Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae Feng Shi 1,2 , Shigeyuki Kawai 1 , Shigetarou Mori 1 , Emi Kono 1 and Kousaku Murata 1 1 Department of Basic and Applied Molecular Biotechnology, Division of Food and Biological Science, Graduate School of Agriculture, Kyoto University, Uji, Kyoto, Japan 2 School of Biotechnology, Southern Yangtze University, Wuxi, Jiangsu, China The genomic DNA sequence of the widely studied yeast Saccharomyces cerevisiae, which is a model organism for eukaryotic cells, contains three NAD kin- ase homologues, namely, Utr1p, Pos5p and Yel041wp [1–3]. NAD kinase (EC 2.7.1.23) catalyses NAD phos- phorylation by using phosphoryl donors (ATP or inor- ganic polyphosphate [poly(P)]), constituting the last step of the NADP biosynthetic pathway [4,5]. For the Keywords ATP-NADH kinase; Pos5p; Saccharomyces cerevisiae; Utr1p; Yef1p Correspondence K. Murata, Department of Basic and Applied Molecular Biotechnology, Division of Food and Biological Science, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan Fax: +81 774 38 3767 Tel: +81 774 38 3766 E-mail: kmurata@kais.kyoto-u.ac.jp (Received 23 August 2004, revised 25 April 2005, accepted 3 May 2005) doi:10.1111/j.1742-4658.2005.04749.x ATP-NAD kinase phosphorylates NAD to produce NADP by using ATP, whereas ATP-NADH kinase phosphorylates both NAD and NADH. Three NAD kinase homologues, namely, ATP-NAD kinase (Utr1p), ATP-NADH kinase (Pos5p) and function-unknown Yel041wp (Yef1p), are found in the yeast Saccharomyces cerevisiae. In this study, Yef1p was identified as an ATP-NADH kinase. The ATP-NADH kinase activity of Utr1p was also confirmed. Thus, the three NAD kinase homologues were biochemically identified as ATP-NADH kinases. The phenotypic analysis of the single, double and triple mutants, which was unexpectedly found to be viable, for UTR1, YEF1 and POS5 demonstrated the critical contribution of Pos5p to mitochondrial function and survival at 37 °C and the critical contribution of Utr1p to growth in low iron medium. The contributions of the other two enzymes were also demonstrated; however, these were observed only in the absence of the critical contributor, which was supported by comple- mentation for some pos5 phenotypes by the overexpression of UTR1 and YEF1. The viability of the triple mutant suggested that a ‘novel’ enzyme, whose primary structure is different from those of all known NAD and NADH kinases, probably catalyses the formation of cytosolic NADP in S. cerevisiae. Finally, we found that LEU2 of Candida glabrata, encoding b-isopropylmalate dehydrogenase and being used to construct the triple mutant, complemented some pos5 phenotypes; however, overexpression of LEU2 of S. cerevisiae did not. The complementation was putatively attri- buted to an ability of Leu2p of C. glabrata to use NADP as a coenzyme and to supply NADPH. Abbreviations CgLEU2, LEU2 of yeast Candida glabrata; FOA, 5-fluoroorotic acid; GFP, green fluorescent protein; KNDE, 10 m M potassium phosphate, pH 7.0, containing 0.1 m M NAD, 0.5 mM dithiothreitol and 1.0 mM EDTA; poly(P), inorganic polyphosphate; ScLEU2, LEU2 of yeast Saccharomyces cerevisiae; SD, synthetic dextrose; SG, synthetic glycerol; SD+FOA+Ura, synthetic dextrose ⁄ 5-fluoroorotic acid ⁄ uracil; WT, wild type; YPD, yeast extract ⁄ peptone ⁄ dextrose; YPG, yeast extract ⁄ peptone ⁄ glycerol. FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3337 phosphoryl donor, the enzyme using ATP and poly(P) is termed poly(P) ⁄ ATP-NAD kinase [4] and that using ATP, but not poly(P), is termed ATP-NAD kinase [6]. For the phosphoryl acceptor, the enzyme specific to NAD is designated NAD kinase and that phosphory- lating both NAD and NADH is NADH kinase (EC 2.7.1.86) [2,3,7]. Utr1p, which was initially identified as an ATP- NAD kinase, was proposed to participate in the ferri- reductase system [1,8]. It was required for the reduc- tion of extracellular ferric chelates to their ferrous counterparts and for the uptake of extracellular iron. This system consists of three components, namely, Fre1p, NADH dehydrogenase and Utr1p. Utr1p was proposed to contribute to the system by supplying NADP [1,8]. However, the NADH kinase activity of Utr1p has not yet been reported [1]. Pos5p was iden- tified as an ATP-NADH kinase; it was shown to be localized in the mitochondrial matrix and to be important to several NADPH-requisite mitochondrial processes, e.g. resistance to a broad range of oxida- tive stress, respiration, arginine biosynthesis, mito- chondrial iron homeostasis and mitochondrial DNA stability [2,3]. The pos5 cell exhibits poor growth in the presence of oxidative damage, glycerol as the sole carbon source and in a medium lacking arginine [2]. This mutant accumulates high mitochondrial iron and is defective in the mitochondrial Fe–S cluster-contain- ing enzymes [2]. The disruption of POS5 increases frame-shift mutations in the mitochondrial DNA [3]. However, the function of Yel041wp remains unidenti- fied. Although Pos5p is believed to play a significant role in NADPH biosynthesis in mitochondria [2,3], the con- tribution of Yel041wp and Utr1p to cellular function and the precise function of Yel041wp is yet to be clar- ified. In the cytosol, NADPH is mainly supplied from NADP by NADP-dependent glucose-6-phosphate dehydrogenase (EC 1.1.1.49) (Zwf1p) [9–11]. Cytosolic NADPH is required for methionine biosynthesis [2,10]. The zwf1 cell is methionine auxotrophic due to the depletion of NADPH [2,9–11], but is not arginine auxotrophic, whereas the pos5 cell exhibits arginine auxotrophy, but not methionine auxotrophy [2], thereby suggesting that NADPH is synthesized in the cytosol, separate from the mitochondria [2]. In this study, we identified the functions of Yel041wp (designated as Yef1p) and Utr1p as ATP- NADH kinases. We also examined the phenotypes of single and double mutants, as well as the triple mutant, which was unexpectedly viable, for UTR1, YEF1 and POS5 and attempted to clarify the roles of these three enzymes. Results Identification of Yel041wp (Yef1p) as ATP-NAD kinase First, we attempted to identify the function of Yel041wp. We referred to Yel041wp as ‘Yef1p’ based on the designation of this protein in the SWISS-PROT database (http://www.genome.ad.jp/dbget-bin/www_ bfind?sptrembl). YEF1 consists of 1488 nucleotides encoding a polypeptide of 496 amino acid residues with a calculated molecular mass of 55.9 kDa and a calculated pI of 5.46. The YEF1 locus on genomic DNA does not contain introns. YEF1 was expressed in Escherichia coli as a fusion recombinant protein with a V5 epitope and His 6 tag at the C terminus. The fusion protein, referred to as Yef1p, consisted of 533 amino acid residues and exhib- ited the calculated molecular mass of 60.1 kDa. The cell extract of E. coli MK746 expressing YEF1 showed 0.078 UÆmg )1 ATP-NAD kinase activity, while that of control strain SK45 carrying vector alone exhibited an activity of 0.00086 UÆmg )1 . When metaphosphate and polyphosphate were used at 1.0 mgÆmL )1 as poly(P) instead of ATP, no NAD kinase activity was detected, thereby suggesting that Yef1p is indeed an ATP-NAD kinase. Yef1p was purified to homogeneity from the cell extract of MK746 (Table 1). The purified enzyme migrated as a single protein band corresponding to 60 kDa on SDS ⁄ PAGE (Fig. 1A) and was eluted as a single peak, consisting of a protein of  480 kDa on gel filtration chromatography (Fig. 1B), thereby indicating that the enzyme was a homooctamer composed of 60- kDa subunits. ATP and other nucleoside triphosphates (especially dATP) at 5 mm were utilized by Yef1p as phosphoryl donors as follows: nucleoside triphosphates, relative activity: ATP, 100%; dATP, 91%; CTP, 43%; UTP, 14%; GTP, 13%; TTP, 6%. Poly(P)s (pyrophos- phate, tripolyphosphate and trimetaphosphate at 5 mm and polyphosphate, metaphosphate and hexametaphos- phate at 1 mgÆmL )1 ) and phosphorylated compounds (phosphocreatine, glucose-6-phosphate and phospho- Table 1. Purification of Yef1p. Total protein (mg) Total activity (U) Yield (%) Specific activity (UÆmg )1 ) Purification (fold) Cell extract 2808 218 100 0.078 1 DEAE–Toyopearl 331 205 94 0.619 8.0 Butyl-Toyopearl 15.1 13.4 6.1 0.886 11.4 Ni–chelate AF Toyopearl 0.9 8.5 3.9 9.475 122 Saccharomyces cerevisiae NADH kinases F. Shi et al. 3338 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS enolpyruvate at 5 mm) were not utilized, thereby indi- cating that Yef1p was an ATP-NAD kinase. K m for NAD and ATP were 1.9 mm and 0.17 mm, respectively. Properties of Yef1p and identification of Yef1p and Utr1p as ATP-NADH kinases The enzyme had an optimum pH of 8.5 in Tris ⁄ HCl (Fig. 2A), the optimal temperature was 45 °C (Fig. 2B) and half of its activity was lost on treatment at 54 °C for 10 min (Fig. 2C). Bivalent metal ions such as Mg 2+ , Mn 2+ ,Co 2+ and Ca 2+ were indispensable for ATP- NAD kinase activity. In the presence of 1 mm metal ions, the ATP-NAD kinase activity was as follows. Metal ions, relative activity: Mg 2+ , 100%; Mn 2+ , 77%; Co 2+ , 32%, Ca 2+ , 26%. On the other hand, no activity was detected in the presence of 1 mm Zn 2+ ,Fe 2+ , Cu 2+ , and monovalent metal ions (Na + and Li + ). NADPH and NADH slightly inhibited Yef1p; however, NADP and intermediates involved in NAD biosynthesis (nicotinic acid mononucleotide, nicotinic acid adenine dinucleotide, nicotinic acid and quinolinic acid) did not inhibit Yef1p (Table 2). HgCl 2 inhibited enzyme activity (Table 2), thereby indicating the importance of the SH group of the enzyme for its catalytic activity. We also found that Yef1p exhibited NADH kinase activity in the presence of ATP, but not poly(P) (1 mgÆmL )1 metaphosphate). On assaying the NADH kinase activity of purified Utr1p [1], a similar result was obtained. K m for NADH of Yef1p was 2.0 mm AB Fig. 1. Molecular mass of Yef1p. (A) SDS ⁄ PAGE of Yef1p. Lane 1, protein markers (Bio-Rad); lane 2, purified enzyme (1.5 lg). (B) Gel filtration of Yef1p. Purified Yef1p was loaded on a Superdex 200 pg column and was eluted as described in Experimen- tal procedures. The arrow (s) indicates the elution volume (Ve) of the purified Yef1p. Protein standards (d) were as follows: (a) blue dextran 2000 (2000 kDa); (b) tyroglobulin (669 kDa); (c) ferritin (440 kDa); (d) catalase (232 kDa); (e) BSA (67 kDa); (f) ovalbumin (43 kDa); and (g) chymotry- psinogen A (25 kDa). Fig. 2. Effect of pH and temperature on Yef1p activity and stability. (A) Effect of pH on ATP-NAD kinase activity. NAD kinase activity was assayed by the stop method as described in Experimental procedures by using potassium phosphate (r), Tris ⁄ HCl ( ) and glycine ⁄ NaOH (m). Activity in the presence of Tris ⁄ HCl (pH 8.5) was taken relatively as 100%. (B) Effect of temperature on ATP-NAD kinase activity. NAD kinase activity was assayed by the stop method as described in Experimental procedures at indicated temperatures. The activity at 45 °C was taken relatively as 100%. (C) Effect of temperature on the stability of Yef1p. Purified Yef1p was incubated for 10 min at indicated tem- peratures in KNDE, cooled in an ice-water bath and the residual activity was determined by the stop method as described in Experimental procedures. The activity after incubation at 30 °C was taken relatively as 100%. F. Shi et al. Saccharomyces cerevisiae NADH kinases FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3339 and that of Utr1p was 3.9 mm; this was similar to and higher than the K m value of the NAD of Yef1p (1.9 mm) and Utr1p (0.5 mm) [1], respectively. V max for the NADH of Yef1p was 1.9 mmÆmin )1 ÆU )1 and that of Utr1p was 3.5 mmÆmin )1 ÆU )1 ; this was also similar to and higher than the V max value of the NAD of Yef1p (1.7 mmÆmin )1 ÆU )1 ) and Utr1p (1.2 mmÆ min )1 ÆU )1 ), respectively. K m and V max for NAD and NADH of Pos5p have not been reported [2,3]. Constructions of double and triple mutants for UTR1, YEF1 and POS5 To examine the roles of Yef1p, Utr1p and Pos5p, we attempted to construct double and triple mutants for UTR1, YEF1 and POS5. Tables 3, 4 and 5 list the yeast strains, plasmids and primers, respectively, used in this study. We hypothesized that the triple mutant (utr1yef1- pos5) may be lethal due to the proposed significance of intracellular NADP and NADPH; therefore, we con- structed a triple mutant carrying UTR1 on YCplac33 (MK1208, utr1yef1pos5 YCp-UTR1) by replacing POS5 in MK933 (utr1yef1 YCp-UTR1) with CgLEU2 (LEU2 of Candida glabrata, GenBank ID CGU90626) and examined the viability of the triple mutant after the loss of YCp-UTR1 by using synthetic dextrose⁄ 5-fluoro- orotic acid ⁄ uracil (SD+FOA+Ura) medium [12]. The MK1208 (utr1yef1pos5 YCp-UTR1) was able to grow in SD+FOA+Ura liquid medium as well as on the SD+FOA+Ura solid medium (data not shown). The resultant triple mutant (MK1219, utr1yef1pos5) that grew on the SD+FOA+Ura media was believed to lose YCp-UTR1 [12]. The loss of YCp-UTR1 was con- firmed by the Ura– phenotype of MK1219 (require- Table 2. Effect of compounds on ATP-NAD kinase activity of Yef1p. The effect of compounds on the activity of Yef1p was stud- ied by assaying ATP-NAD kinase activity in a reaction mixture con- taining compounds at the indicated concentrations as described in Experimental procedures. The effect of NADP and HgCl 2 was examined by the stop method and others, by the continuous method. Activity in the absence of each compound was taken relat- ively as 100%. Compound Concentration (m M) Relative activity (%) None 100 NADPH 0.05 100 0.1 84 NADH 0.05 86 0.1 75 NADP 0.05 100 0.1 100 Nicotinic acid mononucleotide 1.0 100 Nicotinic acid adenine dinucleotide 1.0 100 Nicotinic acid 1.0 100 Quinolinic acid 1.0 100 2-Mercaptoethanol 1.0 100 Dithiothreitol 1.0 100 Glutathione (reduced form) 1.0 100 HgCl 2 0.1 13 0.25 6 Table 3. S. cerevisiae strains used in this study. Strain Genotype Source BY4742 MATa leu2D0 lys2D0 ura3D0 his3D1 EUROSCARF MK424 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 EUROSCARF MK425 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 EUROSCARF MK426 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 EUROSCARF MK353 MATa leu2D0 lys2D0 ura3D0 his3D1 ftr1::kanMX4 EUROSCARF MK710 MATa leu2D0 lys2D0 ura3D0 his3D1 zwf1::kanMX4 EUROSCARF MK743 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 This study MK803 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 pos5::HIS3 This study MK804 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 pos5::HIS3 This study MK933 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 YCp-UTR1 This study MK1208 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 YCp-UTR1 This study MK1219 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 This study MK751 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp13 This study MK1223 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 pRS415 This study MK1224 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::CgLEU2 This study MK342 MATa leu2D0 lys2D0 ura3D0 his3D1 YEplac195 This study MK739 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-UTR1 This study MK740 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-POS5 This study MK741 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-YEF1 This study MK742 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEplac195 This study Saccharomyces cerevisiae NADH kinases F. Shi et al. 3340 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS ment of uracil for growth; data not shown). Thus, the triple mutant was unexpectedly viable. Growth phenotypes of mutants for UTR1, YEF1 and POS5 We examined the growth phenotypes of single, double and triple mutants, i.e. utr1, yef1, pos5, utr1yef1, utr1pos5, yef1pos5 and utr1yef1pos5 cells. These mutants did not exhibit any severe growth defects at 30 °C in SD, YPD, YPD high dextrose (20% glucose), YPD low dextrose (0.2% glucose) liquid media (Fig. 3) and on SD solid medium (Fig. 4A, control). However, in yeast extract ⁄ peptone ⁄ glycerol (YPG; 3% glycerol) medium, pos5 mutants (pos5, yef1pos5 and utr1pos5) showed a longer doubling time than the other single Table 4. Plasmids used in this study. YGRC, Yeast Genetic Resource Centre, Osaka University, Japan. Plasmid Description Source pET-DEST42 Gateway destination vector, Ap r Invitrogen pET-YEF1 YEF1 in pET-DEST42 This study pFA6a-His3MX6 Gene deletion vector, HIS3,Ap r [34] pCgLEU2 Gene deletion vector, CgLEU2 a ,Ap r YGRC YEplac195 E. coli ⁄ S. cerevisiae shuttle vector, URA3,2lm, Ap r [13] YEp-UTR1 UTR1 flanking 5¢ 503 bp in YEplac195 This study YEp-POS5 POS5 flanking 5¢ 406 bp in YEplac195 This study YEp-YEF1 YEF1 flanking 5¢ 503 bp in YEplac195 This study YCplac33 E. coli ⁄ S. cerevisiae shuttle vector, URA3, CEN,Ap r [13] YCp-UTR1 UTR1 flanking 5¢ 503 bp in YCplac 33 This study YEp13 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2 b ,2lm, Ap r [13] pRS415 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2 b , CEN,Ap r [13] pFA6a-GFP(F64A, S65T, Gene modification vector, GFP, HIS3,Ap r [29] R80Q, V163A) -His3MX6 a LEU2 of C. glabrata. b LEU2 of S. cerevisiae. Table 5. Primers used in this study. The start and stop codons are specified in bold. The Shine–Dalgarno sequence is indicated by double underlining. The sequence corresponding to the genomic DNA sequence of S. cerevisiae is underlined. Primer Oligonucleotide sequences yef1-attB1FSD AAAAAGCAGGCTCC GAAGGAGATATAAAA ATGAAAACTGATAGATTACTG yef1-attB2R AGAAAGCTGGGTG GATTGCAAAATGAGCCTGAC attB1 ACAAGTTTGTACAAAAAAGCAGGCT attB2 ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC pos5hisr CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG pos5leu21.6f CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG pos5leu21.6r CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG yef1up0.5kb CGTTATGAAAATCACTATTATCCCC yef1-HindIII AAAAGC TTAGATTGCAAAATGAGCCTGACGA pos5up0.4kb GCTATGAAAGTCAATCCTTTTAATCG pos5-HindIII GAAAGC TTAATCATTATCAGTCTGTCTCTTGG utr1up0.5kb GCCACTGCCATCTCTTCCATTCTTTG utr1-BamHI ATGGATCC TTATACTGAAAACCTTGCTTGAGAAG F. Shi et al. Saccharomyces cerevisiae NADH kinases FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3341 and double mutants and the wild-type (WT, BY4742) cell, although the triple mutant (utr1yef1pos5) did not (Fig. 3). The growth defect of pos5 mutants probably reflected the mitochondrial dysfunction caused by the deletion of POS5 [2,3]. The absence of growth defects in the triple mutant suggested that CgLEU2, which was used for the disruption of POS5 in the utr1yef1 cell to construct triple mutant, can complement the growth defect of pos5 mutants. All mutants exhibited proper growth on solid med- ium lacking methionine (data not shown), the med- ium on which we confirmed that the zwf1 cell exhibited growth defect as reported elsewhere [2,9– 11] (data not shown). Growth defects of the pos5 cell on medium lacking arginine, on medium contain- ing oxidative stress (2 mm hydrogen peroxide) and on synthetic glycerol (SG) medium were previously reported [2] and confirmed in this study (Fig. 4A), thereby indicating that Pos5p is a critical contributor to mitochondrial functions [2,3]. We found that utr1- pos5 and yef1pos5 cells appeared to grow somewhat less than pos5 cells on solid medium lacking argi- nine, on solid medium containing hydrogen peroxide and on solid SG medium (Fig. 4A); this was con- firmed using liquid media lacking arginine (Table 6). However, utr1yef1 and other single mutants showed no growth defects on these solid media (Fig. 4A). These growth defects indicate that Utr1p or Yef1p can partially contribute to the mitochondrial function only in the absence of the critical contributor (Pos5p), i.e. partial contribution was observed only in the absence of the critical contributor. However, the utr1yef1pos5 cell exhibited no growth defects on the solid and liquid media, unlike the other pos5 mutants (Fig. 4A and Table 6), thereby suggesting that CgLEU2 can complement the growth defects of pos5 mutants. In liquid medium lacking arginine, leu- cine slightly inhibited the growth of the triple mutant (Table 6). Fig. 3. Doubling times for the growth of single, double and triple mutants for UTR1, YEF1 and POS5. The mutants and BY4742 (WT) cells that were cultivated in YPD liquid medium to saturation were washed three times in sterilized water and inoculated into 3 mL SD (2% glucose), YPD (2% glucose), YPD high dextrose (20% glu- cose), YPD low dextrose (0.2% glucose) and YPG (3% glycerol) liquid media until D 600 of 0.05. The cells were cultivated aerobically at 30 °C and their growth was monitored by following D 600 every 4 h. Averages in two independent experiments are provided. A B Fig. 4. Growth phenotypes of the mutants for UTR1, YEF1 and POS5. (A) The mutants and WT cells that were cultivated in SD liquid medium to saturation were washed three times in sterilized water and spotted as described in Experimental procedures on SD solid medium (control), SD solid media without arginine (–Arg), with 2 m M hydrogen peroxide (+H 2 O 2 ) and SG solid medium (SG). (B) pos5 mutants lacking ScLEU2 (pos5), carrying ScLEU2 on high copy vector (pos5 YEp13), low copy vector (pos5 pRS415) and carrying CgLEU2 on chromo- some (pos5::CgLEU2) were treated and spotted as in (A). Saccharomyces cerevisiae NADH kinases F. Shi et al. 3342 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS Complementing abilities of LEU2, UTR1 and YEF1 for the growth defects of the pos5 mutant To confirm the complementing ability of LEU2 for the growth defects of the pos5 mutant, we examined the growth of pos5 cells containing CgLEU2 instead of POS5 on the chromosome, ScLEU2 (LEU2 of S. cere- visiae) on a high copy vector (YEp13) [13] and on a low copy vector (pRS415) [13], i.e. MK1224 (pos5:: CgLEU2), MK751 (pos5 YEp13) and MK1223 (pos5 pRS415), on several media on which pos5 mutants, except for the triple mutant, showed growth defects (Fig. 4A). The pos5::CgLEU2 cell was able to grow on these media, whereas pos5 YEp13, pos5 pRS415 and pos5 cells were unable to grow (Fig. 4B), thereby indi- cating that CgLEU2 on the chromosome, but not ScLEU2 on YEp13 and pRS415, could complement the growth defect of the pos5 cell. The effect of leucine on the growth of pos5::CgLEU2, pos5 YEp13 and pos5 pRS415 cells were not detected on these solid media (data not shown). The expression of POS5, UTR1 and YEF1 via a high-copy vector complemented the poor growth of the pos5 cell on SG solid medium and on and in solid and liquid media lacking arginine (Fig. 5 and Table 6), thereby supporting the partial contribution of Utr1p and Yef1p to mitochondrial functions (Fig. 4A). Temperature sensitivity of the mutants for UTR1, YEF1 and POS5 At higher temperature (37 °C) on SD solid medium, pos5 single mutant showed a slight growth defect, and the deletion of UTR1 or YEF1 and particularly of both UTR1 and YEF1 from the pos5 cell enhanced the growth defect (Fig. 6). However, utr1yef1 and the other single mutants did not exhibit growth defects at 37 °C (Fig. 6), thereby indicating that Pos5p is a crit- ical contributor to the survival of the cells at 37 °Con SD solid medium; Utr1p or Yef1p and in particular, both Utr1p and Yef1p can contribute significantly to the survival only in the absence of main contributor (Pos5p). On YPD solid medium, the growth defect was alleviated (Fig. 6). Growth phenotypes of mutants for UTR1, YEF1 and POS5 in low iron medium Because Utr1p is proposed to participate in the ferri- reductase system required for low iron uptake, the utr1 cell was expected to exhibit growth defect on the low iron medium [1,8]. As expected, utr1 exhibited lower growth in the low iron medium than the yef1 and pos5 single mutants (Fig. 7). The deletion of YEF1 or POS5 from utr1 further decreased the growth of utr1 to the same level as that of the ftr1 mutant, which lacks a high-affinity iron transporter and shows severe growth defects in the low iron medium [14] (Fig. 7). Further- more, the deletion of both YEF1 and POS5 from utr1 Table 6. Doubling time of WT (BY4742) and pos5 mutants. Means of two independent experiments are provided. Arginine concentra- tions are specified in parentheses in mgÆL )1 . In this study, 20 mgÆL )1 arginine was usually added. NG, No growth; ND, not deter- mined. Strains Doubling time (h) Arg (0) Arg (0.2) Arg (2) Arg (20) WT 2.1 2.0 2.2 1.9 pos5 NG 6.9 6.1 2.9 utr1pos5 NG 14.8 8.8 2.6 yef1pos5 NG 10.8 8.8 2.7 utr1yef1pos5 2.7 2.6 3.2 3.1 utr1yef1pos5 a 2.1 2.3 2.3 2.2 WT YEplac195 1.8 ND 1.9 1.9 pos5 YEplac195 15.6 ND 8.5 4.0 pos5 YEp-UTR1 6.3 ND 6.0 3.1 pos5 YEp-POS5 2.8 ND 2.8 2.7 pos5 YEp-YEF1 6.6 ND 5.8 4.9 a This strain was grown in media lacking leucine. The other strains were grown in media containing leucine. Fig. 5. Complementation of pos5 cell. Indi- cated pos5 and WT cells carrying each gene on a high-copy vector or high-copy vector alone were treated as in Fig. 4A and spotted on SD solid media (glucose) with (control) and without (–Arg) arginine and SG solid media (glycerol) with (+Arg) and without (–Arg) arginine. F. Shi et al. Saccharomyces cerevisiae NADH kinases FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3343 decreased the growth to a level that was much lower than that of the ftr1 mutant (Fig. 7). It should be noted that in the presence of Utr1p, the mutants (yef1, pos5 and yef1pos5 cells) did not exhibit growth defects (Fig. 7), thereby indicating that Utr1p is a critical con- tributor to growth in the low iron medium and that Yef1p or Pos5p and, in particular, both Yef1p and Pos5p can contribute significantly to this kind of growth only in the absence of the critical contributor (Utr1p). Discussion The genomic sequence of the yeast S. cerevisiae con- tains three NAD kinase homologues, i.e. Utr1p, Pos5p and Yel041wp [1–3]. In this study, we termed Yel041wp ‘Yef1p’. Among the three proteins, only the function of Yef1p was not identified biochemically; therefore, it was termed the ‘function-unknown’ pro- tein. We identified that Yef1p functions as an ATP- NADH kinase by using recombinant protein expressed in E. coli. We also confirmed that Utr1p, initially identified as an ATP-NAD kinase [1], was in fact an ATP-NADH kinase. Thus, the three isozymes of NAD kinase, namely, Utr1p, Yef1p and Pos5p, were bio- chemically identified as ATP-NADH kinases [1–3]. Yef1p exhibited a homooctameric structure consist- ing of 60-kDa subunits, while Utr1p exhibited a homo- hexameric structure consisting of 60-kDa subunits [1]; however, the structure of Pos5p has not been deter- mined [2,3]. The homooctameric structure of Yef1p shows good agreement with that of the NADH kinase found in C. utilis (a homooctamer consisting of 32-kDa subunits) [15] and pigeon liver NAD kinase (a homooctamer consisting of 34-kDa subunits) [16]. However, it was not in agreement with the NAD kin- ase structure of humans (a homotetramer consisting of 49-kDa subunits) [17] and that in Mycobacterium tuberculosis (a homodimer or homotetramer with 33–35-kDa subunits) [4,18–20]. No regulators for Yef1p activity were found (Table 5). Intermediates of NAD biosynthesis, particularly quinolinic acid, did not affect Yef1p, although poly(P) ⁄ ATP-NAD kinase of the Gram-positive bacterium Bacillus subtilis is acti- vated by this compound [21]. NADPH, NADH, and NADP at 0.05 mm also exerted a slight effect on Yef1p activity, although these inhibited the ATP-NAD kinase activity of Utr1p; the residual activity of Utr1p was 0%, 59% and 61% in the presence of 0.05 mm Fig. 6. Temperature sensitivity of the mutants for UTR1, YEF1 and POS5.The mutants and WT cells were treated and spotted on SD and YPD solid media as des- cribed in Fig. 4A and were grown at 30 °C and 37 °C as indicated. Fig. 7. Growth of mutants for UTR1, YEF1 and POS5 in low iron medium. In order to exhaust the intracellular iron content, the mutants and WT cells were cultivated in a low iron liquid medium to saturation and further cultivated for 24 h after a 100-fold dilution of the saturated culture by the same fresh medium. The cells were washed three times in sterilized redistilled water and inoculated into 3 mL SD (filled bar) and low iron (open bar) liquid media to give D 600 of 0.05 (SD) and of 0.20 (low iron). The cells were cultivated aerobically at 30 °C, and growth was monitored by following the D 600 . Bars represent the relative D 600 (%) of the cultures in the sta- tionary phase (SD, after 34 h; low iron, after 100 h), taking D 600 (%) of the WT cell in each medium (SD, D 600 of 5.8; low iron, D 600 of 2.4) as 100%. Means of two independent experiments are pro- vided. Saccharomyces cerevisiae NADH kinases F. Shi et al. 3344 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS NADPH, NADH and NADP [1], respectively, thereby suggesting a difference in the regulation of Yef1p and Utr1p by these compounds. The viability of the triple mutant for the three NADH kinase genes (UTR1, YEF1 and POS5)at 30 °C was unexpected. NAD and NADH kinases have been regarded as the sole enzymes producing NADP and NADPH [5]. Accordingly, NAD kinase was recently reported to be essential to bacteria such as B. subtilis [22] and M. tuberculosis [23]. Taking into account the fact that no NAD kinase homolog other than Utr1p, Yef1p and Pos5p is found in the genome sequence of S. cerevisiae, we propose that a ‘novel’ enzyme, whose primary structure is different from those of all known NAD and NADH kinases, cata- lyses the formation of NADP or NADPH in S. cere- visiae. Furthermore, we believe that the novel enzyme was able to catalyse the formation of cytosolic NADP, but not cytosolic NADPH and mitochondrial NADP(H) for the following reasons: (a) methionine auxotrophy of the zwf1 mutant [2,9–11] indicates that cytosolic NADPH is not supplied by the novel enzyme in this mutant; (b) viability and methionine prototro- phy of the triple mutant (utr1yef1pos5) (data not shown) supports the possibility that cytosolic NADP, which is probably converted to NADPH by Zwf1p, is supplied by the novel enzyme; and (c) the decreased mitochondrial NADPH level in the pos5 mutant [2,3] (Fig. 4A) indicates that mitochondrial NADPH and ⁄ or NADP are not supplied by the novel enzyme in the pos5 mutant. The viability of the triple mutant (utr1yef1pos5) might imply that the three NADH kinases are dispen- sable (Utr1p, Yef1p and Pos5p). However, the pheno- typic analysis of the single, double and triple mutants for UTR1, YEF1 and POS5 and previous reports [2,3] showed the critical contribution of Pos5p to mitoch- ondrial functions and survival at 37 °C, and the critical contribution of Utr1p in supporting growth in a low iron medium. The contributions of the other two enzymes were shown only in the absence of the critical contributor, which was supported by the complementa- tion of certain pos5 phenotypes through the over- expression of UTR1 or YEF1 (Figs 4A,5,6,7; Table 6). Furthermore, the alleviated temperature sensitivity of the pos5 mutants on YPD solid medium when com- pared with that on SD solid medium (Fig. 6) may be indicative of the significance of NADP and NADPH in biosynthetic reactions, which is in agreement with the well-accepted concept that NADP and NADPH are involved primarily in biosynthetic reactions, while NAD and NADH are involved primarily in catabolic reactions [24]. Although the critical contribution of Yef1p alone to specific cellular function was not observed in this study, a difference in the regulation of Yef1p and Utr1p by NADPH, NADH and NADP (Table 2) [1], and the different transcriptional patterns and protein– protein interactions of Yef1p, Utr1p and Pos5p [25– 27] may be indicative of a certain critical contribution of Yef1p. In brief, for example, transcriptions of YEF1 are repressed under anaerobic conditions and in the presence of ethanol stress; however, those of UTR1 and POS5 are not affected [25,26]. Two-hybrid analysis indicated that Yef1p interacted with Utr1p and the ‘function-unknown’ proteins (Yor315wp, Yhr115cp and Ykl009wp). On the other hand, Utr1p interacted with Yef1p and Nup119p (nuclear pore complex involved in nucleocytoplasmic transport), and Pos5p interacted with Gts1p (putative transcription factor) [27]. The interaction of Yef1p with Utr1p is of biological interest and may be related to the pro- nounced requirement of both Yef1p and Utr1p in the absence of Pos5p. The elucidation of the localization of Utr1p and Yef1p would be helpful in understanding the critical contribution of Yef1p as well as the molecular mech- anism underlying the findings described in this study. The localizations of Yef1p and Utr1p were predicted by computer program analysis using ipsort [28], which detects the mitochondrial targeting sequence and N-terminal signal sequence for targeting proteins to the ER. ipsort did not show any positive sequence in Yef1p and Utr1p, although it detected a mitochondrial targeting sequence in Pos5p [2,3], thereby implying that Yef1p and Utr1p are not, at least, mitochondrial enzymes. We attempted to examine the localization of Yef1p and Utr1p by inserting the green fluorescent protein (GFP) gene into the 3¢ terminus of YEF1 and UTR1 on the chromosome by using the pFA6a- GFP(F64A, S65T, R80Q, V163A)-His3MX6 [29] gene modification plasmid in order to express them as GFP-fusion proteins, and then observing them using fluorescence microscopy or detecting them by western blotting with anti-GFP Ig (Molecular probes, Eugene, OR, USA). However, their localization could not be confirmed, possibly due to the low expression of the GFP-fusion proteins and ⁄ or the sensitivity of the detection system. Finally, we also found that CgLEU2 (LEU2 of C. glabrata), but not ScLEU2 (LEU2 of S. cerevisiae), complemented certain pos5 phenotypes (Fig. 4). LEU2 encodes b-isopropylmalate dehydrogenase that cata- lyses the oxidation of b-isopropylmalate by using NAD, but not NADP [30]. ScLeu2p reportedly uses NAD, but not NADP (< 5% efficiency) [30]; it was F. Shi et al. Saccharomyces cerevisiae NADH kinases FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3345 also reported to be localized in the cytosol [31]. No positive sequence was detected in ScLeu2p during the computer program analysis using ipsort, thereby sup- porting the cytosolic localization of ScLeu2p. The co- enzyme specificity and localization of CgLeu2p have not been reported. However, ipsort did not show any positive sequence in CgLeu2p, possibly suggesting that CgLeu2p was localized in the cytosol. Collectively, we assume that cytosolic CgLeu2p has the ability to utilize NADP and that it supplies cytosolic NADPH, whereas cytosolic ScLeu2p cannot provide NADPH due to its specificity to NAD. In the triple mutant (utr1yef1pos5), cytosolic NADP might be supplied by the ‘novel’ enzyme, being different from Utr1p, Yef1p, and Pos5p, as discussed above. In this context, we assume that the adequate amount of cytosolic NADPH that is being provided by CgLeu2p is possibly transported into the mitochondria via an unidentified transporter localized in the mitochondrial membrane. This results in comple- mentation of the pos5 phenotypes caused by low mitochondrial NADPH levels [2,3], although an NADPH supply of this kind is not adequate for com- plementing the growth defects of the triple mutant at 37 °C and in a low iron medium (Figs 6 and 7). This assumption is also supported by the complementation of pos5 phenotypes through the expression of UTR1 or YEF1 via a high-copy vector (Fig. 5 and Table 6), wherein it is implied that Utr1p and Yef1p are not mitochondrial enzymes, as mentioned above. The slight growth inhibition of the triple mutant by leucine in liquid medium lacking arginine (Table 6) might imply that the expression and ⁄ or activity of CgLeu2p are sup- pressed by leucine. Experimental procedures Materials Yeast extract, tryptone, glucose-6-phosphate and NADH were from Nacalai Tesque (Kyoto, Japan). Glutamate dehydrogenase (EC 1.4.1.3), ATP, NAD, NADP and NADPH were from Oriental Yeast (Tokyo, Japan). Ferro- zine, pyrophosphate, tripolyphosphate, trimetaphosphate, glucose-6-phosphate dehydrogenase and other nucleotides were from Sigma (St. Louis, MO, USA). Polyphosphate, metaphosphate, hexametaphosphate, quinolinic acid and 5-fluoro-orotic acid (FOA) were from Wako Pure Chemical Industries (Osaka, Japan). Yeast nitrogen base without amino acids was from Difco (Sparks, MD, USA), and yeast nitrogen base without ferric chloride and copper sulfate was from Q-Bio Gene (Carlsbad, CA, USA). Purified Utr1p was obtained as described elsewhere [1]. Sources of other materials are provided in the text. Strains Strains of S. cerevisiae were cultured at 30 °C in nutrient- rich yeast extract ⁄ peptone ⁄ dextrose (YPD) medium [1% (w ⁄ v) yeast extract, 2% (w ⁄ v) peptone, 2% (w ⁄ v) glucose; pH 5.0), if necessary, with 0.2 mgÆmL )1 geneticin or in syn- thetic dextrose (SD) medium [0.67% (w ⁄ v) yeast nitrogen base without amino acids, 2% (w ⁄ v) glucose, and appropri- ate amino acids; pH 5.0]. Glucose was replaced with 3% (v ⁄ v) glycerol in the synthetic glycerol (SG) medium and the YPG medium. The concentration of glucose was chan- ged to 0.2% and 20% (w ⁄ v) for YPD low dextrose medium and YPD high dextrose medium, respectively. The low iron medium was composed of 0.67% (w ⁄ v) yeast nitrogen base without ferric chloride and copper sulfate, 40 lgÆmL )1 CuCl 2 ,2%(w⁄ v) glucose, 50 mm 2-morpholinoethanesulf- onic acid, pH 6.1, 1 mm ferrozine and appropriate amino acids [14]. The SD+FOA+Ura medium was composed of 0.7% (w ⁄ v) yeast nitrogen base without amino acid, 2% (w ⁄ v) glucose, 0.1% FOA, 50 mgÆL )1 uracil and appropri- ate amino acids [12]. The SD+FOA+Ura medium was similar; however, FOA and uracil were not included. In order to prepare solid media, liquid media were solidified using 2% agar. To check the growth on solid media, the cells were cultured to saturation at 30 °C, collected, washed three times in sterilized water and diluted in water to yield A 600 of 2.0, 0.2 and 0.02. The diluted cell suspensions (5 lL) were spotted on appropriate solid media. After 5 days, photographs were taken. Culture conditions for derivative strains of E. coli BL21(DE3) (Novagen, Madi- son, WI, USA) are given below. In order to serve as a host for plasmid amplification, E. coli DH5a was routinely cultured at 37 °C in Luria–Bertani medium (1% tryptone, 0.5% yeast extract, 1% NaCl; pH 7.2) supplemented with 100 lgÆmL )1 ampicillin or 30 lgÆmL )1 kanamycin as required. Construction of YEF1 expression plasmid and strain YEF1 was amplified from genomic DNA of S. cerevisiae BY4742 with PfuUltra high-fidelity DNA polymerase (Stratagene, La Jolla, CA, USA) by using PCR and was cloned into pET-DEST42 (Invitrogen, Carlsbad, CA, USA) to produce pET-YEF1 in accordance with the manufacturer’s protocol. The primers used were as follows: yef1-attB1FSD, yef1-attB2R, attB1 and attB2. A Shine– Dalgarno sequence (GAAGGAG) with optimal spacing (ATATAAAA) for appropriate translation initiation in E. coli was inserted upstream of the start codon of YEF1 (Table 5). The use of pET-DEST42 enabled us to fuse a V5 epitope and a His 6 tag to the C-terminal of Yef1p. E. coli BL21(DE3) was transformed with pET-YEF1 and pET- DEST42 to yield MK746 and SK45, respectively. Saccharomyces cerevisiae NADH kinases F. Shi et al. 3346 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS [...]... upstream and downstream of POS5 was obtained using primers pos5hisf and pos5hisr and was introduced into MK424 (utr1) and MK426 (yef1), yielding MK803 (utr1pos5) and MK804 (yef1pos5) CgLEU2 flanking approximately 40 nucleotides upstream and downstream of POS5 was amplified by PCR from plasmid pCgLEU2 by using primers pos5leu21.6f and pos5leu21.6r and was introduced into BY4742 and MK933 (utr1yef1 YCp-UTR1) in. .. tube in boiling water for 5 min, the amount of NADP was determined as described above One unit (U) of enzyme activity was defined as 1.0 lmol NADPH produced for 1 min at 30 °C in an initial reaction mixture (1.0 mL), and specific activity was expressed in UÆmg)1 protein Vmax was determined using 1.0 U Yef1p or Utr1p, being defined by an assay of NAD kinase activity Purification of Yef1p Assay of NAD kinase. .. (PROBRAIN) References 1 Kawai S, Mori S, Suzuki S & Murata K (2001) Molecular cloning and identification of UTR1 of a yeast Saccharomyces cerevisiae as a gene encoding an NAD kinase FEMS Microbiol Lett 200, 181–184 2 Outten CE & Culotta VC (2003) A novel NADH kinase is the mitochondrial source of NADPH in Saccharomyces cerevisiae EMBO J 22, 2015–2024 3 Strand MK, Stuart GR, Longley MJ, Graziewicz MA, Dominick... concentration of 0.4 mm, and cultivation was continued further at 37 °C aerobically for 5 h As a control, SK45 in 10 mL medium was treated in a similar manner Saccharomyces cerevisiae NADH kinases and NADP by the addition of 12.5 U glutamate dehydrogenase, followed by incubation at 30 °C for 10 min Oxidation was monitored by observing the decrease in A340 After the oxidation reaction was terminated by immersing... in UÆmg)1 protein Protein concentrations were determined in accordance with the method of Bradford [32] by using BSA as the standard Assay of NADH kinase activity A reaction mixture (1.0 mL) consisting of 2.0 mm NADH, 5.0 mm ATP, 5.0 mm MgCl2, 100 mm Tris ⁄ HCl (pH 8.0) and an appropriate amount of enzyme was incubated at 30 °C Enzyme solution of less than 100 lL was routinely added to the reaction... GB (1973) Subcellular localization of the leucine biosynthetic enzymes in yeast J Bacteriol 116, 222–225 32 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye-binding Anal Biochem 72, 248–254 33 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685... YEp-YEF1 and YEplac195, thereby yielding MK739 (pos5 YEp-UTR1), MK740 (pos5 YEp-POS5), MK741 (pos5 YEp-YEF1) and MK742 (pos5 YEplac195) UTR1 in addition to upstream 503 bp DNA was inserted into the SmaI site of YCplac33 in order to produce 3348 F Shi et al YCp-UTR1, which was then introduced into MK743 (utr1yef1), yielding MK933 (utr1yef1 YCp-UTR1) pos5 single mutant (MK425) was transformed with YEp13 and. .. was routinely added to the reaction mixture In some cases, NAD kinase activity was also assayed by a stop method [4] In brief, glucose6-phosphate and glucose-6-phosphate dehydrogenase were removed from the initial reaction mixture described above After the reaction was terminated by immersing the test tube in boiling water for 5 min, 0.1 mL of 50 mm glucose6-phosphate was added to the mixture, and the... YEF1 flanking 503 bp, 406 bp and 503 bp upstream of each gene were amplified by PCR from the genomic DNA of BY4742 with KOD-plus polymerase (Toyobo, Osaka, Japan) by using the following primers: utr1up0.5kb, utr1-BamHI (UTR1), pos5up0.4kb, pos5-HindIII (POS5), yef1up0.5kb and yef1-HindIII (YEF1) They were then inserted into the SmaI site of YEplac195 to produce YEp-UTR1, YEp-POS5 and YEp-YEF1 S cerevisiae. .. Dominick OC & Copeland WC (2003) POS5 gene of Saccharomyces cerevisiae encodes a mitochondrial NADH kinase required for stability of mitochondrial DNA Eukaryot Cell 2, 809–820 4 Kawai S, Mori S, Mukai T, Suzuki S, Hashimoto W, Tamada T & Murata K (2000) Inorganic polyphosphate ⁄ ATP-NAD kinase of Micrococcus flavus and Mycobacterium tuberculosis H37Rv Biochem Biophys Res Commun 276, 57–63 5 McGuinnes ET & Bulter . Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae Feng Shi 1,2 ,. kinase [1], was in fact an ATP-NADH kinase. Thus, the three isozymes of NAD kinase, namely, Utr1p, Yef1p and Pos5p, were bio- chemically identified as ATP-NADH