pid can be caused by a number of different microorganisms what are they

Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Ngày tải lên : 25/10/2012, 10:51

... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon S Afr Med J 1961;35:715-6 Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD Incidence, complications, and management of Meckel's...

3
531
0

Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf

Ngày tải lên : 07/03/2014, 03:20

... maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase may correlate with the active synthesis of NADPH, one may think ... efﬁciency of PrPSc propagation was enhanced by the addition of NADPH, which was closely related to increasing NADPH concentrations (Fig 4A, compare lane and lanes 2–9) After densitometric quantiﬁcation ... transferring electrons, the energy class of PrP may change, leading to an unstable status Another aspect may be the potential metal-catalysed oxidation of PrP Reduced Cu+ from Cu2+ by NADPH can...

10
342
0

Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt

Ngày tải lên : 16/03/2014, 04:20

... thermophilic archeaons can also use ATP as a phosphoryl transfer donor [9–12] Here we report an apparent ADPase activity in preparations of the recombinant ATPase domain of the AAA+ ATPase NtrC1 ... of 0.01% contamination by E coli adenylate kinase (AK) Apparent catalysis of ADP hydrolysis by NtrC1C was in fact conversion of two ADP molecules to ATP and AMP by AK followed by hydrolysis of ... the ‘ADPase-stimulating’ fraction from the above by MonoQ chromatography and analysis by MS (MALDI and, separately, LC ⁄ MS) identiﬁed AK as a contaminant that could cause the apparent ADP hydrolysis...

9
401
0

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Ngày tải lên : 23/03/2014, 04:20

... mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... the American Brain Tumor Association Michael Reiss Fellowship (A. L.), Art of the Brain (A. L.), unrestricted funds from the Cancer Center of Santa Barbara (A. L.), and National Institutes of Health ... lateral surface of the cell membrane and spanned either the entire area of cell cell contact (Fig 7A) or a smaller area closer to the basal (Fig 7B) or apical (Fig 7C) membrane Plaques were also...

14
433
0

Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

Ngày tải lên : 18/06/2014, 12:20

... Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College of Cardiology/American ... cardiac events of long-term (1-year) treatment of the combination of clopidogrel plus ASA compared to ASA alone has been proven in patients with unstable angina and non-ST-elevation myocardial ... then be accomplished and stabilised by additional routine percutaneous intervention as soon as possible Thus, the advantage of early and ubiquitous initiation of reperfusion achievable by pharmacotherapy...

12
323
1

several epidemiological characteristics of acute encephalitis syndrome suspected to be caused by banna virus in some provinces of vietnam

Ngày tải lên : 25/07/2014, 11:36

... pseudovishnui Male 05VN 311 10 11 12 13 14 15 16 17 18 Province Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can Tho Can ... Ha Tay Ha Tay Ha Tay Ha Tay Bac Giang Bac Giang Bac Giang Bac Giang Bac Giang Bac Giang Bac Giang Bac Giang In 12 Banna virus strains isolated in the Northern region period 2001-2011, there are ... symptom was not observed after days of treatment from all patients in this study 3.1.2.3 Result after treatment of AES caused by Banna virus Table 3.5 Average number of days of treatment of AES caused...

24
296
0

Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx

Ngày tải lên : 08/08/2014, 16:23

... Villegas A, Gonzalez AF, Anguita E, Sanchez J, Carreno DL, Arrizabalaga B, Atuxta L Hb Johnstown [beta 109 (G11) Val >Leu]: second case described and associated for the first time with beta(0)-thalassemia ... gas parameters are available, without necessity of more sophisticated calculations using antilog parameters With increased ease and rapidity of calculation using our Excel program (Supplementary ... longer easily available in routine and even reference laboratories Lichtman and colleagues have reported a mathematical formula which can be used to calculate P50 reliably [5] Calculating P50 using...

5
418
0

Báo cáo y học: "Acute heart failure caused by a giant hepatocellular metastatic tumor of the right atrium" pps

Ngày tải lên : 10/08/2014, 09:22

... Elod Papp, Zsuzsanna Keszthelyi, Nagy Karoly Kalmar, Lajos Papp, Csaba Weninger, Tamas Tornoczky, Endre Kalman, Kalman Toth, Tamas Habon: Pulmonary embolization as primary manifestation of hepatocellular ... Cir Cardiotorac Vasc 2008, 15(2):79-81 Sabir AA, Banoo T, Al Haj OB, Fouad Sedky AA, Hamid TA, Mahrous AR: Metastatic hepatocellular carcinoma with occult primary presentation: A case report Saudi ... Review of The Literature Tumori 2004, 90:345-7 Afonso DV, Laranjeira A, Galrinho A, Fragata J: Metastatic hepatocellular carcinoma: right atrial tumor as primary clinical manifestation Case report...

4
396
0

Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" pptx

Ngày tải lên : 11/08/2014, 03:20

... to inadequate collateral circulation, this results in venous stasis and an increased risk of DVT Page of Congenital anomalies of the inferior vena cava are described as a rare cause of thrombotic ... Spectrum of congenital anomalies of the inferior vena cava: cross-sectional imaging findings RadioGraphics 2000, 20:639-652 Tiesenhausen K, Amann W, Thalhammer M, Aschauer M: Aplasia of the vena cava ... and infrarenal Variations of IVC anatomy are classified in a system based on abnormal regression and/or persistence of various embryonic veins [8] We describe a congenitally absent infrarenal IVC...

4
391
0

Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" potx

Ngày tải lên : 11/08/2014, 06:23

... to inadequate collateral circulation, this results in venous stasis and an increased risk of DVT Page of Congenital anomalies of the inferior vena cava are described as a rare cause of thrombotic ... Spectrum of congenital anomalies of the inferior vena cava: cross-sectional imaging findings RadioGraphics 2000, 20:639-652 Tiesenhausen K, Amann W, Thalhammer M, Aschauer M: Aplasia of the vena cava ... and infrarenal Variations of IVC anatomy are classified in a system based on abnormal regression and/or persistence of various embryonic veins [8] We describe a congenitally absent infrarenal IVC...

4
600
0

Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" potx

Ngày tải lên : 11/08/2014, 19:21

... carotid sheaths In 2b (after days of antibiotic therapy), the appearance of the disease process has changed (in comparison to 2a) with a decreasing amount of air in the soft tissues and replacement ... invasive than conventional surgical drainage and produced a similar outcome Moreover, percutaneous catheter drainage areas are less likely to become secondarily infected by antibiotic-resistant ... postoperative day and the wound was allowed to heal by secondary intention Inflammatory markers progressively came back to normal and the patient was discharged on the 18th day after admission He was...

5
217
0

Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" pps

Ngày tải lên : 11/08/2014, 19:21

... distal oesophagus with hilar lymphadenopathy, hepatic lesions consistent with metastases, a mass in the left adrenal gland, several areas of renal infarction bilaterally, but no cerebral metastatic ... literature of bacteraemia caused by this genotype of Capnocytophaga, genomospecies AHN8471; indeed, this genotype has only recently been described, as a member of the normal oral flora of healthy ... taken on the day of admission became positive after days incubation Gram-negative rods were isolated from both aerobic and anaerobic Our case shows again the potential for Capnocytophaga to cause...

3
239
0

Báo cáo y học: " Snapping hip caused by a venous hemangioma of the gluteus maximus muscle: a case report" pptx

Ngày tải lên : 11/08/2014, 19:21

... surgical treatments of external coxa saltans (the snapping hip) by Z-plasty of the iliotibial band Am J Sports Med 2004, 32:470-476 Ilizaliturri VM Jr, Martinez-Escalante FA, Chaidez PA, CamachoGalindo ... patient, a snapping hip was an extraordinarily rare presentation of a venous haemangioma The crucial image modality is MRI while the choice of treatment is surgical excision [12] Conclusion cases have ... hip caused by an osteochondroma of the proximal femur [10] The symptoms disappeared after surgical resection of the osteochondroma In our patient, the hemangioma grew in the lateral part of the...

4
341
0

Báo cáo y học: "Open Access Perforation of Meckel''''s diverticulum caused by a chicken bone: a case report" doc

Ngày tải lên : 11/08/2014, 19:21

... Radiological as well as clinical findings aid clinicians in diagnosing this congenital anomaly Perforation of Meckel's diverticulum caused by a chicken bone is a very rare complication and may ... general anaesthesia A normal appendix was identified during laparoscopic examination of the abdomen An inflammatory mass was seen with turbid fluid collection in the pelvic area on laparoscopy ... range Routine blood tests, erect chest and abdominal Xrays were unremarkable A provisional diagnosis of acute appendicitis was made and initial management included intravenous fluid resuscitation...

2
303
0

Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

Ngày tải lên : 11/08/2014, 21:22

... (T-tube cholangiogram) Figure Cannulation of T-tube fistula Cannulation of T-tube fistula Intraoperative laparoscopic photograph illustrating cannulation of T-tube fistula tract with 10-Fr Latex ... Lazaridis C, Papaziogas B, Patsas A, Galanis I, Paraskevas G, Argiriadou H, Papaziogas T: Detection of tract formation for prevention of bile peritonitis after T-tube removal Case report Acta ... biliary anatomy (b) Diagram of fistula pathway and leak mechanism Historically, a latex T-tube has always been used during open exploration, specifically to encourage a vigorous inflammatory reaction...

4
439
0

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Ngày tải lên : 12/08/2014, 16:20

... a quantitative score findings are in contrast to those of Kasahara and colleagues in adults [7] and de Blic and colleagues [15] in children A limitation of this study compared to that by Kasahara ... from asthmatics [7] HRCT scans were loaded to a PACS workstation (mv1000, Siemens) and all images were analysed electronically A magnification factor of was applied in all images that were displayed ... Kasahara K, Shiba K, Ozawa T, Okuda K, Adachi M: Correlation between the bronchial subepithelial layer and whole airway wall thickness in patients with asthma Thorax 2002, 57:242-246 Little SA,...

9
390
0

Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Ngày tải lên : 12/08/2014, 20:21

... continuous haemodiafiltration Values are presented as mean ± standard deviation (range) or as number of patients aCatecholamines: an infusion of dopamine, dobutamine, noradrenaline, or adrenaline bInsulin: ... 1.83 l and the rate of disappearance of glucose from plasma was 0.069 ± 0.018 Bland–Altman plots of the differences between each approximated IDVG and original IDVG are shown in Fig There was a close ... (1.27–2.14) Number of patients receiving mechanical ventilation 26 Number of patients receiving catecholaminesa 14 Number of patients receiving insulinb Number of patients receiving on continuous haemodiafiltration...

6
286
0

Báo cáo y học: "Can choices between alternative hip prostheses be evidence based? a review of the economic evaluation literature" ppsx

Ngày tải lên : 13/08/2014, 11:22

... data; the data are then extrapolated over 60 years While survival is a useful measure of health gain, QALYs have the advantage that they combine length of survival with quality of life Thus they ... May 2010); The Cochrane Library (Issue 5, 2010): The Cochrane Database of Systematic Reviews; Database of Abstracts of Reviews of Effects (DARE) and Health Technology Assessment (HTA) database; ... different states of health and the representation of different pathways of care); source of values to inform parameter and parameter precision (uncertainty around the mean health and cost inputs...

10
258
0

Báo cáo y học: "Malaria control in Timor-Leste during a period of political instability: what lessons can be learned" docx

Ngày tải lên : 13/08/2014, 13:21

... Democratic Republic of Congo [8] in which malaria cases increased by 3.5-fold compared with the situation before the war Significant increases in the national burden of malaria cases have also been ... prescribed the use of RDT and ACT in malaria control in Timor-Leste ACT has been shown to be effective in treating drug-resistant falciparum and vivax malaria in Papua, Indonesia [27] It has been ... beyond the IDPs alone, and adequate resources and expertise should be made available to assure a whole-ofcity approach Research should be advocated to improve malaria control in both normal and...

10
292
0

Thuyết trình tài chính quốc tế CAN CENTRAL BANKS’ MONETARY POLICY BE DESCRIBED BY A LINEAR (AUGMENTED) TAYLOR RULE OR BY A NONLINEAR RULE

Ngày tải lên : 21/06/2015, 23:44

... NHTW Canada Anh PHẦN PHẦN PHẦN PHẦN PHẦN Các nghiên cứu có liên quan Fendel Frenkel (2006) & Surico (2007) xem xét vai tròn cung tiền ECB Cecchetti cộng (2000), Borio Lowe (2002), Goodhart Hofmann ... spead futures interest rate spead Biến credit spread xem báo tốt cho chu kỳ kinh doanh căng thẳng tài chính, thay đổi mức chênh lệch lãi suất (interest rate spread) hợp đồng tương lai báo độ dao ... thi sách tiền tệ Fourcans Vranceanu (2004) đ a số chứng cho thấy ECB có phản ứng tỷ giá hối đoái lệch so với mức trung bình Chadha cộng (2004) đ a kết tương tự cho FED, NHTW Anh NHTW Nhật Lubik...

63
928
13