tqm tqm is a system of managing quality depends on the attendance of all members in an organization always increase the customer s satisfaction with improve quality find out solution to avoid defect and eliminate overlapping

Báo cáo toán học: "How frequently is a system of 2-linear Boolean equations solvable" ppsx

Ngày tải lên : 08/08/2014, 12:22

... Daud´ and V Ravelomanana, Random 2-XORSAT at the satisﬁability threshold, e LATIN 2008: Theoretical Informatics, 8th Latin American Symposium Proceedings, (2008) 12-23 [11] O Dubois and J Mandler, ... Wilson, The scaling window a of the 2-SAT transition, Random Structures and Algorithms, (2001) 201–256 [7] V Chv´tal and B Reed, Mick gets some (the odds are on his side), 33th Annual a Symposium ... Importantly, a monotone decreasing (increasing) graph function is a monotone decreasing (increasing) function of the code δ For the random graph G(n, p), the components of δ are independent random...

50
328
0

Báo cáo hóa học: "Existence of solutions and convergence analysis for a system of quasivariational inclusions in Banach spaces" pptx

Ngày tải lên : 21/06/2014, 00:20

... Cite this article as: Chen and Wan: Existence of solutions and convergence analysis for a system of quasivariational inclusions in Banach spaces Journal of Inequalities and Applications 2011 ... solutions to a system of variational inclusions in Banach spaces and established a strong convergence theorem in uniformly convex and 2-uniformly smooth Banach spaces Kamraksa and Wangkeeree [16] introduced ... q-uniformly smooth Banach space, and A1 , A2 , M1 and M2 be the same as in Theorem 3.4, and let T be a -Lipschitz continuous mapping Assume that Ω ∩ F(T) ≠ ∅, {an} and {bn} are sequences in [0, 1] and satisfy...

14
393
0

Báo cáo y học: "A mechanism of airway injury in an epithelial model of mucociliary clearance" doc

Ngày tải lên : 12/08/2014, 18:21

... mucociliary clearance on the frog palate A further objective was to analyze tissue and mucus samples in ultrastructural and molecular studies to characterize the nature of the injury and to assess the potential ... isopropanol in 4% ethanol and 8% acetic acid The presence of gelatinases (MMP and 9) was shown by clear bands (no staining) corresponding to MMP standards (MMP and 9) run in leftmost lane on the ... comparison of the scanning density of the MMP-9 bands since the MMP-2 control and sodium metabisulphite-treated tissue showed similar activation A significant increase in activated MMP-9 was seen...

9
301
0

Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt

Ngày tải lên : 12/08/2014, 13:22

... College Station, Texas) computer software was used for statistical analysis All interval data in tables and text are presented as mean with standard deviation in parentheses Data presented in graphs ... Centre, Toronto, Canada Department of Anesthesia, University of California, San Francisco at San Francisco General Hospital, San Francisco California, USA Authors’ contributions RK, DM and MM generated ... statistical analysis RK and MAM oversaw the research, helped analyzed the data and edit the manuscript All authors have read and have approved this manuscript Competing interests The authors declare...

8
351
0

Báo cáo y học: "Quality of life before intensive care unit admission is a predictor of survival" pptx

Ngày tải lên : 13/08/2014, 08:20

... (5 to 16) Hospital length of stay (days )a 23.0 (14 to 40) Ventilation days+ 6.0 (3 to 13) Type of admission (%) Nonsurgicalb Elective Statistical analysis A Pearson 's χ2 test was used to assess ... Other possibly relevant variables such as the presence of severe sepsis, length of ICU and hospital stay, and ventilation days were included in the logistic regression analysis However, because ... 50% to 70%]) [4] Page of (page number not for citation purposes) The advantages of using pre-admission HRQOL as a predictor of mortality are that it is easily obtained and available as soon as the...

7
609
0

Developing a system of exercises to improve public speaking skill in interpreting for the 4th year students of english at vinh university

Ngày tải lên : 25/12/2013, 20:21

... comparison 2.4 Findings and Discussion 2.4.1 Results and Discussion In this part, the data obtained from the questionnaires will be classified and analyzed on the following issues: - Students’ ... the participants and instruments of the study, as well as the procedure of the research The results of the investigation, the findings and the discussions are also presented in this chapter Chapter ... public speaking skill in interpreting and largely concentrates on developing some exercises to improve public speaking skill Within the scope of an graduation thesis and the constrains of time and...

71
689
1

Developing a system of games to enhance short term memory for interpreter students at vinh university

Ngày tải lên : 25/12/2013, 20:21

... understanding In contrast, inactive listening is simply being present when the conversation takes place without obtaining the information A person hears the words, but his mind is wandering and has ... to increase mutual understanding The interpreter with the duty of understanding the meanings and intentions expressed in SL and then expressing those ones in TL should practice to improve his active ... a person to recall something from several seconds to as long as a minute without rehearsal It is involved in the selection, initiation and termination of information-process functions such as...

64
541
0

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Ngày tải lên : 26/01/2014, 04:20

... levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also ... that 's pleasing to the eye They can this only if all of the important lighting sources within a scene have the same color temperature A combination of filters and electronic adjustments is used to ... measured The ideal contrast range for NTSC television is about twenty to one This corresponds to a difference of about four and one half fnumbers between the darkest and brightest parts of the...

6
462
1

Learning english is a piece of cake 1

Ngày tải lên : 27/01/2014, 20:11

... ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ɡlɪʃ æz mʌtʃ æz ˈp s ... ɡlɪʃ They think English is difficult and it s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can ...   In fact, she is a sales person! Improve = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn...

2
1.7K
15

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20

... preparedness are Multisector and Other; banking and financial services, and business and other services are Financing and Business; and government and civil society - general and conflict, peace, and security ... SRDBs are introducing innovations in microfinance and SME financing with instruments such as loans to financial intermediaries, financial support to productive chains and producer associations, and ... forestry, fishing, manufacturing, and tourism are Productive Sectors; social and personal services are Education, Health, and Social Services; and financial is Financing and Business (iv) CABEI:...

35
481
0

Tài liệu A System of Logic: Ratiocinative and Inductive 7th Edition, Vol. I ppt

Ngày tải lên : 18/02/2014, 12:20

... composed Sec The second general division of names is into concrete and abstract A concrete name is a name which stands for a thing; an abstract name is a name which stands for an attribute of a ... to him, the fact that Socrates was his son I further apply to him these other expressions: a man, a Greek, an Athenian, a sculptor, an old man, an honest man, a brave man All these are, or may ... ulterior analysis Logic is common ground on which the partisans of Hartley and of Reid, of Locke and of Kant, may meet and join hands Particular and detached opinions of all these thinkers will...

292
633
0

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

Ngày tải lên : 06/03/2014, 13:20

... expressions: a man, a Greek, an Athenian, a sculptor, an old man, an honest man, a brave man All these are, or may be, names of Sophroniscus, not indeed of him alone, but of him and each of an indefinite ... are almost always supposed to mean a substance There seems a kind of contradiction in using such an expression as that one thing is merely an attribute of another thing And the announcement of a ... by adopting, and occasionally by controverting, matter contained in his treatise The longest of the additions belongs to the chapter on Causation, and is a discussion of the question how far,...

1K
548
0

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Ngày tải lên : 07/03/2014, 03:20

... haematoxylin–phloxin–safran histological staining For determination of the number and minimal diameter of ﬁbres, histochemical immunostaining with a rabbit polyclonal antibody against laminin (Dako, Trappes, France; ... especially interesting, as CARP expression is increased in many different muscle diseases Considering that transforming growth factor-b, tumour necrosis factor -a and interleukin- 1a are known stimuli ... wasting, the expression of pivotal proteins involved in all the mechanisms discussed previously was investigated in denervationinduced atrophy, as well as in three animal models of LGMD and in the...

16
428
0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains ... core of an oligomeric ring formed by these AAA ATPases Thus many AAA ATPases function as protein disassembly machines [25] ATPase activity of Vps4 is critical for disassembling the MVB sorting machinery, ... material is available online: Fig S1 Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and ﬁdgetin from a range of species This material is available as part of the online...

23
490
0

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Ngày tải lên : 07/03/2014, 12:20

... cerato-platanin domain, and a blastp search always yielded the members of the cerato-platanin family as the best hits It is possible that they represent an ancestral cerato-platanin member that ... various carbon sources, plate confrontation assays, osmotic stress and starvation Although the TrichoEST database comprises ESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of ... proteins have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis ﬁmbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens...

14
494
0

Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc

Ngày tải lên : 15/03/2014, 20:20

... other financial and non-financial information used to analyze a company (e.g., disclosures in press releases, key performance indicators, and non-GAAP measures) and whether risks are appropriately ... process for assessing risk and developing financial assumptions and estimates; the company s critical judgments and accounting estimates; and the risk factors disclosure in the annual report OVERWIEV ... management However, investors noted that financial statements are often used only as a “prescreen” because investors and analysts today rely on a range of quantitative information and financial...

20
388
0

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Ngày tải lên : 16/03/2014, 14:20

... dephosphorylation assays were prepared using resin-based phosphorylation reactions in the presence of [32P]ATP[cP] In- solution phosphatase assays revealed that incubation with Mstp led to a decrease in the intensity ... resistance and the LAM ⁄ LM ratio The present study shows that EmbR serves as a substrate of multiple STPKs If each of the kinases senses its own signal amongst a plethora of environmental cues, as is ... courses of ATP and GTP hydrolysis by EmbR The release of Pi was measured, using the malachite green method, at various time points The Pi release was assayed when ATP or GTP was used as a substrate...

11
402
0

Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

Ngày tải lên : 17/03/2014, 23:20

... resulted in a significant reduction in lexical redundancy, with linguistic regularities and subregularities defined by means of TDFSS, in a lexicon that is succinctly organised, and that is also easier ... information, using YADU 's DefFill operation (Lascarides and Copestake, 1999), that has a TDFS as input and returns a TFS by incorporating all the default information into the indefeasible TFS, say at ... right-hand) As a consequence, during default unification non-default information can always be preserved and only consistent default information is incorporated into the defeasible TFS Another...

4
285
0

a system of integrated agricultural censuses and surveys potx

Ngày tải lên : 18/03/2014, 15:22

164
324
0

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Ngày tải lên : 22/03/2014, 17:20

... Tris ⁄ HCl-injected rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and was absent in samples from Tris ⁄ HCl-injected rats To demonstrate ... (CL) striatum (Fig 1C,D) To conﬁrm that the increased expression of BNIP3 after KA BNIP3 in excitotoxicity administration was caused by activation of kainate receptors, brain tissue was processed ... cell death (A) Transient transfection of rat hippocampal neurons resulted in DNA condensation and neuronal cell death (B) Transient transfection of rat hippocampal neurons with a dominant-negative...

9
388
0