectively, the two major fatty acids found in yeast When linoleic (18:2D9,12) and a-linolenic (18:3D9,12,15) acids were added to the culture medium, 18:3D6,9,12 and 18:4D6,9,12,15 were detected (Fig 2), confirming that TpdesI encodes a D6-desaturase Analysis of the fatty acid composition in the pYDESI transformants after days of incubation showed the percentage conversion of the 16:1D9 and 18:1D9 substrates were 29 and 38%, FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS Microalgal front-end desaturases Fig GC analysis of FAMEs from yeast transformed with the empty plasmid pYES2 or the plasmid containing TpDESO Yeast cells transformed with either pYDESO (top chromatograms) or pYES2 (bottom chromatograms) were induced for six days in the presence of 20:3D8,11,14 and 20:4D8,11,14,17 (A), 20:3D11,14,17 (B), and 20:2D11,14 (C) exogenously fed before sampling for fatty acid analysis New fatty acids are underlined The experiment was repeated twice and results of a representative experiment are shown respectively For the exogenous substrates 18:2D9,12 and 18:3D9,12,15, TpDESI exhibited a slight preference for the omega-3 fatty acid, as 68 and 80% of these substrates were converted to their corresponding D6-products Fatty acid profiling of extracts from TpDESO S cerevisiae transformants detected new peaks when the culture medium was supplemented with 20:3D8,11,14 and 20:4D8,11,14,17 (Fig 3A) These new FAMEs were identified as 20:4D5,8,11,14 (arachidonic acid, ARA) and 20:5D5,8,11,14,17 (EPA), respectively These results demonstrate that pYDESO introduces a double bond at position from the C-terminus of 20:3D8,11,14 and 20:4D8,11,14,17, indicating it is a D5-desaturase Analysis of cells harvested after incubation for days in the presence of both fatty acid substrates showed 16–19% conversion of each to their corresponding D5 fatty acids, suggesting that pYDESO does not have a 3405 Microalgal front-end desaturases preference for one substrate over the other The Caenorabditis elegans D5-desaturase is capable of inserting double bonds in a nonmethylene interrupted pattern into 20:2D11,14 and 20:3D11,14,17 as well as in a methylene interrupted pattern into fatty acids with a D8 double bond [20] TpdesO transformants were incubated in the presence of 20:3D11,14,17 and 20:2D11,14 to establish if the T pseudonana enzyme exhibited similar characteristics Profiling of extracts of TpdesO transformants fed with 20:3D11,14,17 and 20:2D11,14 revealed the presence of new peaks in both corresponding to 20:4D5,11,14,17 (juniperonic acid) and 20:3D5,11,14 (podocarpic acid), respectively (Fig 3B,C) The percentage conversion of 20:2D11,14 and 20:3D11,14,17 to their D5-desaturated products was 4.7 and 8.4, respectively, which was significantly less than the percentage conversion determined for D5-desaturation of the D8-desaturated fatty acids 20:3D8,11,14 and 20:4D8,11,14,17 Heterologous expression of TpDESK in S cerevisiae identified this enzyme as a D4-desaturase, as feeding of transformants with 22:5D7,10,13,16,19 resulted in the appearance a new peak identified as 22:6D4,7,10,13,16,19 (Fig 4) The quantities of both D4-desaturated FAs Fig GC analysis of FAMEs from yeast transformed with the empty plasmid pYES2 or the plasmid containing TpDESK Yeast cells transformed with either pYDESK (top chromatogram) or pYES2 (bottom chromatogram) were induced for six days in the presence of 22:5D7,10,13,16,19 exogenously fed before sampling for fatty acid analysis New fatty acid is underlined The experiment was repeated twice and results of a representative experiment are shown 3406 T Tonon et al detected were low but significant, with a conversion value of 3.0% for DHA These were the only unique peaks detected in the TpDESK transformants fed with the full range of fatty acids compared to the empty vector pYES2 controls Characterization of sphingolipid related front-end desaturase(s) Previous data have demonstrated that sphingolipid long chain base (LCB) desaturases have a paralogous relationship to front-end PUFA desaturases To determine if any of the five T pseudonana cytochrome b5 fusion candidate desaturases (TpdesA, TpdesB, TpdesI, TpdesK and TpdesO) functioned as sphingolipid desaturases, LCBs were extracted from S cerevisiae cells after galactose-induced expression of the heterologous gene Total LCBs (i.e both free LCBs and those deacylated from sphingolipids) were extracted and analysed using previously reported methodology [21] LCB desaturation was determined by separation of derivatized LCBs by HPLC and LC-MS as previously described [22], with candidate T pseudonana enzymes tested for activity using both trihydroxy (i.e phytosphingosine) and dihydroxy (i.e sphinganine) substrates Of the five candidate desaturases tested by expression in S cerevisiae, only one, TpdesB, displayed any ability to desaturate sphingolipid LCBs, resulting in the appearance of one additional (non-native) LCB (Fig 5) This activity was more pronounced when the pYDESB plasmid was expressed in the yeast sur2D mutant (which lacks the LCB C-4 hydroxylase Sur2p and hence trihydroxylated LCBs, Fig 5A), indicating a preference for dihydroxylated substrates (Fig 5C) The molecular ion for the pYDESB-dependent LCB had an m ⁄ z of 465, consistent with the identification of this product as a dihydroxylated long chain base of 18 carbons, containing one double bond (data not shown) The precise regiospecificity of the activity encoded by TpdesB was further investigated by comigration with authentic standards for desaturated dihydroxy-LCBS This indicated that the novel product present on expression of pYDESB in sur2D was not sphingosine (d18:1D4t) (Fig 5D), but instead comigrated with the trans-isomer of d18:1D8 (Fig 5B) (as determined by coinjection with LCBs resulting from expression of the borage sphingolipid D8-desaturase in sur2D 23,24); Thus, TpdesB encodes a sphingolipid D8desaturase with strong preference for dihydroxylated substrates In addition, it appears that the TpDESB desaturase differs from higher plant orthologs, since it only synthesizes the trans stereoisomer of the D8-double bond (Fig 5C, cf the stereo-unselective borage FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS T Tonon et al Fig HPLC analysis of sphingolipid LCB profiles of yeast transformed with TpdesB Total LCBs were extracted from yeast sur2D expressing pYDESB, derivatized and separated as described (A) LCB profile from yeast mutant sur2D which synthesizes only dihydroxylated LCBs (e.g d18:0 ¼ dihydroxylated 18 carbon LCB, saturated) (B) LCB profile from sur2D yeast expressing the stereounselective borage sphingolipid D8-desaturase: note the presence of cis and trans D8-desaturated dihydroxylated LCBs (inset) (C) LCB profile from sur2D yeast expressing pYDESB: note the presence of only the trans isomer of the D8-desaturated dihydroxylated LCB (D) The LCB profile of pYDESB was coinjected with a derivatized authentic standard for sphingosine (d18:1D4t): note that sphingosine does not coelute with the novel D8t-LCB which arises from pYDESB expression sphingolipid D8-desaturase, Fig 5B) To provide further evidence for the correct assignment of function of TpdesB as a sphinganine D8t-desaturase, we examined the sphingolipid LCB composition of T pseudonana This indicated that the diatom sphingolipids are composed predominantly of dihydroxylated C18-LCBs, of which the majority are unsaturated: 76% dienine-containing and 17% sphingenine-containing sphingolipids, compared with 7% sphinganine-containing sphingolipids Thus, 93% of T pseudonana LCBs contain one or more double bonds Discussion Using a combination of molecular cloning and bioinformatics analysis of the available T pseudonana genome, we have been able to identify 11 putative front-end desaturases Two lacked cytochrome b5 fusion domain and grouped with functionally uncharacterized putative proteobacterial desaturases Among the remaining nine cytochrome b5 fusion domain containing desaturase sequences, seven were shown to be FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS Microalgal front-end desaturases transcriptionally active in T pseudonana cells based on semiquantitative RT-PCR We were unable to obtain a full-length ORF for TpdesE due possibly to problems of secondary structure in the mRNA We previously showed that despite having significant sequence similarity, TpDESN actually encodes a D11-desaturase specific for 16:0 and so cannot be considered as a member of the front-end desaturase functional class [18] Of the five remaining sequences we expected that at least some if not all of these would encode desaturases involved in the biosynthesis of EPA and DHA from stearidonic acid (18:4D6,9,12,15) According to the phylogenetic analysis, TpdesI, TpdesO and TpdesK were good candidates for genes encoding D6-, D5- and D4-desaturases, respectively Results of heterologous expression in yeast of these genes confirm these predictions TpDESI introduces a double bond at position from the C-terminus of endogenous 16:1D9, 18:1D9 and exogenous fatty acids 18:2D9,12 and 18:3D9,12,15 Production of 16:2D6,9 and 18:2D6,9 from yeast fatty acids has already been observed after transformation with D6-desaturase from the oleaginous fungus Pythium irregulare [25], the moss Physcomitrella patens [26], the diatoms P tricornutum [9] and higher plants [27] The fatty acid profile of T pseudonana cells [18] suggests the existence of a D6-desaturase that can act on 16:2D9,12 to produce the corresponding D6 fatty acid 16:3D6,9,12 TpDESI is a good candidate for this activity considering its broad substrate specificity However, we were unable to test this hypothesis by direct feeding experiments as, to our knowledge, 16:2D9,12 is not commercially available TpDESO acts as a D5-desaturase on C20 fatty acids to produce 20:4D5,8,11,14 and 20:5D5,8,11,14,17 as predicted from the clustering of the gene in the phylogenetic tree This enzyme is also able to introduce a double bond in a nonmethylene interrupted pattern at the D5-position of 20:3D11,14,17 and 20:2D11,14 but at much lower efficiency than the methylene interrupted pattern of activity with fatty acids containing a double bond at the D8 position The C elegans D5-desaturase was shown to exhibit similar activities as found with TpDESO [20] The significance of this nonmethylene interrupted pattern of activity in a biological context is not clear, as the resulting fatty acids are considered to be ‘dead end’ metabolites since they not appear to act as precursors for signalling molecules such as prostaglandins and they are not present as a major fatty acid component in T pseudonana Of the three PUFA desaturases characterized in the heterologous system, TpDESK exhibited the lowest activity with only 3.0% of 22:5D7,10,13,16,19 being desaturated to DHA Due to the low D4-desaturase activity of TpDESK on what is likely to be the 3407 Microalgal front-end desaturases preferred substrate it is not possible to reach a conclusion on the substrate preference of this enzyme for omega-3 vs omega-6 fatty acids with the current data TpDESI and TpDESO displayed almost no selectivity between the omega-3 and omega-6 fatty acid substrates, being equally active on both substrates Interestingly the D6-desaturase is more active than the D5-desaturase which in turn is more active than the D4-desaturase activity of TpDESK It is not possible to conclude if this has any significance as regards rate of flux through these different enzymes in vivo as the heterologous expression system could introduce artefacts with respect to overall activity TpDESO and TpDESI also exhibited additional activities with TpDESO producing 16:2D6,9 and 18:2D6,9 and TpDESI producing 20:3D5,11,14 and 20:4D5,11,14,17 However, none of these products were detected in extracts from T pseudonana cells [18] An alternate pathway for PUFA desaturation has been demonstrated in several lower eukaryotes [28] and a gene encoding this enzyme has been isolated from Euglena gracilis [6] In this alternate pathway, a front end D8-desaturase acts on 20:2D11,14 (eicosadienoic acid) and 20:3D11,14,17 (eicosatrienoic acid) to produce 20:3D8,11,14 and 20:4D8,11,14,17 The E gracilis D8-desaturase is in the same subgroup as TpDESI and TpDESE in the phylogenetic tree (Fig 1) We have functionally characterized TpDESI in the current work but have been unable to characterize TpDESE The fact that we did not detect eicosadienoic acid in T pseudonana cells, and only very low level of eicosatrienoic acid were measured suggests the D8-desaturase alternate pathway is not present in this organism Furthermore, acyl-CoA profiling of T pseudonana cells, did not detect 20:2D11,14 or 20:3D11,14,17 CoA (Tonon et al unpublished data) Therefore it is unlikely that TpdesE or any of the other Tpdes genes encode a PUFA D8-desaturase As well as the three T pseudonana cytochrome b5 fusion desaturases confirmed as front-end PUFA desaturases, we have also identified a sphingolipid D8-desaturase, TpDESB This is the first example of a sphingolipid long chain base D8-desaturase from a marine algal species It has previously been observed that this class of sphingolipid desaturase displays a paralogous relationship to the PUFA desaturases, though the evolutionary significance of this is still unclear [29] In that respect, the availability of the T pseudonana genome sequence may provide further insights into the ancestry of these cytochrome b5 fusion desaturases, not least of all as this diatom represents the first example of an organism which carries out both front-end LCPUFA desaturation (up to and including the 3408 T Tonon et al synthesis of DHA) and sphingolipid D8-desaturation However, there are several subtle difference between the TpDESB sphingolipid desaturases and the predominant form of the enzyme found in higher plants Firstly, TpDESB has a strong preference for dihydroxylated LCB substrates (i.e sphinganine), whereas almost all higher plant sphingolipid D8-desaturases display greater activity towards trihydroxylated LCBs (i.e phytosphingosine) [30] A recent example of a higher plant sphingolipid desaturase with activity towards sphinganine was reported from Aquilegia vulgaris [24] The introduction of the D8-desaturation into dihydroxylated substrates may represent the first step in the synthesis of sphingadienine-containing sphingolipids (i.e containing d18:2D4t,8c ⁄ t LCBs), by the subsequent D4-desaturation of the D8-desaturated LCB This biosynthetic route has been invoked to explain the absence of sphingosine (i.e D4-desaturated dihydroxysphingosine) in many plant species, even though higher plant LCB D4-desaturases are clearly present, as witnessed by the high levels of sphinga-4,8-dienine present in plant sphingolipids Interestingly, we have detected a presumptive ortholog of the dihydrosphingosine D4desaturase [22] in the T pseudonana genome sequence, as well as the presence of sphingadienine LCBs (Michaelson and Napier, unpublished data) It therefore seems likely that the biosynthesis of unsaturated sphingolipids in T pseudonana occurs in the manner initially proposed for higher plants, i.e via D8-desaturation of dihydroxy substrates, followed by D4-desaturation This is in contrast to that reported for animal systems (which lack a sphingolipid D8-desaturase), where D4-desaturation occurs on an N-acylated dihydroxylated LCB (i.e dihydroceramide) [31] Although TpDESA clustered closely to TpDESB, expression of TpDESA in either wild-type or sur2D yeast strains failed to reveal any activity as an LCB desaturase The second feature of TpDESB is that this is the first cloned example of stereo-selective sphingolipid D8 sphinganine desaturase; previous examples of the higher plant sphingolipid desaturases with this regiospecificity are stereo-unselective in terms of the double bond introduced (i.e a nonequal mixture of cis and trans configurations), though a stereo-specific D8t phytosphingosine desaturase has been reported from the yeast Kluyveromyces lactis [32] (see Sperling and Heinz, 2003 [30] for an excellent review of the topic of LCB desaturation) The enzymatic basis for this higher plant stereo-unselective is currently unclear, but has been hypothesized to result from a syn-elimination of two vicinal hydrogen atoms from two different substrate conformers, making this form of sphingolipid LCB desaturation distinct from the D4-desaturation which FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS T Tonon et al Microalgal front-end desaturases yields sphingosine [30] In that respect, it is perhaps surprising to find a more ‘precise’ form of stereo-specific LCB desaturation in the unicellular diatom T pseudonana, which may be due to an as yet unknown role It is also currently unclear as to the role of sphingolipid LCB D8-desaturation, though it has been hypothesized to be involved in chilling tolerance in some plant species and we have observed some variation in T pseudonana LCB profiles according to culture conditions Interestingly, the ratio of cis ⁄ trans forms of D8desaturated LCBs in higher plants varies according to subcellular location, with a very much enhanced level of D8t-LCBs found in plasma-membranes and detergent-resistant membranes (lipid rafts) [33] Our observation of a D8t-specific dihydroxy-LCB desaturase in T pseudonana may therefore provide an additional tool with which to investigate the functionality and importance of sphingolipid LCB heterogeneity [34] In conclusion, this comprehensive study on the T pseudonana front-end desaturases demonstrates the value of whole genome sequence for gene discovery programmes Whether the complete set of PUFA desaturases from T pseudonana represent valuable tools for metabolic engineering of the PUFA biosynthetic pathway into oil crops remains to be established The additional activities exhibited by the D5- and D6-desaturases could prove problematic as it would be preferable to limit the introduced enzymatic activities to those essential for EPA and DHA production in order to avoid the presence of additional fatty acids in an end product Nevertheless, this set of desaturases along with the recently characterized D5-elongase from the same organism represents an attractive biotechnological resource As highlighted in recent publications [10], a critical issue for the development of a commercially viable product will be the final yield of EPA and DHA in the engineered vegetable oil and this will most likely require the introduction of additional activities such as acyltransferases and acyl-CoA synthetases [35] Further mining of the T pseudonana genome should lead to identification of genes encoding these additional enzyme activities Experimental procedures Cultivation of T pseudonana, RNA extraction and RT-PCR analysis of gene expression T pseudonana was cultivated as described previously [18] Total RNA was extracted from cells harvested at different stages of growth using an RNeasy plant mini kit (Qiagen, Valencia, CA, USA) First-strand cDNA was synthesized from three lg of DNAse treated RNA using a Prostar First-strand RT-PCR kit (Stratagene, La Jolla, CA, USA) PCR with primer pairs specific to each T pseudonana desaturase gene (Table 1) were performed using gDNA, or undiluted and five-fold serial dilutions of cDNAs as follows: the reactions were heated to 95 °C for followed by 35 cycles at 95 °C for 30 s, 30 s at temperatures ranging between 50 and 70 °C according to the primer pair used and 72 °C for min, then a single step at 72 °C for 10 The 18S rRNA gene was used to ensure that the same quantity of cDNA was used for PCR on the different RNA samples Aliquots of PCR reactions were electrophoresed through a 1% agarose gel Identity of the diagnostic frag- Table Primers used in this study Sequence of the primers is given in the 5¢ to 3¢ orientation Restriction site used for cloning in the yeast plasmid pYES2 are in bold Gene name RT-PCR 18S rRNA TpdesA TpdesB TpdesE TpdesG TpdesI TpdesK TpdesM TpdesN TpdesO Yeast expression TpdesA TpdesB TpdesI TpdesK TpdesO Forward Reverse GGTAACGAATTGTTAG GAGAGGAAGTTCCGTCCTTG GTATGGATGCTACCGATG GAGTTGATGAAGACATTGCG GATACTTCTTCATCTTGCACG GAGAATGCCAAGTTGGAG GTGTGAGTTATGGAACGAAG GATTCATCCGTATCATAATAGTAAG GTGAGAGCACTAACCAAGCTT GATGAAGGCTGTTGGAAAG GTCGGCATAGTTTATG CAACGCAATCAATGAACGC TGAATGTACAGATTGAACCT CTCCAACTGGTATTGCATTC CATATCTGAAGTGTGAGCG TGTTGCAACACTTCCACGG CTACTCACACTTGGCTTTAC TGGAACCTATGCCACCAC CAATCAGTAGGCTTCGTCG CATCATCCTCAATGCAACGG GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG GCGGGTACCATGGCTCCACCCTCCATCAAAGAC GCGGGATCCACCATGGCTGGAAAAGGAGGAGAC GGGATCCATGGGCAACGGCAACCTCCCAG CCCAAGCTTACCATGGCTCCCCCCAACGCCGAT GCGGAGCTCTCACGTGTACATGAAAGC GCGGAGCTCCTATCCCTGAGCACACAT GCGAATTCTTACATGGCAGGGAAATC GGTCTAGACTACTCACACTTGGCTTTACC GCTCTAGATTAGGCACTTCCAGACAA FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3409 Microalgal front-end desaturases ment for TpdesO, TpdesM, TpdesN and TpdesG was verified by sequencing after cloning in the pGEM-T EasyVector (Promega, Madison, WI, USA) 5¢- and 3¢-RACE experiment The GeneRacerTM kit (Invitrogen, Carlsbad, CA, USA) was used to reverse transcribe T pseudonana RNA and cDNA was used to amplify the 5¢-end of TpdesE and the 3¢-end of the TpdesB gene Fragments generated by nested PCR were cloned into the pGEM-T EasyVector (Promega) and sequenced Functional characterization of T pseudonana putative front-end desaturases in Saccharomyces cerevisiae cDNA of the entire desaturase coding region was synthesized from T pseudonana RNA using the SuperScriptTM III RNase H– Reverse Transcriptase (Invitrogen) or the Enhanced Avian Reverse Transcriptase (Sigma) and gene specific primers pairs (Table 1) Forward primers for TpdesA, TpdesB, TpdesI and TpdesO gene were designed to contain an alanine codon (GCT) just downstream of the start codon not present in the original algal sequences Presence of a G at position +4 has been shown to improve translation initiation in eukaryotic cells [36] In the case of TpDesK, activity was detected in S cerevisiae when a full length cDNA that did not contain the alanine codon was used The Expand High Fidelity PCR system (Roche, Indianapolis, IN, USA) was employed to minimize potential PCR errors The amplified product was gel purified and restricted with KpnI and SacI for TpdesA and TpdesB, EcoRI and BamHI for TpdesI, HindIII and XbaI for TpdesO, and BamHI and XbaI for TpdesK Each desaturase fragment was then cloned into the corresponding sites behind the galactose-inducible GAL1 promoter of pYES2 (Invitrogen) to yield the plasmids pYDESA, pYDESB, pYDESI, pYDESO, and pYDESK The fidelity of the cloned PCR product was checked by sequencing The vectors containing the T pseudonana sequences were then transformed into S cerevisiae strain Invsc1 (Invitrogen) (or W303A1 for pYDESK) by a lithium acetate method Transformants were selected on minimal medium plates lacking uracil In order to monitor LCBs sphingolipids synthesis, pYDESA, pYDESB, pYDESI, pYDESO, and pYDESK were also transformed into the yeast mutant sur2D (Euroscarf, http://www.uni-frankfurt.de/fb15/mikro/euroscarf/ index.html) As a positive control for the sphingolipid D8-desaturation of LCBs in both WT and sur2D mutant, the yeast expression construct containing the borage D8desaturase was used, as described previously [23,24] For PUFA feeding experiment, individual transformants were grown at 25 °C in the presence of 2% (w ⁄ v) raffinose 3410 T Tonon et al and 1% (w ⁄ v) Tergitol NP-40 (Sigma, St Louis, MO, USA) Expression of the transgene was induced at D600 ¼ 0.2–0.3 by supplementing galactose to 2% (w ⁄ v) At that time, the appropriate fatty acids were added to a final concentration of 50 lm Incubation was carried out at 25 °C for days and then 15 °C for another days For the cofeeding experiment, the same conditions were applied, except that both substrates were added to 25 lm final concentration Each feeding experiment was repeated twice, and FA analysis was carried out on triplicate samples For functional characterization of Tpdes genes in the sur2D background, cultures were grown at 22 °C with shaking in the presence of 2% (v ⁄ v) raffinose and induction was carried out as previously described [37] All cultures were then grown for a further 48 h unless indicated All analysis was performed on triplicate samples and replicated three times Fatty acid analysis Microalgae or yeast cells were harvested by centrifugation Total fatty acids were extracted and transmethylated as previously described [14] Fatty acid methyl esters (FAMEs) of methyl pentadecanoate (15:0) or methyl heptadecanoate (17:0) were included as internal standards to enable quantification PUFA FAMEs were identified by comparing chromatographic traces with transmethylated commercial Menhaden oil (Supelco, Gillingham, Dorset, UK), and by identification of picolinyl ester and dimethyl disulphide adduct structures by GCMS as previously described [18] Sphingoid base analysis Sphingolipid analysis of yeast cells was carried out essentially as described previously [21] LCBs were liberated from yeast cells by alkaline hydrolysis and extracted with chloroform ⁄ dioxane ⁄ water (6 : : 1, v ⁄ v ⁄ v) The LCB fraction was converted to dinitrophenol derivatives, extracted with chloroform ⁄ methanol ⁄ water (8 : : 3, v ⁄ v ⁄ v), purified by TLC on silica plates and analysed by reversed-phase HPLC using an Agilent 1100 LC system, with MS analysis carried out on a Thermoquest LCQ system with an APCI source Standards were obtained from Matreya Inc USA, or using previously authenticated in vivo synthesized LCBs [23,24] Acknowledgements Financial support for this work was provided by the Department for Environment, Food and Rural Affairs grant no NF 0507 and the EU Sixth Framework Programme Integrated Project LipGene (Contract FOODCT-2003–505944) RQ is a visiting scholar from FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS T Tonon et al Sichuan University of China supported by the China Scholarship Council, grant no CSC 22851086 Rothamsted Research receives grant-aided support from the Biological Sciences and Biotechnology Research Council (BBSRC) UK References Hanisak MD (1998) Seaweed cultivation: global trends World Aquaculture 29, 18–21 Anonymous (2000) The State of World Fisheries and Aquaculture Food and Agriculture Organization of the United Nations, Rome, Italy Tonon T, Harvey D, Larson TR & Graham IA (2002) Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae Phytochemistry 61, 15–24 Metz JG, Roessler P, Facciotti D, Levering C, Dittrich F, Lassner M, Valentine R, Lardizabal K, Domergue F, Yamada A et al (2001) Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes Science 293, 290–293 Qi B, Beaudoin F, Fraser T, Stobart AK, Napier JA & Lazarus CM (2002) Identification of a cDNA encoding a novel C18-Delta(9) polyunsaturated fatty acid-specific elongating activity from the docosahexaenoic acid (DHA)-producing microalga, Isochrysis galbana FEBS Lett 510, 159–165 Wallis JG & Browse J (1999) The Delta8-desaturase of Euglena gracilis: an alternate pathway for synthesis of 20-carbon polyunsaturated fatty acids Arch Biochem Biophys 365, 307–316 Sayanova O & Napier JA (2004) Eicosapentaenoic acid: biosynthetic routes and the potential for synthesis in transgenic plants Phytochemistry 65, 147–158 Beaudoin F, Michaelson LV, Hey SJ, Lewis MJ, Shewry PR, Sayanova O & Napier JA (2000) Heterologous reconstitution in yeast of the polyunsaturated fatty acid biosynthetic pathway Proc Natl Acad Sci USA 97, 6421–6426 Domergue F, Lerchl J, Zahringer U & Heinz E (2002) ă Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis Eur J Biochem 269, 4105–4113 10 Abbadi A, Domergue F, Bauer J, Napier JA, Welti R, Zahringer U, Cirpus P & Heinz E (2004) Biosynthesis ă of very-long-chain polyunsaturated fatty acids in transgenic oilseeds: constraints on their accumulation Plant Cell 10, 2734–2748 11 Qi B, Fraser T, Mugford S, Dobson G, Sayanova O, Butler J, Napier JA, Stobart AK & Lazarus C (2004) Production of very long chain polyunsaturated omega-3 and omega-6 fatty acid in plants Nat Biotech 22, 1–7 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS Microalgal front-end desaturases 12 Qiu X, Hong H & MacKenzie SL (2001) Identification of a Delta fatty acid desaturase from Thraustochytrium sp involved in the biosynthesis of docosahexanoic acid by heterologous expression in Saccharomyces cerevisiae and Brassica juncea J Biol Chem 276, 31561– 31566 13 Meyer A, Cirpus P, Ott C, Schlecker R, Zahringer U & ă Heinz E (2003) Biosynthesis of docosahexaenoic acid in Euglena gracilis: Biochemical and molecular evidence for the involvement of a D4-fatty acyl group desaturase Biochemistry 42, 9779–9788 14 Tonon T, Harvey D, Larson TR & Graham IA (2003) Identification of a very long chain polyunsaturated fatty acid D4-desaturase from the microalga Pavlova lutheri FEBS Lett 553, 440–444 15 Pereira SL, Leonard AE, Huang Y-S, Chuang L-T & Mukerji P (2004) Identification of two novel microalgal enzymes involved in the conversion of the x3-fatty acid, eicosapentaenoic acid, into docosahexaenoic acid Biochem J 384, 357–366 16 Meyer A, Kirsch H, Domergue F, Abbadi A, Sperling P, Bauer J, Cirpus P, Zank TK, Moreau H, Roscoe TJ et al (2004) Novel fatty acid elongase and their use for the reconstitution of docosahexaenoic acid biosynthesis J Lipid Res 45, 1899–1909 17 Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH, Zhou S, Allen AE, Apt KE, Bechner M et al (2004) The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism Science 306, 79–86 18 Tonon T, Harvey D, Qing R, Li Y, Larson TR & Graă ham IA (2004) Identication of a fatty acid A11-desaturase from the microalga Thalassiosira pseudonana FEBS Lett 563, 28–34 19 Sperling P, Ternes P, Zank TK & Heinz E (2003) The evolution of desaturases Prostaglandins Leukot Essent Fatty Acids 68, 73–95 20 Watts JL & Browse J (1999) Isolation and characterization of a delta5-fatty acid desaturase from Caenorhabditis elegans Arch Biochem Biophys 362, 175–182 21 Sperling P, Zahringer U & Heinz E (1998) A sphingoliă pid desaturase from higher plants: identification of a new cytochrome b5 fusion protein J Biol Chem 273, 28590–28596 22 Garton S, Michaelson LV, Beaudoin F, Beale MH & Napier JA (2003) The dihydroceramide desaturase is not essential for cell viability in Schizosaccharomyces pombe FEBS Lett 538, 192–196 23 Sperling P, Libisch B, Zahringer U, Napier JA & Heinz ă E (2001) Functional identification of D8-sphingolipid desaturase from Borago officinalis Arch Biochem Biophys 388, 293–298 24 Michaelson LV, Longman AJ, Sayanova O & Napier JA (2002) Isolation and characterization of a cDNA 3411 Microalgal front-end desaturases 25 26 27 28 29 30 31 encoding a Delta8 sphingolipid desaturase from Aquilegia vulgaris Biochem Soc Trans 30, 1073–1075 Hong H, Dalta N, Reed DW, Covello PS, MacKenzie SL & Qiu X (2002) High-level production of c-linolenic acid in Brassica juncea using a D6 desaturase from Pythium irregulare Plant Physiol 129, 354–262 Girke T, Schimdt H, Zahringer U, Reski R & Heinz E ă (1998) Identication of a novel D6-acyl-group desaturase by targeted gene disruption in Physcomitrella patens Plant J 15, 39–48 Sayanova O, Davies GM, Smith MA, Griffiths G, Stobart AK, Shewry PR & Napier JA (1999) Accumulation of D6-unsaturated fatty acids in transgenic tobacco plants expressing a D6-desaturase from Borago officinalis J Exp Bot 50, 1647–1652 Pereira SL, Leonard AE & Mukerji P (2003) Recent advance in the study of fatty acid desaturases from animals and lower eukaryotes Prostaglandins Leukot Essent Fatty Acids 68, 97–106 Napier JA, Michaelson LV & Dunn TM (2002) A new class of lipid desaturase central to sphingolipid biosynthesis and signalling Trends Plant Sci 7, 475–478 Sperling P & Heinz E (2003) Plant sphingolipids: structural diversity, biosynthesis, first genes and functions Biochim Biophys Acta 1632, 1–15 Merrill AH Jr & Sweeley CC (1996) Biochemistry of Lipids, Lipoproteins and Membranes (Vance DE & 3412 T Tonon et al 32 33 34 35 36 37 Vance J, eds), pp 309–339 Elsevier Science B.V., Amsterdam, the Netherlands Takakuwa N, Kinoshita M, Oda Y & Ohnishi M (2002) Isolation and characterization of the genes encoding D8-sphingolipid desaturase from Saccharomyces kluyveri and Kluyveromyces lactis Curr Microbiol 45, 459–461 Borner GH, Sherrier DJ, Weimar T, Michaelson LV, Hawkins ND, Macaskill A, Napier JA, Beale MH, Lilley KS & Dupree P (2005) Analysis of detergent-resistant membranes in Arabidopsis: evidence for plasma membrane lipid rafts Plant Physiol 137, 104–116 Dunn TM, Lynch DV, Michaelson LV & Napier JA (2004) A post-genomic approach to understanding sphingolipid metabolism in Arabidopsis thaliana Ann Bot Lond 93, 483–497 Tonon T, Qing R, Harvey D, Li Y, Larson TR & Graham IA (2005) Identification of a long-chain polyunsaturated fatty acid acyl-coenzyme A synthetase from the diatom Thalassiosira pseudonana Plant Physiol 138, 402–408 Kozak M (1987) An analysis of 5¢-noncoding sequences from 699 vertebrate messenger RNAs Nucleic Acids Res 15, 8125–8148 Michaelson LV, Lazarus CM, Griffiths G, Napier JA & Stobart AK (1998) Isolation of a delta5-fatty acid desaturase gene from Mortierella alpina J Biol Chem 273, 19055–19059 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS ... Pavlova lutheri [15], Ostreococcus tauri and Thalassiosira pseudonana [16] These novel fatty acid elongases were used to successfully reconstitute DHA synthesis in yeast Therefore, all the activities... comprehensive study on the T pseudonana front-end desaturases demonstrates the value of whole genome sequence for gene discovery programmes Whether the complete set of PUFA desaturases from T pseudonana. .. the TpdesI transformants even in the absence of exogenous fatty acids in the medium These new peaks corresponded to 16:2D6,9 and 18:2D6,9 (Fig 2) These fatty acids are produced by D6-desaturation