volumes expressed at reservoir conditions

Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

Báo cáo y học: "Asporin, a susceptibility gene in osteoarthritis, is expressed at higher levels in the more degenerate human intervertebral disc" ppsx

Ngày tải lên : 09/08/2014, 14:20
... asporin localization sand seen in the human specimen shows simiSectioned en face, thisto thatrat lumbar vertebral disc lar asporin localization to that seen in the human disc The greatest asporin ... here, and in the sand rat (an small rodent with spontaneous age-related disc degeneration), greater immunolocalization was found in the outer, compared to inner, annulus Localization was rare in the ... layers of extracellular matrix surrounding them (Figure 3) The sand rat disc was also examined for asporin localization in sections of disc cut en face Patterns of immunolocalization for the presence...
  • 7
  • 235
  • 0
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

Ngày tải lên : 05/09/2013, 08:40
... the storm runoff has a dramatic impact on Daecheong reservoir Spatial variation of organic carbon in Daecheong reservoir Overall trend of spatial changes: Spatial variation of SUVA along to main ... turbidity The concentration of Chlorophyll-a was analyzed with UV/Vis Spectrophotometer Table General information on Daecheong reservoir Trophic state Reservoir area Watershed area Reservoir length ... common that algae blooming used to be occurred at the temporally intermediate period between the end of wet season and early of dry season It could be suspected of that organic matter in water attributed...
  • 7
  • 428
  • 0
Tài liệu Báo cáo khoa học: Optimal observability of sustained stochastic competitive inhibition oscillations at organellar volumes pptx

Tài liệu Báo cáo khoa học: Optimal observability of sustained stochastic competitive inhibition oscillations at organellar volumes pptx

Ngày tải lên : 19/02/2014, 07:20
... dt,d[H] dt) This ã matrix is evaluated at the steady state and its eigenvalues are computed In the oscillatory regime, J evaluated at the steady state has a pair of complex conjugate eigenvalues ... 6, we also note that two display rotation by a similar amount The rate of rotation, and thus the period of oscillation, originates in the interplay between the time scales for catalysis and inhibition, ... observed indicate that uctuation-sustained cycles such as seen in Fig dominate the dynamics rather than escape events The amplitudes, being dictated by the sequence of random uctuations experienced...
  • 12
  • 399
  • 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Ngày tải lên : 16/03/2014, 18:20
... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... qACT.fw1 qACT.rv1 T7 T3 GTGCGGATCTSTTCTTCACAC CACCGTCACAGATATGTACCATATAGTC GGTGGTCTTTTGCAGAGTCATTT TTCTTTAGATACTGCTGAAGCCA AGGTCTGCATCAACCCCAAG GCATCAACCCCAAGACCAAATGG CGGGACGGTGTTGAGAGTGGA GAGAGTGGACCGGCACCAACA ... GGGCAGGTGTTTTTGTGTTGA AAGAGCGACTTGCGGGTATG CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CAACAGGGAAAAGATGACACAGATC GGGACAGCACAGCCTGGAT TAATACGACTCACTATAGGG CGCAATTAACCCTCACTAAAG Vector Ó FEBS 2004...
  • 13
  • 398
  • 0
Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf

Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf

Ngày tải lên : 17/03/2014, 08:20
... association, and indeed the estimated correlation between the two time series equals 0.3 This provides some evidence that the business cycle at birth has a negative effect on the mortality rate at ... population size) Fluctuations in the latter rate are primarily driven by fluctuations in the national twinning rate (i.e # twin births / # births) and not by fluctuations in the birth rate Interestingly, ... bivariate lifetime data, Statistical Modelling 2, 1–14 Wienke, A., K Arbeev, I Locatelli and A.I Yashin (2005), A comparison of different bivariate correlated frailty models and estimation strategies,...
  • 45
  • 453
  • 0
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study

assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study

Ngày tải lên : 24/05/2014, 20:32
... thermal treatment for stress relieving, the calibration process indicated a fringe value of 6581 N/fr.m for the photoelastic material used In Fig (5) the isochromatic patterns associated to axial ... isochromatic fringe at the border, on the hole surface, the image of the isochromatic pattern was projected on a screen where, using the Tardy compensation method, the isochromatic fringe at nine ... points at the notch root region A, the influence of component size on the fringe pattern at region B and the presence of compression areas at region C 15 kg 30 kg 45 kg B A Figure Isochromatic patterns...
  • 9
  • 410
  • 0
Báo cáo hóa học: " Solvability of boundary value problems with Riemann-Stieltjes Δ-integral conditions for second-order dynamic equations on time scales at resonance" pptx

Báo cáo hóa học: " Solvability of boundary value problems with Riemann-Stieltjes Δ-integral conditions for second-order dynamic equations on time scales at resonance" pptx

Ngày tải lên : 20/06/2014, 22:20
... Ker L, 0) = Thus, the conditions of Theorem 2.4 are satisfied, that is, the operator equation Lx = Nx admits at least one solution in Dom L ∩ Therefore, BVPs (1.1) has at least one solution ... projector such that Ker Q = Im L Then, the equation Lu = Nu admits at least one nontrivial solution in Dom L ∩ ¯ Definition 3.2 A mapping f : [0, T]Ì × Ê × Ê → Ê satisfies the Carathéodory conditions ... Ê → Ê satisfy the Carathéodory conditions, then the mapping N is L-completely continuous Proof Assume that xn, x0 Î E ⊂ X satisfy ||xn - x0|| ® 0, (n ® ∞); thus, there exists M > such that ||xn||...
  • 18
  • 587
  • 0
báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf

Ngày tải lên : 21/06/2014, 00:20
... (1) that a(r) vanishes as r ® not faster than any power of r.) Hence, the order of system (3) is strongly degenerate at the point x = because of a > Let S be a non-degenerate matrix such that S ... relation (5) hold, and let natural k, ≤ k ≤ s - 1, be such that ak+1 ≤ (k) (k) n ak Then, there exists a unique matrix solution Qn (r) = qnij (r) of Equation 12 such that relation (21) holds, and boundary ... degenerate at a point Lithuanian Math J 41(4), 384–393 (2001) doi:10.1023/A:1013816706017 Rutkauskas, S: The Dirichlet problem with asymptotic conditions for an elliptic system degenerate at a...
  • 11
  • 399
  • 0
current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010

current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010

Ngày tải lên : 25/07/2014, 13:57
... 16.2% were treated at other outpatient clinics, 3.0% were treated at private clinics There are types of ARV treatment regimens for the AIDS patients before registering at the outpatient clinics ... Health staff directly participate in AIDS patient care and treatment at the outpatient clinics and in the community - Colleagues, co-ordinators - AIDS patient’s relatives: Father, mother, wife/husband, ... AIDS patients receiving the support from their relatives during ARV treatment are relatively high, the highest is couple patients, then father/mother patients and siblings patients; before treatment...
  • 27
  • 364
  • 0
Combined flow prediction and reservoir control system optimizes production at Hoa Binh docx

Combined flow prediction and reservoir control system optimizes production at Hoa Binh docx

Ngày tải lên : 13/08/2014, 22:21
... optimization of reservoir operation rule curves using historical data Implementation of the optimised rule curves with MIKE 11 then provides a base-line reservoir operation system This operation ... numerical optimization tool that is used to optimize different control variables defined for the reservoir operation strategies The optimization tool includes a general multi-objective optimization framework ... the river system and reservoir operations The structure operation module in MIKE 11 allows for the implementation of complex control strategies, whereby reservoirs can be operated by defining a...
  • 15
  • 203
  • 0
Combined flow prediction and reservoir control system optimizes production at Hoa Binh ppt

Combined flow prediction and reservoir control system optimizes production at Hoa Binh ppt

Ngày tải lên : 13/08/2014, 22:21
... lower and upper reservoir level curves Optimization of reservoir rule curves The control variables to be optimized consist of the reservoir water level curves and water level targets at the flood ... to simulate reservoir operation using the present regulations and the balanced Pareto-optimal solution The hydropower generated in the analysed flood seasons using the two operation strategies, ... Fig Simulated water level at the end of the flood season using, respectively, the present regulations and the balanced Pareto-optimal rule curves Real-time optimization Operation of reservoir...
  • 6
  • 217
  • 0
Unsteady flow in centrifugal pump at design and off design conditions

Unsteady flow in centrifugal pump at design and off design conditions

Ngày tải lên : 10/09/2015, 08:27
... qualitatively and quantitatively at different operating points for a diffuser pump 2.2 Mathematical Models 2.2.1 Basic governing equations For three-dimensional incompressible unsteady flow in stationary ... with recirculation flows at its inlet and exit, flow separation, and so on From the past researches, it showed that rotating impeller with highly complex blade curvature has great influence on ... simulation (LES) at design and off-design conditions At design load, the flow field inside the impeller is smooth and with no significant separation At quarter design load, a steady non-rotating...
  • 176
  • 336
  • 0
SCREENING FOR DIFFERENTIALLY EXPRESSED GENES IN DENGUE INFECTION UNDER ANTIBODY DEPENDENT ENHANCEMENT CONDITIONS

SCREENING FOR DIFFERENTIALLY EXPRESSED GENES IN DENGUE INFECTION UNDER ANTIBODY DEPENDENT ENHANCEMENT CONDITIONS

Ngày tải lên : 13/10/2015, 16:41
... illustrate terms used in ADE studies 16 1.7A/B Illustration of Fcγ-FcγR mediated ADE 17 1.8 Illustration of IgM-complement mediated ADE 18 1.9 Illustration of cross-binding antibody mediated ADE ... was postulated that classical pathway activation of complement by IgM results in attachment of complement protein C3 fragment to WNV The attachment of C3 fragment on the virus mediated ADE via ... neutralise DENV even at high concentration Unlike most anti-E antibodies which show neutralisation at higher concentration, antiprM fails to neutralise DENV at high concentration of 30µg/ml Not...
  • 250
  • 140
  • 0
Game Theory at Work - James Miller

Game Theory at Work - James Miller

Ngày tải lên : 03/10/2012, 15:19
... of your boats By destroying your boats, you limit your choices You can no longer take the easy way out of the battle by retreating Eliminating the option of retreating makes your threat credible ... stupid A strictly stupid strategy is a strategy that gives you a lower payoff than at least one of your other strategies, regardless of what your opponent does Knowing that your opponent will never ... battle for the castle, so you desperately pray for your enemy's surrender Since the enemy knows that it would lose the battle, one might think that it indeed should surrender Figure Unfortunately,...
  • 294
  • 685
  • 0
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Ngày tải lên : 26/10/2012, 09:39
... which indicated that genetic factors may play an important role in the pathogenesis of asthma Regulated upon activation, normal T-cell expressed and secreted (RANTES), which generated by T lymphocyte, ... that RANTES induces recruitment of eosinophils and their up regulation into the airways of asthmatic patients causing tissue damage [23-25] Both atopic asthma and nonatopic asthma are associated ... reciprocal of the SE) Discussion Regulated upon activation, normal T-cell expressed and secreted (RANTES) is a C-C chemokine that has been shown to be a potent chemoattractant for T cells, eosinophils,...
  • 7
  • 525
  • 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Ngày tải lên : 26/10/2012, 09:39
... the formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) ... with hematoxylin Western blot Protein extracts were prepared in lysis buffer and then repeatedly aspirated (20 times) through a 23-gauge needle followed by centrifugation at 4°C for 30 at 10,000 ... AngII, whether up-regulation of Cx43 can be antagonized by AT1 antagonists or whether suppressed smooth muscle cell proliferation and migration by AT1 antagonists are mediated through decreasing...
  • 8
  • 467
  • 0
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

Ngày tải lên : 26/10/2012, 09:53
... Mechanical complications and reconstruction strategies The exact rate of mechanical complications following hip spacer implantation remains unknown Despite numerous reports about these complications, only ... on the operated extremity, the patient should be rather considered as a candidate for a resection arthroplasty and not for a spacer implantation For prevention of any spacer dislocation due to ... data available that have demonstrated that the insertion of a metallic endoskeleton significantly improves the mechanical properties of hip spacers or reduces the rate of mechanical complications...
  • 6
  • 455
  • 0

Xem thêm