a new term describing the global survey of the overall sperm function by the combined utilization of immunocytochemistry metabolomics proteomics and other classical analytical techniques

APPLICATIONS OF IMMUNOCYTOCHEMISTRY pot

Ngày tải lên : 28/06/2014, 08:20

... Early Mammalian Embryos Hesam Dehghani 161 Chapter Spermiomics: A New Term Describing the Global Survey of the Overall Sperm Function by the Combined Utilization of Immunocytochemistry, Metabolomics, ... Immunocytochemical Approach 249 Alejandra Kun, Gonzalo Rosso, Luc a Canclini, Mariana Bresque, Carlos Romeo, Karina Cal, Aldo Calliari, Alicia Hanuz, José Roberto Sotelo-Silveira and José Roberto Sotelo Chapter ... number of species, a wide, versatile range of secondary antibodies are available to detect any primary antibody An additional advantage of using secondary antibodies is that several secondary antibody...

330
233
1

Tài liệu Báo cáo khoa học: Post-translational modiﬁcations of the linker histone variants and their association with cell mechanisms docx

Ngày tải lên : 18/02/2014, 08:20

... A A A P – pS P P P P A A – P A S A A A P A A A A A A A mK K K K K aK – A A A A A A A K K K K K K amK A A P A A A R K K K K K K pS A A A A A A pS T T T T T T T K K K K K K A K K K K K K K K K K ... human and mouse were taken from [43], and the data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS A A A A A A A A A A A P ... variation acting as a marker for a particular phenotype However, the main aim of Sarg et al [34] was to demonstrate the use of a particular chromatography technique, rather than to ﬁrmly establish...

13
633
0

báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt

Ngày tải lên : 11/08/2014, 00:22

... ZC and NG synthesized nanoparticles; YL, YH and JW performed the cell labeling and the animal studies; YH, YL, ZC, NG and JW wrote the manuscript All authors read and approved the final manuscript ... tracked by the IRDy800CW labels and the small animal NIRF-imaging system, Pearl Image NIRF imaging of the mouse also clearly revealed that the intensity of signal in the liver region and kidneys was ... biodegradability of superparamagnetic core-shell nanoparticles Biomaterials 2010, 31:1316-1324 19 Hatanaka S, Matsushita N, Abe M, Nishimura K, Hasegawa M, Handa H: Direct immobilization of fluorescent...

14
399
0

Intein mediated generation of n terminal cysteine proteins and their applications in live cell bioimaging and protein microarray

Ngày tải lên : 08/11/2015, 16:30

... TCC AAC TGC AGA GCC atg tcc cct ata cta- 3’ 5’-GGT GGT CTG CAG tca gtc acg atg cgg-3’ 19 pT-Rex-DEST30-intein/EGFP 5’-GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GCT ATC ... lyophilized and then desalted through a NAP-5 column (Amersham Pharmacia, USA) Each step of the purification was analyzed by 12% SDS-PAGE and the identity of eluted proteins were confirmed by Western ... Inteins have been found in organisms from eubacteria, archaea, and eucarya, as well as in viral and phage proteins They are predominantly found in enzymes involved in DNA replication and repair Inteins...

77
200
0

Aspects of carbohydrate quality and their relevance for risk markers of type 2 diabetes and related health outcomes

Ngày tải lên : 25/11/2015, 14:52

... (HOMA-IR), alanine-aminotransferase (ALT), and gamma-glutamyltransferase (GGT) in a subsample of the DONALD Study (n=226 and n=214, respectively) In Study III, again based on data from the DONALD ... indicated a prevalence of 7.2% among adults aged between 18 and 79 years with an additional 2.1% of undiagnosed cases [65] Compared to data from the German National Health Interview and Examination Survey ... with the Australian data and that I am now spending a research fellowship at the University of Sydney Special thanks go to Dr Christian Herder, Head Inflammation Workgroup at the German Diabetes...

203
431
0

GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

Ngày tải lên : 28/08/2013, 11:59

... concentration (CO) and total number of spermatozoon in ejaculate (NT), rate of abnormal spermatozoon (R) and pH of semen (pH) VOL was determined using a graduated cylinder CO was estimated by using ... performance evaluation started at months (60 days) of age and ended on 7.5 months (225 days) of age The animals were weighted using an electronic balance at starting (BW60) and ending (BW225) dates ... PiCC and PiCT) considered as a fixed effect Since the measurements could not be realized exactly at months and 7.5 months of age, actual ages of animals (days) at measurement were added in the...

6
734
0

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Ngày tải lên : 05/09/2013, 10:17

... the area around the Seto Inland Sea has a small amount of rainfall with a comparatively warm climate, the cultivation of citrus fruits is popular The ratio of the citrus groves to the total land ... uptake and transition to the bottom due to the increase of pH Other materials, such as heavy metals, were similar, and their concentration decreased at the reservoir Water quality of the leachate ... was surveyed in detail and material balances around reservoirs were considered RESEARCH PROCEDURE Location: Matsuyama region and periphery of the Seto Inland Sea The location of the research area...

10
717
0

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Ngày tải lên : 26/11/2013, 13:17

... find out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic features and making a contrastive analysis to ... the analysis of ESVs and VSVs in terms of the syntactic and semantic features The analysis results of the ESVs and VSVs will be compared and contrasted in order to find out the similarities and ... What are the syntactic and semantic features of SVs in English and Vietnamese? What are the similarities and differences of SVs in English and Vietnamese? What are some implications for teaching...

13
1.3K
5

A study of semantic and syntactic features of english famous love sayings and their vietnamese translation

Ngày tải lên : 26/11/2013, 13:21

... beliefs, arts, morals, law, custom, and any other capabilities, and habits acquired by man as a member of a society” ♦ Relation of Culture and Language The relationship between language and culture are ... Implications for Teaching and Learning EFLSs and Their Vietnamese Translation As mentioned, the findings of this thesis are the syntactic and semantic features of EFLSs and their Vietnamese translation ... this chapter This chapter is a basis so that we could analyze and compare the syntactic and semantic features of EFLSs and their Vietnamese translation in the next chapter CHAPTER METHOD AND PROCEDURE...

26
1.2K
3

Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx

Ngày tải lên : 16/02/2014, 02:20

... 2.5 Factor analysis of the sample We apply factor analysis to evaluate the extent of common variation across CDS, bond spreads and the basis Table 4a shows the proportion of the total variance ... variables and the corresponding signs that we expect for the respective estimates of the parameters The effects of the factors are evaluated by means of a standard panel regression approach using ... before the peak of the crisis in fall 2008 Since the start of the crisis, with a dramatic re-pricing of risk, for Germany, France, the Netherlands, Austria and Belgium the cash market has a predominant...

49
1.5K
0

Tài liệu Báo cáo khoa học: Identiﬁcation of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Ngày tải lên : 20/02/2014, 01:20

... yef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAA ATGAAAACTGATAGATTACTG AGAAAGCTGGGTGGATTGCAAAATGAGCCTGAC ACAAGTTTGTACAAAAAAGCAGGCT ACCACTTTGTACAAGAAAGCTGGGT CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC ... TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG CGTTATGAAAATCACTATTATCCCC AAAAGCTTAGATTGCAAAATGAGCCTGACGA ... ATGCGTACGCTGCAGGTCGAC GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG...

13
560
0

Tài liệu Báo cáo khoa học: Localization of N-linked carbohydrate chains in glycoprotein ZPA of the bovine egg zona pellucida pptx

Ngày tải lên : 21/02/2014, 03:20

... position of the acidic fraction was the same as that of the monosialylated chain, and all the acidic chains in this fraction were neutralized by sialidase digestion From the peak area, the molar ratios ... from ovarian eggs The molecular masses of the N- and C-terminal fragments of the endo-b-Galactosidase-digested ZPA are 21 and 63 kDa, respectively [12], and the time course of the N-glycanase (glycopeptidase ... [10] and these active chains are mainly localized in the N-terminal region of the ZP domain of ZPB and the C-terminal region of the ZP domain of ZPC (Fig 5) In Molar ratio the cow, ZPB exhibits the...

10
514
0

Tài liệu An International Comparison of Milk Supply Control Programs and Their Impacts pot

Ngày tải lên : 22/02/2014, 05:20

... The US and New Zealand have both significantly increased their share of the world market, while the EU and Canadian shares have been declining Australia’s share has also declined, but that has ... This means that the remaining farms are more than making up for the production lost by outgoing farms The compound average growth rate (CAGR) in the EU, Canada, and New Zealand are almost exactly ... EU and Canada and created an economic incentive for imports o Slow domestic and export growth has pushed Canadian and European processors to invest and expand in the US and other countries o Canadian...

83
436
0

Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

Ngày tải lên : 07/03/2014, 21:20

... R&R Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial ... Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component in horseshoe crab hemocytes, is an antimicrobial ... (Stratagene, La Jolla, CA, USA) and subjected to DNA sequence analysis [62] Rapid ampliﬁcation of cDNA ends (RACE) Analysis by 5¢- and 3¢-RACE was performed using a SMARTTM RACE cDNA ampliﬁcation...

13
582
0

Báo cáo khoa học: Identiﬁcation of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx

Ngày tải lên : 08/03/2014, 10:20

... TCGGCAGCACTACATTGTCAAC-3¢; ES3 5¢- GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ and for AY034877 5¢-AGGCCCAGGAACACAGGGATTCC-3¢ The speciﬁcity of oligonucleotides ... carboxylesterase protein band that was separated by preparative and analytical nondenaturing PAGE was characterized by the LC/ESI-MS methods Bands were cut out of the analytical nondenaturing gel, digested ... stained for activity and the activity bands for corresponding peaks are labeled with arrows In this gel, peak appeared as a doublet (band a and b) Each peak was further separated on nondenaturing...

12
439
0

Polymer assisted synthesis of aligned amorphous silicon nanowires and their core shell structures with au nanoparticles

Ngày tải lên : 16/03/2014, 15:06

... will lead to a large amount of carbon nanoparticles having high chemical activity The growth of SiNWs may start from the reaction of the active carbon nanoparticles with the native oxide layer ... dispersed Au nanoparticles were obtained by heating them upto 300 °C at a rate of °C/ and keeping them at that temperature for h under Ar atmosphere in a seal pyrolysis quartz tube The morphology and ... of them are straight and have a smooth surface Fig 3b shows a TEM image of individual curly wire with the average diameter of 400 nm, revealing the typical structure of wire-like spherical particle...

5
467
0

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

Ngày tải lên : 19/03/2014, 16:48

... Correspondingly, there are an endothermic peak and an exothermic peak on the DTA curve which may be ascribed to the removal of the structural water molecules and the crystallization process of R-Fe2O3, ... Information) At a shorter reaction time of only min, there are almost no nanorods formed, and the average diameter of the nanoparticles is about nm As the reaction time increased to 10 min, part of ... micrographs of the as-prepared R-FeOOH sample, respectively The images clearly demonstrate that the sample has a smooth, rodlike morphology with average diameter of about 10-15 nm and a length of about...

5
458
1

BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

Ngày tải lên : 22/03/2014, 21:20

... general analytical strategy in order to determine what to analyse and why And the researcher’s further claim that before the data is actually analysed, investigator can choose between two analytical ... qualitative and quantitative this would be explained first followed by the reasons of this study’s approach Qualitative and Quantitative The research approach can be either qualitative or quantitative The ... flows of activity: Data reduction, data display and conclusion drawing and verification Data reduction is often done to sort, focus, discard and organize the data in a way that leads to final conclusions...

73
710
0

Báo cáo khoa học: Identiﬁcation of rice TUBBY-like genes and their evolution Qingpo Liu docx

Ngày tải lên : 23/03/2014, 07:20

... Aa, Aedes aegypti; Ag, Anopheles gambiae; Am, Apis mellifera; At, Arabidopsis thaliana; Bt, Bos taurus; Ca, Cicer arietinum; Cb, Caenorhabditis briggsae; Ce, Caenorhabditis elegans; Cf, Canis familiaris; ... was observed that the chemical properties of the amino acid at site 317 were signiﬁcantly different between plant and animal tubby domains In plants, the amino acid at site 317 was the invariant ... phosphates Boggon et al [8] observed a groove of highly positive charge that was bordered at the top by helix H8 and at the bottom by the large 7–8 loop and the threestranded ‘extra’ 9ABC sheet The...

9
381
0

báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx

Ngày tải lên : 18/06/2014, 18:20

6
449
0