what cognitive mechanisms are involved in the elaboration of a situation model

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Ngày tải lên : 22/03/2014, 21:20

... following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG ... Functional and structural characterization of the catalytic domain of the starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima Y, Isono N, Hamada S, Ito ... triplicate and the average values ± SD are reported [19,39] SS activity was determined using a radiochemical method [44] All kinetic parameters are the means of at least three determinations and are...

13
457
0

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Ngày tải lên : 09/08/2014, 10:22

... tolerance and immune inhibition in the induction of oral tolerance in the murine CIA model We examined the change in the expression of IDO in CD11c+ DCs of Peyer's patches after repeated oral administration ... tarsal bone, = moderate edema and erythema from the ankle to the tarsal bone, and = edema and erythema from the ankle to the entire leg The sum of the values from three legs, excluding the hind ... 4:1206-1212 Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O: Regulation of indoleamine 2,3-dioxygenase activity in the small intestine and the epididymis of mice Arch Biochem Biophys...

10
473
0

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Ngày tải lên : 16/03/2014, 23:20

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...

11
584
0

Molecular mechanisms involved in the specification of embryonic ectoderm in the zebrafish embryo

Ngày tải lên : 16/09/2015, 17:12

... kDa to 78 kDa and are comprised of a structural and a functional domain: the T-domain, and a transcriptional activator or repressor domain The crystallographic structure of the T-domain of the ... specification; and a parallel pathway model, where a cell initially assesses its position within the gastrula and interpretation of this information leads to the parallel activation of a fate specification ... maternal Wnt signalling (Miller et al, 1999) Induction of the A- P axis occurs at the onset of gastrulation and involves a combination of several pathways, including the Wnt signalling pathway...

120
258
0

Risks Involved in the Use of Herbal Products

Ngày tải lên : 25/10/2013, 05:20

... cyclosporine) Anticoagulants (such as warfarin) Iron Drugs used to manage migraine headaches (such as ergotamine) Nonsteroidal anti -in ammatory drugs (NSAIDs) Garlic Anticoagulants (such as warfarin) ... native to Asia, where it has a long history of medicinal use, as documented in ancient medical treatises from India and China In traditional Chinese and Indian medicine, branches of the herb are ... investigators calculated mean values for the maximal plasma concentration, the time to reach the maximal plasma concentration, the area under the plasma concentration–time curve, the elimination of half-life,...

15
396
0

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Ngày tải lên : 20/02/2014, 11:20

... mobility of the domains in the crystal; the PYR domain has the lowest average B-factor, ˚ 23 A2 (comparable to the B-factor of bound ThDP), whereas the middle domain has the highest overall B-factor, ... such large-scale conformational changes during catalysis, and these structural features explain the lack of substrate activation in ZmPDC In IPDC, the assembly of the subunits in the tetramer ... three-dimensional structure of the corresponding intermediate in transketolase [37] and the model derived for ScPDC [38] (Fig 6) In the immediate vicinity of the modelled a- carbanion/enamine, there are a...

10
557
0

Tài liệu Báo cáo Y học: Identiﬁcation of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Ngày tải lên : 21/02/2014, 01:21

... termination codons are in bold letters The start and direction of each ORF are indicated by horizontal arrows and named accordingly Putative )10 and )35 regions of ata12 and ataPKS1 are overlined Restriction ... putative ribosomal binding sites, )10 and )35 regions, consensus sequences, etc., are indicated in Fig ataP3, ataP4, and ataP5 encode peptides (AtaP3, AtaP4 and AtaP5) that are highly similar ... previously are in dashed boxes Cosmids pCAR11 and pCAR13, which contain the A2 0 1A resistant determinants ard2 and ard1, respectively, are modiﬁed from Barrasa et al [12,13] As a comparison, the gene...

9
728
0

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Ngày tải lên : 22/02/2014, 07:20

... when the rate of amylopectin synthesis becomes minimal At these moments the rates of amylopectin synthesis are only 5% of their maximal values In fact this low rate of amylopectin polymerization ... followed the kinetics of amylose synthesis over a 5-day period of nitrogen starvation and measured the amounts of starch, amylose, the kmax of the starch fractions, the degree of crystallinity and the ... h in vitro synthesis of amylose appear highly distorted and partly fused into a network This demonstrates that at least part of the synthesis can occur at the surface of the granule The apparent...

11
556
0

Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc

Ngày tải lên : 05/03/2014, 23:20

... construction of the domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r in the ... properties of the quadratic maps which the ordinary unimodal maps not enjoy: • Quadratic maps are analytic and they have nondegenerate critical point; • Quadratic maps have negative Schwarzian derivative; ... in the 2-to-1 way onto the domain A (so that there is a critical point of g in the central domain), • All other components of B are mapped univalently onto A by the map g, • The iterates of the...

44
412
0

Báo cáo khoa học: Identiﬁcation of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt

Ngày tải lên : 08/03/2014, 10:20

... either alanine or serine residues C10 6a, 5¢-TAGAGGGGGCTA AAACAAAA-3¢; c21 2a, 5¢-ACTGTGCACTCGGCGTG AGC-3¢; c21 4a, 5¢-ACTGTGGCCTCGCAGTGAGC-3¢; c23 5a, 5¢-TAGGAGCCACCACTGTCCTC-3¢; c33 0a, 5¢-CAGAGTCCCTCCAGCCTGCC-3¢; ... fragment of the plasmid pGIR201protA (a gift from H Kitagawa, Kobe Pharmaceutical University) [22,23], containing a cDNA encoding the insulin signal sequence and the Protein A- IgG binding domain, ... structural features of the GT1 motif in GalNAc-T1 are similar to the UBD, raising the possibility that catalytic mechanisms similar to those described above are conserved in the GalNAc-transferases as...

9
435
0

BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx

Ngày tải lên : 09/03/2014, 00:20

... “How can we reduce the amount of garbage?” are often asked The expression “minimizing waste” is governing many trends, in each phase of the chain Customers, who are becoming more and more aware, ... rain that swamped the northern half of Queensland at the start of the year made its way south over the ensuing months and finally filled Brisbane’s dams If it hadn’t, the water grid and desalination ... delivered in air-tight bags packed in heavy cardboard The market for bag -in- box – BIB – has virtually exploded bag -in- box packaging fi rst saw the light of day in the US in the mid-1950s Back then,...

36
485
0

Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc

Ngày tải lên : 16/03/2014, 22:20

... consumption was analysed The corresponding values are shown in Fig After 15 of incubation in the presence of 3.5 lm Ca2+ in an air atmosphere, state respiration of brain mitochondria was decreased to ... contradictory results Consequently, the initial enthusiasm for the use of antioxidants to treat acute brain injury subsided As a reason for the failure, the bioavailability of antioxidants was ... mitochondria This work was conducted in accordance with the regulations of the National Act, the use of Experimental Animals (Germany) Mitochondria were prepared from the brains of 220–240 g male Wistar...

9
433
0

Báo cáo khoa học: RNA-binding properties of HCF152, an Arabidopsis PPR protein involved in the processing of chloroplast RNA pdf

Ngày tải lên : 17/03/2014, 10:20

... motifs (A) RNA-binding of the HCF152 and truncated parts containing diﬀerent amounts of PPR motifs were analyzed in a UVcrosslinking assay to [32P]BDd RNA Increasing amounts of proteins, as indicated ... concentration and analyzed by SDS/PAGE and autoradiography In the lane marked ÔinputÕ, 5% of the corresponding 35 S-labeled protein was analyzed In the lanes marked Ô-Õ, the thioredoxin protein was incubated ... calibrated with the following protein standards: thyroglobolin, 669 kDa; catalase, 232 kDa; aldolase, 158 kDa; bovine serum albumin, 67 kDa and casein, 30 kDa Analyzing the protein–protein interaction...

12
400
0

Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

Ngày tải lên : 23/03/2014, 03:20

... droplet-targeting proteins, perilipin and fatty acid-binding protein (FABP) are expressed at late and mature stages of lipid droplet formation Interestingly, we found that the mRNA level of adipophilin ... using a free-glycerol determination kit, according to the manufacturer’s instructions (Sigma) Statistical analysis All values are given as mean ± SE Paired samples were analyzed using the paired-sample ... human adipocyte differentiation F Li et al mRNA in 3T3-L1 adipocytes, whereas the expression of a dominant-negative mutant of PPARc results in a decrease in the amount of Fsp27 mRNA in 3T3-L1 adipocytes...

11
513
0

Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

Ngày tải lên : 23/03/2014, 04:20

... S, Kawamura Y, Sato S, Wang R, Saido TC, Oyama F, Sakaki Y, Komano H & Yanagisawa K (1998) Presenilin mutations linked to familial Alzheimer’s disease increase the intracellular levels of amyloid ... 2009 The Authors Journal compilation ª 2009 FEBS 5839 Synoviolin is involved in the degradation of nicastrin T Maeda et al 23 Sai X, Kokame K, Shiraishi H, Kawamura Y, Miyata T, Yanagisawa K & ... Hrd1 enhances the degradation and suppresses the toxicity of polyglutamine-expanded huntingtin Exp Cell Res 313, 538–550 Yamasaki S, Yagishita N, Sasaki T, Nakazawa M, Kato Y, Yamadera T, Bae E,...

9
561
0

Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

Ngày tải lên : 23/03/2014, 17:21

... to the increased Sp1 binding to GC boxes and DNase II promoter activity Other mechanisms, such as interactions with other factors, may also be involved in increasing the DNA binding and transcriptional ... both basal and PMA-mediated induction of DNase II transcription These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These ﬁndings indicate ... used, bands C2 and C3 disappeared and bands SC 3a and SC3b appeared (lane 12) Coaddition of the two antibodies resulted in the loss of bands C1, C2, and C3 (lane 13) In contrast, the use of a control...

8
447
0

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identiﬁed substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Ngày tải lên : 29/03/2014, 21:20

... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...

16
462
0

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Ngày tải lên : 30/03/2014, 04:20

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...

13
344
0

Báo cáo khoa học: Catalytic activation of human glucokinase by substrate binding – residue contacts involved in the binding of D-glucose to the super-open form and conformational transitions ppt

Ngày tải lên : 30/03/2014, 04:20

... Residues involved in the binding of D-glucose to the super-open conformation The 3D structure has revealed that GK is a typical two-domain enzyme and, in the unliganded state, the L- and S-domains are ... steady-state kinetic parameters as well as the Kd value for Glc in the ITF binding assay (Fig 2C), and the GST fusion proteins were therefore mostly used in the kinetic analyses of mutant proteins ... mutations N20 4A, D20 5A, N23 1A and E25 6A ⁄ K resulted in enzyme forms that not bind Glc at all at physiological concentrations of Glc and they are essentially catalytically inactive Only in the range 200–1600...

15
522
0

Báo cáo khoa học: Towards understanding the functional role of the glycosyltransferases involved in the biosynthesis of Moraxella catarrhalis lipooligosaccharide ppt

Ngày tải lên : 30/03/2014, 08:20

... UORF3:4093 ATCACCAATCCATAATGCATG DORF3:2768 ATGTAATCAGCATCGAAGACG DORF3:3434 GCGTATTAAGAACTTACAAGG 2951:DORF 3A AACTCAACAAGATAGTCAAAC 2951:UORF 3A ATGATAAAGTACTCAATGGTG Primers used to amplify and ⁄ or ... UORF4:3684 TCAATTTGCTCATGTAATGGC 2951:UORF 4A ACAGGACAGCCCAAATATAAG 2951:UOrf4B AAAAGGTGTCGTAATCTCACC 2951:DOrf4B GTGAGATTACGACACCTTTTG DORF4:4515 TTTCTAGATTTATACCATGGTG DORF4:4132 AAAAGAAGACAAACAAGCAGC ... mutant M catarrhalis, because the spectrum lacked an N-acetamido methyl peak at p.p.m that would have been indicative of a GlcNAc being retained at the terminal position of the (1 ﬁ 4) chain Additionally,...

14
260
0