persistence of melanocytic lesions at the site of a previous incomplete excision recurrent nevi recurrent melanoma

Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

Ngày tải lên : 26/10/2012, 09:53

... cementation has the disadvantage in comparison with the partial cementation that all cement debris have to be removed from the femoral canal during the later prosthesis reimplantation, and that ... be avoided (Figure 1) Alterna- 275 tively, a partial (Figure 2) or normal cementation of the spacer into the femoral canal provides the advantage of rotational and axial stability [3] A normal ... there are no clinical data available that have demonstrated that the insertion of a metallic endoskeleton significantly improves the mechanical properties of hip spacers or reduces the rate of...

6
455
0

Báo cáo y học: "Natural history and clinical significance of MRI-detected bone marrow lesions at the knee: a prospective study in community dwelling older adults" pot

Ngày tải lên : 12/08/2014, 15:22

... to the fact that much of the data is clumped at zero because BMLs were measured at four separate sites and the majority of participants who had a BML present had it at only one of the four sites ... (University of Geneva, Geneva, Switzerland) and were defined as areas of increased signal adjacent to the subcortical bone at the medial tibial, medial femoral, lateral tibial, and lateral femoral sites ... revised the manuscript TW participated in interpretation of the data, and critically revised the manuscript GZ carried out data collection, participated in interpretation of the data, and critically...

12
333
0

Báo cáo y học: " Compression of the radial nerve at the elbow by a ganglion: two case reports" pot

Ngày tải lên : 11/08/2014, 17:21

... morphology of the cystic lesion (arrows), which is located directly anterior to the anterior aspect of the radial head (B) Axial, T2W image at the level of the radial head demonstrates a lobulated ... of the cause of the palsy and further determination of the location of the entrapment in the radial tunnel are important Our first case experienced lateral forearm pain that is initially often ... branch against the arcade of Frohse and the superficial branch against the extensor carpi radialis muscle (Figure 3) Yamazaki et al reported 14 patients presenting Figure Diagrammatic view of the...

4
245
0

Báo cáo y học: "Influence of genetic variability at the surfactant proteins A and D in community-acquired pneumonia: a prospective, observational, genetic study" pot

Ngày tải lên : 14/08/2014, 07:21

... comparisons A dominant effect of SFTPA2 aa9 -A, and a recessive effect of SFTPA1 aa50-G and aa219-C as well as SFTPA2 aa223-C were associated with a lower risk of CAP (see Table 1) Table Comparison of ... 1A1 0 and 6A- 1A, and a lower frequency of the major SFTPA1aa19-T and aa219-C alleles and of haplotypes 6A3 and 6A3 - 1A1 (see Table 4) Similar results were observed when 90-day mortality was analyzed ... Hospital Universitario de Gran Canaria Dr Negrớn, Barranco de la Ballena s/n, Las Palmas de Gran Canaria, 35010, Spain Department of Respiratory Diseases, Hospital Universitario de Gran Canaria Dr...

12
278
0

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Ngày tải lên : 20/02/2014, 23:20

... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were ... by addition of 14Clabelled pyruvate (1 lCi, about 60 nmol) after the assay mix had been incubated for 10 at 25 °C PDH assay This measures the rate of formation of NADH at 340 nm and 30 °C after...

10
459
0

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Ngày tải lên : 06/03/2014, 00:20

... Molnes et al ATP binding at active site of human glucokinase Table The kinetic constants for WT GST–hGK at high and low concentrations of the ﬁxed substrate The catalytic activity was measured at 37 ... nm at a constant heating rate of 40 °CÆh)1 The midpoint of the transition (Tm) was determined from the ﬁrst derivative of the smoothed denaturation curve The associated high-voltage (pseudoabsorbance) ... (mutated nucleotides are underlined): T228M forward, 5¢-GC ATG ATC GTG GGC ATG GGC TG C AAT GCC TGC 3¢; T228 reverse, 5¢-GCA GGC ATT GCA GCC CAT GCC CAC GAT CAT GC-3¢; L146R forward, 5¢-CAC AAG AAG...

15
374
0

Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

Ngày tải lên : 07/03/2014, 11:20

... GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... eryngii is a monomeric glycoprotein of 70 kDa with dissociable ﬂavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols...

11
471
0

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Ngày tải lên : 15/03/2014, 23:20

... mutations were (positions of mismatches underlined): F14 4A: 5¢-CAA AAT GGG GCT GAC AAC TCC-3¢; F144Y: 5¢-CAA AAT GGG TAT GAC AAC TCC-3¢; F22 9A: 5¢-CAC GAT GCT GCC CAA GTC TTT-3¢; F25 8A: 5¢-TAC ... Initially, this appears to be an example of convergent evolution towards aromatic triads that can accommodate the twists speciﬁcally associated with b-1,3-glucan polymers The nature of the aromatic ... implications for substrate speciﬁcity and catalysis J Mol Biol 321, 149–162 Haga K, Kanai R, Sakamoto O, Aoyagi M, Harata K & Yamane K (2003) Effects of essential carbohydrate ⁄ aromatic stacking...

13
498
0

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Ngày tải lên : 16/03/2014, 01:20

... [16], as are the calculations of Galabov et al concerning the energetics of the alkaline hydrolysis of N-phenylacetamides [19] The investigation of Perakyla et al on the catalytic reaction of AGA, ... distribution of the real substrates and PGA active site In order to interpret the biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the tetrahedral ... substrate, and the phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active...

10
425
0

Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

Ngày tải lên : 17/03/2014, 09:20

... L-Phe at half-maximum saturation ([S]0.5) of 98 lM (Fig 2A, B) Saturation was reached at approximately mM with a DRU-value of 75 RU/(pmol subunitặmm)2) Simultaneous injection of L-Phe (variable ... conformational states include a ground state for the ligand-free enzyme, an activated state with bound substrate (L-Phe), an inhibited state with bound H4biopterin and nally the state of catalytic ... the reduction of the active site iron in addition to its binding at the catalytic site as part of a catalytically active ternary complex Based on the crystal 3.0 structure of a ligand-free dimeric...

10
470
0

Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

Ngày tải lên : 17/03/2014, 17:20

... propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic carboxylate of propionate CoA-transferase As the sequence analysis did not allow an unequivocal ... glutamate 324, which led us to conclude that this residue is the active site carboxylate The proteins most similar to propionate CoA-transferase in the databases are a putative acetoacetate CoAtransferase ... unequivocal identi®cation of the catalytic glutamate of propionate CoAtransferase, this residue was speci®cally labelled The thiol ester in the proposed enzyme-CoA intermediate of the CoAtransferase...

9
498
0

Báo cáo khoa học: Roles of adenine anchoring and ion pairing at the coenzyme B12-binding site in diol dehydratase catalysis pptx

Ngày tải lên : 23/03/2014, 06:20

... Sa224N, 5¢-ggcatccagtcgagaggcaccacggtgatc-3¢ for Kb135R, 5¢-ggcatccagtcggcaggcaccacggtgatc-3¢ for Kb13 5A, 5¢-ggcatc cagtcgcaaggcaccacggtgatc-3¢ for Kb135Q, and 5¢-gcatc cagtcggaaggcaccacggtgatc-3¢ ... suggesting that the oxidation of cob(II)alamin accompanies the inactivation of the Kb13 5A holoenzyme during catalysis Upon denaturation of the complex after 30 of incubation, the spectrum of enzyme-bound ... adenosyl group of AdoCbl in inactivation of a mutant holoenzyme during catalysis To study the fate of the adenosyl group, the upper axial ligand of AdoCbl, in the inactivation of the Sa22 4A holoenzyme...

13
380
0

Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

Ngày tải lên : 23/03/2014, 21:20

... GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC Table Micro-organisms and plasmids ... strand of the ribA Designation Primer orientation MF BamH1rev P-C54S-f P-C54S-r P-C65S-f P-C65S-r P-C67S-f P-C67S-r + – + – + – + – Sequence ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG ... in the light of the rapid progression of resistance development in all microbial pathogens In contrast with the riboﬂavin biosynthetic pathway, the dihydrofolate pathway was already validated as...

7
367
0

Báo cáo Y học: Identiﬁcation of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt

Ngày tải lên : 24/03/2014, 04:21

... -glyceraldehyde-3-phosphate (GraP ) The reaction was started by the addition of an appropriate amount of a solution of GraP containing the requisite amount (0.5 mmol) of GraP The aqueous solution of ... GraP was prepared from the water insuluble barium salt of D ,L -glyceraldehyde3-phosphate diethylacetal and the amount of GraP present was measured enzymatically [10] The enzyme was also assayed ... of a lysine residue speciﬁcally at the active site of the enzyme of normal sources Moreover, preliminary evidence has indicated that the catalytic properties of Gra3P DH of normal cells and a...

8
283
0

Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx

Ngày tải lên : 30/03/2014, 20:20

... lipid/detergent molar ratio Due to dispersion of the data for the same sample we conclude that an average value of 110 ± 25 nm can be 37 assumed as a reasonable estimate of the liposomes radius The measurements ... purchased from association and dissociation (quinone exchange), both in the dark and in Avanti Polar Lipids Inc., Alabaster, AL, USA), and the charge separated state The constants in the scheme are ... chromatophores, where quinone can freely diffuse towards and away from the enzyme, and the large volume of the bilayer allows the accommodation a large number of ligands; (b) the arrangement of the...

11
365
0

Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Ngày tải lên : 31/03/2014, 07:20

... subjects (CA genotype) was PCR ampliﬁed using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) ... demonstrate that the )1C A mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects b2GPI plasma levels ... polymerase (Stratagene, La Jolla, CA, USA) to eliminate the possibility of PCRinduced mutations The reactions were then denatured at 95 °C for and gradually reannealed by decreasing the temperature...

9
462
0

color atlas of melanocytic lesions of the skin - h. soyer, et al., (springer, 2007)

Ngày tải lên : 12/05/2014, 17:23

... Ferrara G, Argenziano G Limitations of histopathologic analysis in the recognition of melanoma: a plea for a combined diagnostic approach of histopathologic and dermoscopic evaluation Arch Dermatol ... surfaces of body, all demarcated areas (shaded and unshaded) are photographed On lateral aspects of body, only shaded areas are photographed Clinical Examination of Melanocytic Neoplasms C Chapter ... simulating balloon cell melanoma Combined nevi can be distinguished from melanoma by the absence of features of melanoma in situ in the intraepidermal portion of the neoplasm, the maturation of...

348
3.8K
0

Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modiﬁed by liming and experimental acidiﬁcation at the Höglwald site, Germany, from 1982 to 2004" pdf

Ngày tải lên : 07/08/2014, 16:20

... Element Year Age class A1 B1 C1 A2 B2 P 2004 C a ab a ab ab b C+1 a ab a b ab ab ab b C+2 a ab a b Ca 1990, 1997 C ab b ab a Mg 1990 C ab ab b C2 a b Mn C a ab a C+1 ab ab ab b ab a C+2 Al 1990 ... our data show that the high year to year variations have to be considered when interpreting needle data, and a lot of repeated estimations are needed to show a real time trend The K concentrations ... C., Weis W., Baumgarten M., Gửttlein A. , Spatial and temporal variation of seepage water chemistry after femel and small scale clear-cutting in a N-saturated Norway spruce stand, Plant Soil 267...

9
286
0

Báo cáo khoa học: "The synchronous occurrence of squamous cell carcinoma and gastrointestinal stromal tumor (GIST) at esophageal site" ppsx

Ngày tải lên : 09/08/2014, 07:22

... study and collect the clinical data AZ participated in the design of the study and collect the clinical data FZ participated in the design of the study and collect the clinical data GCP participated ... drafting FT participated in the design of the study and collect the clinical data LR participated in the design of the study and collect the clinical data GP participated in the design of the ... 152(5):1259-1269 Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G, Matsuzawa Y, Kanakura Y, Shinomura Y, Kitamura Y: Gain -of- function...

5
228
0

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Ngày tải lên : 12/08/2014, 04:21

... GAT ATC TTCA AAG T gill chlamydia Sch-probe TCC TTC GGG ACC TTA C Sch-R CCC ATG AGC CGC TCT CTC T Elongation factor EL 1A- elaf CCC CTC CAG GAC GTT TAC AAA alpha EL 1A- elam1 ATC GGT GGT ATT GGA AC ... ATG GTA TAG theridion Amplicon size GGT CCA GGT TGG GTC TTG AG Flavobacterium Flavo-R Flavo-probe AAA CAC TCG GTC GTG ACC Candidatus Flavo-F Pch-F Pch-probe CAA AAC TGC TAG ACT AGA GT salmonis ... GAT CCT TAT TCT CAC AGT ACC GTC AA TCA CCC CCA GGC TGC TT Piscichlamydia [49] TGT AAA CTG CTT TTG CAC AGG AA psychrophilum 59 nt GAA TTC CAT TTC CCC CTC TTG New species of Sch-F GGG TAG CCC GAT...

15
252
0