Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling Lydie Laure 1 , Laurence Suel 1 , Carinne Roudaut 1 , Nathalie Bourg 1 , Ahmed Ouali 2 , Marc Bartoli 1 , Isabelle Richard 1 and Nathalie Danie ` le 1 1Ge ´ ne ´ thon-CNRS FRE3087, Evry, France 2 INRA de Theix, Saint Gene ` s Champanelle, France Muscle atrophy can result from disuse of the organ or be associated with ageing or severe systemic conditions such as diabetes, AIDS and cancer. It is also a feature common to many hereditary muscle diseases, including muscular dystrophies (MDs). Duchenne MD (DMD), caused by mutation in the dystrophin gene, is the most common form of the disease and is particularly severe: skeletal and cardiac muscles are affected, and the life- span of the patients is seriously impaired [1]. Limb girdle MDs (LGMDs) represent another important subgroup of MD, grouped together on the basis of common clinical features: they all primarily and Keywords CARP; FoxO1; muscle; p21 WAF1/CIP1 ; remodelling Correspondence I. Richard, Ge ´ ne ´ thon, CNRS FRE3087, 1 bis rue de l’Internationale, 91000 Evry, France Fax: +33 0 1 60 77 86 98 Tel: +33 0 1 69 47 29 38 E-mail: richard@genethon.fr (Received 31 July 2008, revised 20 October 2008, accepted 24 November 2008) doi:10.1111/j.1742-4658.2008.06814.x In an attempt to identify potential therapeutic targets for the correction of muscle wasting, the gene expression of several pivotal proteins involved in protein metabolism was investigated in experimental atrophy induced by transient or definitive denervation, as well as in four animal models of muscular dystrophies (deficient for calpain 3, dysferlin, a-sarcoglycan and dystrophin, respectively). The results showed that: (a) the components of the ubiquitin–proteasome pathway are upregulated during the very early phases of atrophy but do not greatly increase in the muscular dystrophy models; (b) forkhead box protein O1 mRNA expression is augmented in the muscles of a limb girdle muscular dystrophy 2A murine model; and (c) the expression of cardiac ankyrin repeat protein (CARP), a regulator of transcription factors, appears to be persistently upregulated in every condi- tion, suggesting that CARP could be a hub protein participating in com- mon pathological molecular pathway(s). Interestingly, the mRNA level of a cell cycle inhibitor known to be upregulated by CARP in other tissues, p21 WAF1/CIP1 , is consistently increased whenever CARP is upregulated. CARP overexpression in muscle fibres fails to affect their calibre, indicating that CARP per se cannot initiate atrophy. However, a switch towards fast- twitch fibres is observed, suggesting that CARP plays a role in skeletal muscle plasticity. The observation that p21 WAF1/CIP1 is upregulated, put in perspective with the effects of CARP on the fibre type, fits well with the idea that the mechanisms at stake might be required to oppose muscle remodelling in skeletal muscle. Abbreviations AAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI, 4¢,6-diamidino-2-phenylindole; DMD, Duchenne muscular dystrophy; EDL, extensorum digitorum longus; FoxO, forkhead box protein O; FP, fluorescent protein; LGMD, limb girdle muscular dystrophy; MAFbx, muscle atrophy F-box protein; MD, muscular dystrophy; MLC-2v, myosin light chain 2v; MLC-f, myosin light chain, fast; MuRF1, muscle RING finger protein 1; NF, neurofilament protein; NF-jB, nuclear factor-jB; qRT-PCR, quantitative RT-PCR; TA, tibialis anterior; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labelling; Ub, ubiquitin; UPS, ubiquitin–proteasome system; YFP, yellow fluorescent protein. FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 669 predominantly affect proximal muscles around the scapular and the pelvic girdles [2]. About 20 different forms of LGMD are currently recognized; among the most frequent are LGMD2A, LGMD2B and the sarcoglycanopathies (LGMD2C–F), caused by muta- tion in the calpain 3, dysferlin and sarcoglycan genes, respectively [2]. Disuse-induced atrophy and MDs might share some molecular mechanisms that are possibly involved in skeletal muscle wasting. Muscle atrophy results from the negative balance in the ratio between protein syn- thesis and protein degradation, hence leading towards protein wasting. One of the key players in the degrada- tion of myofibrillar proteins is the ubiquitin–protea- some system (UPS) [3]. The elimination process is initiated by labelling of the targeted proteins with mul- tiple ubiquitin molecules, and requires the coordinated action of three classes of enzymes known as E1 (ubiqu- itin-activating enzymes), E2 (ubiquitin-conjugating enzymes) and E3 (ubiquitin ligases) [4]. The ubiquitin– proteasome cascade is stimulated at many levels in several conditions leading to muscle wasting: the expression of proteasome subunits, the hydrolytic activity, and the general substrates ubiquitination [5]. In particular, the 14 kDa ubiquitin carrier protein E2 (E2-14 kDa) and two recently identified E3s, muscle atrophy F-box protein (MAFbx; also commonly called atrogin-1) and muscle RING finger protein 1 (MuRF1; also named TRIM63), are upregulated in many skele- tal muscle-wasting conditions [5]. During atrophy, expression of MAFbx and MurF1 is stimulated by the forkhead box protein O (FoxO) family of transcription factors, through inhibition of the Akt pathway [6,7]. In addition, it was also shown that transcriptional stimulation of MuRF1 is under the control of the nuclear factor-jB (NF-jB) pathway [8]. Even though the literature largely explores the con- vergent role of the UPS components in atrophy, mus- cle wasting is a complex mechanism in which specific, although poorly understood, pathways could play a role. In particular, cardiac ankyrin repeat protein (CARP) was suggested to be involved in these pro- cesses. CARP, together with ankyrin repeat domain- containing protein 2 (Ankrd2) and diabetes-related ankyrin repeat protein, forms a family of transcription regulators known as muscle ankyrin repeat proteins. These three isoforms share in their C-terminal region a minimal structure composed of several ankryrin-like domains possibly involved in protein–protein inter- action, PEST motifs characteristics of rapidly degraded protein, and a putative nuclear localization signal. CARP is expressed in both cardiac and skeletal mus- cles, and was reported to be either upregulated [9] or downregulated [10,11], depending on the atrophic situ- ation considered, and upregulated in hypertrophic con- ditions in heart [12–17] and in skeletal muscle [18–21]. From the functional point of view, in heart cells, CARP overexpression suppresses troponin C and atrial natriuretic factor expression [22], and its interaction with the transcription factor YB1 inhibits the synthesis of the ventricular-specific myosin light chain 2v (MLC- 2v) [23]. In vascular smooth muscle cells, increased CARP expression has been demonstrated to be associ- ated with upregulation of the protein p21 WAF1/CIP1 ,an inhibitor of the cell cycle [24]. Taken as a whole, these findings suggest that CARP coordinates the expression of genes involved in cell structure and proliferation, and could play a role during muscle mass variation. In an attempt to identify hub proteins that may be potential diagnostic markers or even therapeutic tar- gets for the correction of muscle wasting, the expres- sion of pivotal proteins involved in all the mechanisms discussed previously was investigated in denervation- induced atrophy, as well as in three animal models of LGMD and in the mdx mouse, a DMD model. Our study demonstrates that: (a) the UPS is transiently upregulated after denervation, consistent with its known role in atrophy, but it does not seem to be greatly activated in MD; (b) FoxO1 is a biological marker specific for the LGMD2A murine model; and (c) among all the genes considered, the expression of CARP, together with its downstream target, p21 WAF1/CIP1 , appears to be the only one that system- atically increases. CARP overexpression in muscle fibres fails to induce an atrophic phenotype, indicating that CARP per se cannot initiate the phenomenon. Nonetheless, the switch towards fast-twitch fibres observed in this situation, together with the observa- tion that the p21 WAF1/CIP1 expression pattern seems to reflect CARP level, suggests that CARP might play a role in muscle plasticity. Results The proteasome pathway components are only transiently upregulated, whereas increased CARP expression is maintained throughout denervation-induced-atrophy The expression of several factors possibly involved in atrophy was investigated by the evaluation of their mRNA level by quantitative RT-PCR (qRT-PCR) in conditions leading to transitory or definitive atrophy. The genes studied were those encoding: (a) two tran- scription factors involved in the control of muscle mass: NF-jB-p65 and FoxO1; (b) several components Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 670 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS of the UPS – ubiquitin (Ub), E2-14 kDa, two E3 ubiquitin ligases, MuRF1 and MAFbx, and the C2, C8 and C9 subunits of the proteasome; and (c) CARP, a transcriptional regulator associated with perturbation of muscle mass. Transient or chronic denervation of the posterior limb was induced and the mRNA levels were measured in tibialis anterior (TA) muscles at four different times following the initiation of the treat- ments (days 3, 9, 14 and 21). Atrophy was efficiently triggered by the treatment, as 40% of the TA weight was lost after 21 days of chronic denervation (Fig. 1A). When denervation was only transient, the TA weight also initially decreased, but slowly increased again from day 14 while innervation occurred [25] (sta- tistically higher than chronic denervation from day 14 to day 21, P < 0.05). 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control C9 0 50 100 150 200 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * 0 50 100 150 200 250 300 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control FoxO1 0 50 100 150 200 250 300 0 50 100 150 200 250 300 50 100 150 200 250 300 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * * ** 0 100 200 300 400 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control NF-kB 0 100 200 300 400 0 100 200 300 400 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control ** 0 50 100 150 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control E2 0 50 100 150 0 50 100 150 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control ** 1 10 100 1000 T0 T3 T9 T14T21 D0 D3 D9 D14D21 % of control MuRF1 1 10 100 1000 1 10 100 1000 T0 T3 T9 T14T21 D0 D3 D9 D14D21T0 T3 T9 T14T21 D0 D3 D9 D14D21 % of control * ** ** ** T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control MAFbx 1 10 100 1000 10 000 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * ** ** ** 15 20 25 30 35 40 45 50 Day 3 Day 9 Day 14 Day 21 TA weight (mg) 15 20 25 30 35 40 45 50 Day 3 Day 9 Day 14 Day 21 15 20 25 30 35 40 45 50 15 20 25 30 35 40 45 50 Day 3 Day 9 Day 14 Day 21Day 3 Day 9 Day 14 Day 21 Control Transient Definitive TA weight (mg) * * * * * 0 50 100 150 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control Ubiquitin 0 50 100 150 0 50 100 150 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * * * * * * ** ** T0 T3 T9 T14T21 D0 D3 D9 D14D21 % of control CARP 1 10 100 1000 10 000 100 000 T0 T3 T9 T14T21 D0 D3 D9 D14D21T0 T3 T9 T14T21 D0 D3 D9 D14D21 % of control * ** ** ** ** ** ** 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control C2 0 50 100 150 200 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * * 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control C8 0 50 100 150 200 0 50 100 150 200 T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21 % of control * ** A B Fig. 1. Effect of transient or definitive denervation on muscle weight and gene expression profiles. Male mice of the 129SvPasIco strain were treated transiently (T) by crushing or definitively (D) by section of the sciatic nerve. Samples were taken from six animals on each date (control, 3, 7, 9, 14 and 21 days after nerve injury). (A) Weight of TA muscles from control, crushed and sectioned limbs (n = 6 per time point). Other muscles of the lower limb, such as EDL and soleus muscles, present similar proportional loss of weight. P-values are shown as *P < 0.05 for significance between control and each time point, and as h P < 0.05 for significance between tran- sient and definitive denervation. (B) Each graph demonstrates the expression level for a gene of interest (FoxO1, NF-jB-p65, Ub, E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and CARP ) as assessed by qRT-PCR in TA muscles of treated animals (n = 2–6 for each time point). Results are expressed as percentage of expression level measured in the respective sham-operated muscles. *P < 0.05 and **P < 0.01 for significance between control and each time point; h P < 0.05 for significance between transient and definitive denervation. L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 671 The results showed that, with both transient and definitive denervation, FoxO1, NF-jB-p65 and several components of the UPS (subunits C2, C8 and C9, and the two E3s MuRF1 and MAFbx) were immediately and transiently upregulated, with higher variations in the case of the two E3s (note the logarithmic scale) Fig. 1B). After this initial increase, their expression returned rapidly to normal levels, even displaying a slight reduction for every proteasome subunit consid- ered (C2, C8 and C9). Ubiquitin mRNA levels decreased very early during the time course of atrophy, remaining very low when denervation was definitive, but progressively increasing again from the start of reinnervation when the sciatic nerve was only crushed (Fig. 1B). E2-14 kDa expression, which remained sta- ble when atrophy was only transient, was reduced at late stages (from day 14) of definitive denervation- induced atrophy (Fig. 1B). CARP expression increased with atrophy (Fig. 1B). Whereas CARP expression slowly decreased back to control level with the reduc- tion of atrophy in transient denervation, it stayed high when sciatic nerve regeneration was prevented. CARP upregulation was particularly important, as reflected by the logarithmic scale. CARP is robustly upregulated in murine MDs, whereas FoxO1 expression is increased specifically in C3-null animals The expression levels of the mRNAs measured in denervation conditions were also compared by qRT- PCR in several models of MD: a natural model of dysferlin deficiency [26], which we backcrossed on a C57BL/6 background and renamed B6.A/J-dysf prmd (model for LGMD2B), and three engineered models deficient in either dystrophin (mdx 4Cv [27]), calpain 3 (C3-null; unpublished), or a-sarcoglycan (Sgca-null [28]), models of DMD, LGMD2A and LGMD2D, respectively. Every strain was used at an age where the symptoms of the disease are detectable (4 months of age for all models except C3-null mice, which were evaluated at 7 months of age) and was compared to its respective control breed. The levels of mRNA expres- sion were measured in five muscles [quadriceps, extensorum digitorum longus (EDL), TA, soleus and psoas], chosen in order to reflect the muscle impair- ment specificity – which varies between models – and the type of fibres composing the muscle (see Experi- mental procedures). The results of qRT-PCR showed that the level of NF-jB-p65 was slightly increased in specific muscles of every murine model, especially in the two most inflam- matory models, mdx 4Cv and Sgca-null (Fig. 2). FoxO1 was upregulated to very similar levels in every muscle of the C3-null strain (about two-fold over control, with P < 0.05 for quadriceps, EDL and psoas), whereas its expression was slightly decreased in all the other models (Fig. 2). The expression of Ub was not affected in any of the four pathologies considered, whereas that of E2-14 kDa showed a tendency to decrease in several muscles (Fig. 2). In the mdx 4Cv model, the levels of the three proteasome subunits (C2, C8 and C9) were affected, C2 and C8 being downregulated and C9 upregulated. Unexpectedly, considering their role in atrophy, neither MuRF1 nor MAFbx expression increased in these animal models, their levels being even significantly reduced in some cases (Fig. 2). The most remarkable effect observed herein was robust upregulation of CARP mRNA (note the loga- rithmic scale) in most muscles of all models of MDs (Fig. 2). Interestingly, this increase seemed to be higher in the muscles strongly affected by the pathologies. The increase was far more important in the Sgca-null and in the mdx 4Cv models, two dystrophies character- ized by a similar pathogenesis and caused by a defect in one of the components of the dystrophin-associated glycoprotein complex. CARP is expressed at the protein level in myofibres of denervation-induced atrophy models and in mononucleated cells of highly regenerative MD animals Among all the genes whose expression was investi- gated in the different models of muscle disorder, we demonstrated that the CARP gene was the only one whose expression systematically increased, which is consistent with CARP’s role as a hub protein partici- pating in common pathological molecular pathway(s). CARP protein expression was hence measured by western blot in conditions of denervation-induced atrophy and in murine models of MD (Fig. 3). Inter- estingly, we observed that the protein was detected by western blot provided that the mRNA level reached 60-fold over the basal condition. This ele- ment probably accounts for the inability to detect CARP in many conditions in which its mRNA upregulation is indeed important, although not important enough. The protein was therefore detected from day 3 in both denervation conditions, remaining high until day 21 when the sciatic nerve was sectioned, but dropping to undetectable levels when reinnervation occurred during transient dener- vation (Fig. 3A, upper left panel). As regards the murine models of dystrophies, CARP protein was Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 672 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS Fig. 2. Gene expression profiles in murine models of MD. Each graph demonstrates the expression level for a gene of interest (FoxO1, NF-jB-p65, Ub, E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and CARP ) as assessed by qRT-PCR in quadriceps, EDL, TA, soleus and psoas muscles of C3-null, B6.A/J-dysf prmd , Sgca-null and mdx 4Cv animals (n = 3–4 for each point). Results are expressed as percentage of expres- sion level measured in the respective control muscles (129svPasIco and C57BL/6). P-values for significance between wild-type and deficient animals: *P < 0.05 and **P < 0.01. L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 673 detected in Sgca-null animals only (Fig. 3A, lower left panel). In order to clarify CARP cellular distribution within the muscle, immunodetection of the protein was performed on sections of muscles from denervated (3 days after denervation), a-sarcoglycan-deficient and dystrophin-deficient animals, and their appropriate control strains. Specificity of the CARP antibody was T0 T3 T9 T14 T3 C3-null 129SvPasIco T3 C57BL/6 B6.A/J-Dysf T3 CARP Ponceau red CARP Ponceau red Control Denervated Control Sgca-null Day3 after denervation Sgca-nullControl CARP Pax7 Merge 255.0 0.0 1440.0 pixels 1560.0 pixels 1440.0 pixels 1560.0 pixels 2550 0.0 A B C D E T21 D3 D9 D14 D21 Sgca-null C57BL/6 mdx 4cn mdx 4cn mdx 4cn 50 µm 50 µm 50 µm Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 674 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS first confirmed by the very specific staining observed in cultured HER911 cells transfected with a plasmid encoding CARP (data not shown). In all sections (con- trol, denervated and MD animals), intense staining was seen within scattered clusters of small myofibres (Fig. 3B). No difference in the number of these clusters was observed between conditions, indicating that the increase in CARP expression did not originate from these cells. In denervation-induced atrophy, additional diffuse checked-pattern staining of higher-calibre fibres was also detected, with a higher intensity in denervated muscles than in control sections (Fig. 3C). Considering the dystrophic process present in Sgca-null and mdx 4Cv animals, it is difficult to evaluate whether such upregu- lation also occurred in these models. In any case, very intense foci corresponding to the cytoplasm of small round cells flanking the muscle fibres were observed in Sgca-null and mdx 4Cv animals (Fig. 3D). These cells expressed Pax7, the first transcription factor activated during myogenesis (Fig. 3E). Immunostaining of the neurofilament protein (NF) failed to reveal any colo- calization with CARP (data not shown). The p21 WAF1/CIP1 gene expression profile parallels CARP in both MD and denervation-induced atrophy models In an attempt to dissect the molecular mechanisms activated downstream of the CARP gene, the gene expression of three relevant target genes chosen on account of CARP targets in cardiac and vascular tis- sues was measured by qRT-PCR in both denervation and MD models: the slow isoform of myosin light chain MLC-2v [23], its paralogous gene in skeletal muscle fast fibres, myosin light chain, fast (MLC-f), and the cell cycle inhibitor p21 WAF1/CIP1 [24]. Although it was previously reported to be expressed at low levels in skeletal muscle [29], MLC-2v gene expression remained undetectable in our conditions (data not shown). Whereas MLC-f expression was inversely correlated with CARP level in denervated animals, its level was generally unaffected, or even slightly increased, in muscles of MD models (data not shown). As neither MLC-2v nor MLC-f expression were corre- lated consistently with CARP level, neither of these proteins seems to be involved in the CARP signalling pathway in skeletal muscle. In contrast, in both dener- vation and MD models, p21 WAF1/CIP1 gene expression paralleled the CARP profile, i.e. increased when muscle degeneration occurred, and progressively decreased back to control level during the reinnervation phase of transient denervation (Fig. 4). It is worth mentioning that p21 WAF1/CIP1 upregulation was of the same order of magnitude as CARP upregulation, as reflected by the logarithmic scale. CARP overexpression in wild-type mouse TA muscle does not induce atrophy, but alters fibre type composition Considering that the upregulation of CARP persisted in definitive denervation and was consistent in MD models, we tried to understand its contribution to these conditions and therefore investigated its func- tion(s) in skeletal muscle. A pseudotyped adeno-associ- ated virus 2/1 (AAV2/1) vector in which the CARP coding sequence is fused with the yellow fluorescent protein (YFP) sequence was injected into the TA mus- cle of normal mice. One month after injection, direct observation of the skinned injected muscle using con- focal fluorescence microscopy allowed the visualization of a high level of YFP fluorescence. Measurement of the level of CARP mRNA by qRT-PCR confirmed strong expression of the transgene (more than 60 times the level of mRNA in the control experiment, P < 0.01; Fig. 5A,B). This was indeed reflected by the appearance of a band corresponding to CARP expres- sion in western blots (Fig. 5C). Fig. 3. Analysis of CARP protein level and cellular localization in denervation-induced atrophy and in murine models of MD. (A) In conditions of both transient (T) and definitive (D) denervation, the level of expression of CARP protein was assessed on equivalent amounts of lysate proteins resolved by western blot. The standardization of the loading was verified by Ponceau red staining. The expression of CARP protein correlates perfectly with the mRNA profile. The expression of CARP protein was estimated by the same method in the psoas muscle (all models but C3-null) or the deltoid muscle (C3-null mice) of the different MD models (comparison made in each case with the adequate wild- type strain). We previously verified that the upregulation of the level of CARP transcripts is similar in both deltoid and psoas in the C3-null strain (five-fold over wild-type control, data not shown). The results show that the upregulation of the expression of CARP protein can be visualized in the Sgca-null model only. (B) CARP was detected by specific immunostaining (in green) on transverse sections of control (129svPasIco), denervated (129svPasIco), Sgca-null and mdx 4Cv muscles. Staining with dystrophin (in red) was used to delimit the fibres. A view of each muscle taken with a 40· objective is presented, showing the very specific staining observed within clusters of small myofibres. Scale bars: 30 lm. (C) Surface plots representing the density of pixels from whole muscle sections after immunostaining show that CARP expression increases after denervation. Original images were processed using IMAGEJ software (8-bit images, Fire look-up table; http://rsb. info.nih.gov/ij/). (D) Very intense foci of mononucleated cells are observed in Sgca-null and mdx 4Cv muscles, but not in control muscles. Scale bars: 50 lm. (E) Costaining for CARP and Pax7 shows that the cells identified in (D) are positive for Pax7. L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 675 We next investigated whether any phenotype was apparent following CARP expression. In these condi- tions, the TA muscle weight was not affected (Fig. 5D). The histological appearance of the muscles was normal (Fig. 5E). Morphometric analyses per- formed on sliced muscles (Fig. 5F) revealed no differ- ences in terms of number or mean diameter of fibres in comparison with the untreated control, although the slight switch of the curve detected in the presence of CARP might reflect a tendency to generate bigger fibres. Muscle sections were negative for terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining, a marker of apoptosis (data not shown). As members of the CARP family were recently suggested to play a role in fibre typing [30], immunohistochemistry of sections was performed using an antibody against slow myosin. A shift towards a reduction of slow-twitch fibre type was observed in the presence of CARP (P < 0.05; Fig. 5G). Discussion In this study, in an attempt to identify proteins involved in the physiopathology of muscle wasting, we examined the variation in the expression levels of sev- eral atrophy-associated genes during transient and definitive denervation and in four models of MD. The main results gained from these studies are: (a) that the levels of essential components of the UPS are aug- mented rapidly and transiently during denervation- induced atrophy, but are not elevated in most MD muscles; (b) that FoxO1 mRNA expression is signifi- cantly increased in an LGMD2A model; and (c) that CARP is robustly upregulated in numerous murine MD models and in denervation-induced atrophy. First, in line with their documented role in atrophy [31–33], we demonstrated that the expression levels of most investigated components of the UPS increase transitorily during transient and definitive denervation. However, the mRNA expression levels of both Ub and E2-14 kDa, previously reported to be upregulated in atrophic conditions [5], do not increase, suggesting that neither protein is rate-limiting in this atrophic situa- tion. Consistent with this result, the role of E2-14 kDa has lately been reconsidered, as the inactivation of the corresponding genes does not seem to induce atrophy resistance, at least in the conditions tested [34]. In con- trast to the denervation situation, the mRNA expres- sion levels of the UPS elements were almost never increased in the four MDs tested, suggesting that the UPS is not overly activated in these diseases. Whether this reflects the slow progression of the diseases with respect to the atrophy phenomenon or weak involve- ment of the UPS in the pathogenesis remains to be determined. Second, FoxO1 was demonstrated to be specifically upregulated in every muscle of the C3-null strain. Besides raising the interesting possibility that FoxO1 could be used as a diagnostic marker for LGMD2A, our results indicate that FoxO1 expression increases as a consequence of the absence of calpain 3, either because of a functional relationship between the two proteins, or by a specific pathophysiological mecha- nism unique to calpain 3 deficiency. Regardless of its cause, this upregulation of FoxO1 is very likely to play an important role in the atrophy observed in this dis- ease, as its in vivo overexpression was previously dem- onstrated to induce reduction of muscle mass [6,35]. However, this phenomenon does not seem to proceed through MuRF1 and MAFbx, as their expression levels did not increase in our C3-null strain, but might p21 WAF1/CIP1 p21 WAF1/CIP1 Fig. 4. Gene expression profiles of p21 WAF1/CIP1 after transient or definitive denervation and in murine models of MD. The gene expression of p21 WAF1/CIP1 was measured by qRT-PCR in TA muscles subjected to denervation-induced atrophy (n = 2–6 for each time point), and in quadri- ceps, EDL, TA, soleus and psoas muscles of the four MD models (n = 3–4 for each point). T, transient denervation; D, definitive denervation. Results are expressed as percentage of expression level measured in the respective control muscles for MDs (129svPasIco and C57BL/6) or in the sham-operated muscles for denervation models. In every situation, p21 WAF1/CIP1 gene expression reflects CARP level. Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 676 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS instead involve other FoxO1-dependent signalling cascades, such as the autophagy pathway [36–38] and/ or the control of satellite cell proliferation [39], two mechanisms important for muscle mass regulation [40]. Provided that upregulation of FoxO1 is found also in LGMD2A patients, it seems highly likely that imped- ing FoxO1 increase and/or inhibiting its activity might improve the phenotype. 0 20 40 60 Control +CARP TA weight (mg) Control + CARP 0 20 40 60 80 100 Control + CARP ** * 0 5000 10 000 15 000 20 000 25 000 Control CARP CARP mRNA level (% of control) WB CARP Ponceau red + CARPControl 0 100 200 300 400 500 600 700 800 900 0–10 10–20 20–30 30–40 40–50 50–60 60–70 70–80 80–90 90–100 100–110 Control + CARP Fibre number/TA Fibre diameter (µm) Mean number of slow-twitch fibres/section ** A D F G B C E Fig. 5. Effect of CARP overexpression in muscle. (A) One month after intramuscular injection of AAV–CARP–FP into the TA muscle, trans- duction efficiency was visualized by fluorescence microscopy. Note that most observable fibres expressed the construct, apart from a few negative fibres, which reflected the fluorescence background level. Scale bar: 50 lm. (B) The level of CARP transcript overexpression was evaluated by qRT-PCR. Results are expressed as percentage of expression level measured in untransduced control muscles. n = 5–7; **P < 0.01 for significance between AAV–CARP–FP-injected TA muscle and contralateral control. (C) Expression of CARP protein was evalu- ated by western blot. Equivalent amounts of proteins were resolved, and Ponceau red staining was also used to confirm the standardization of the loading. (D) Weights of injected TA muscles (n = 13) were compared to those of control samples. No significant difference was observed. (E) Histological analyses of muscles. Frozen sections of injected TA muscles (right panel) stained with haematoxylin–phloxin–sa- fran show features identical to normal sections (left panel). Scale bars: 20 lm. (F) Morphometric analysis of muscles overexpressing CARP. The number of fibres and their minimum diameter in injected muscles are not significantly different as compared to the control (n = 4). (G) Slow fibres were detected using slow myosin immunostaining, and their numbers were determined on three slices of the TA muscle mid- section. The number of slow fibres is reduced significantly (*P < 0.05) in CARP-expressing muscles as compared to noninjected muscles, indicating that CARP can influence the fibre type (n = 6). L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 677 Third, the most striking evidence obtained from our investigation is that CARP expression appears to be persistently upregulated in denervation-induced atro- phy and is also elevated in all the MD models investi- gated. This last observation adds to the panel of muscle pathologies already reported to be associated with an increase in CARP expression: DMD, spinal muscular atrophy, facio-scapulo-humeral muscular dystrophy, amyotrophic lateral sclerosis, and peroxisome prolifera- tor-activated receptor-induced myopathy [41], as well as the mdx, Swiss Jim Lambert (SJL) and muscular dystrophy with myositis (MDM) animal models, defi- cient respectively in dystrophin, dysferlin and titin [42– 48]. Overall, CARP seems to be a general marker of muscle damage. The reason(s) for CARP upregulation remain(s) obscure, and whether CARP expression par- ticipates in or represents an attempt to resist the unre- lenting muscle degeneration is an important issue. It is of interest that CARP is the only protein show- ing a variation of profile between transient and defini- tive denervation, with persistence of upregulation in the latter condition. The CARP profile precisely reflects muscle atrophy, which could be consistent with the idea that CARP is an important factor in this mechanism. However, several facts support the idea that CARP probably has no active part to play in muscle atrophy per se. First, there is no consistent positive correlation between CARP expression and atrophic situations [9,11], and it can even be upregulated when skeletal muscle mass increases [18–21]. Second, in our hands, CARP overexpression in a normal muscle background failed to induce significant changes in the number and calibre of fibres. Interestingly, although CARP is upregulated to very similar levels in both denervation and MD models, two different CARP expression sites are observed, in Pax7-positive mononucleated cells and within the cyto- plasm of large myofibres, suggesting that CARP plays a role in myogenic activation, as well as in mature fibres. It is possible that a common molecular signal- ling pathway encompassing CARP and p21 WAF1/CIP1 occurs at these two locations. Indeed, among the three potential target genes tested herein, the p21 WAF1/CIP1 gene is the only one whose expression matches strictly with CARP level. In addition, p21 WAF1/CIP1 expression was observed at the same locations (proliferating myo- blasts [49] and terminally differentiated myotubes [50]) as CARP overexpression. First, in the skeletal myo- genic lineage, p21 WAF1/CIP1 upregulation leads to the irreversible withdrawal of myoblasts from the cell cycle, stimulates differentiation, and confers protection against apoptosis [49]. However, intense regeneration is still ongoing in both the Sgca-null and mdx 4Cv mod- els, which suggests that either p21 WAF1/CIP1 is not inhibiting the cell cycle or else that the inhibition pro- cess is not entirely efficient. Second, p21 WAF1/CIP1 has previously been reported to be upregulated within the myonuclei of denervated muscles, a location where it might be required to protect fibres against denerva- tion-induced apoptosis [50]. Taken as a whole, the findings in the MD and denervation models studied herein suggest that the systematic upregulation of p21 WAF1/CIP1 whenever CARP expression increases might oppose cell proliferation and/or inhibit apop- tosis, thus preventing muscle remodelling. It should also be noted that muscle ankyrin repeat proteins, which include CARP, have recently been sug- gested to be important for sarcomere length stability and muscle stiffness and to have an inhibitory role in the regenerative response of muscle tissue [30]. Here, we showed that CARP overexpression induces a switch towards fast-twitch fibres. All of these elements add to the previous observations related to the effects of p21 WAF1/CIP1 , and support the idea that CARP plays a global role in muscle plasticity. Accordingly, the main- tenance of CARP expression during chronic denerva- tion suggests that this protein plays an active part in this static condition and might contribute actively to the prevention of remodelling through blockade of adaptive pathways during deleterious muscle processes. Interestingly, besides MDs, CARP has been reported to be upregulated in many other pathological tissues (hypertrophic hearts [12–17], nephropathic kidneys [51], and wounded epidermis [52]), which suggests that CARP is a widely spread marker of tissue alterations. If the consequences of CARP overexpression prove to be detrimental for the skeletal muscle, impeding CARP expression would seem to be especially interest- ing, as CARP expression is increased in many different muscle diseases. Considering that transforming growth factor-b, tumour necrosis factor-a and interleukin-1a are known stimuli of CARP expression, pharmacologi- cally targeting these pathways might be an option. Indeed, as it has already been demonstrated that drug- mediated inhibition of tumour necrosis factor-a [53] or transforming growth factor-b [54] in the mdx mouse model greatly improves the muscle histology, it would be interesting to investigate the role of CARP in these signalling pathways. Experimental procedures Animals All mice were handled in accordance with the European guidelines for the humane care and use of experimental Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 678 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS [...]... TTTGGATTCCAGATTTGTGTTTGACAGACCA 392mC2.R: GGATCTGGGTTTTGCTTCCA 343mC8.F: TCTTGCAGACAGAGTGGCCA 391mC8.P: CGCTGTTAGACCTTTTGGCTGCAGTTTC 439mC8.R: CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT 83E2_14.F: GGGATTTCAAGCGATTGCAA... CGCCCCATCTGAAAACAACATCATGC 191E2_14.R: GGTGTCCCTTCTGGTCCAAA 1297mFoxO1.F: CTAAGTGGCCTGCGAGTCCT 1369mFoxO1.P: CCAGCTCAAATGCTAGTACCATCAGTGGGAG 1445mFoxO1.R: GTCCCCATCTCCCAGGTCAT 1235mMafBx.F, CTGGAAGGGCACTGACCATC 1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC 1353mMafBx.R, TGTTGTCGTGTGCTGGGATT 396mMLCfast.F: TGGAGGAGCTGCTTACCACG 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG... 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F AGGGCCATTGACTTTGGGAC 995mMurf1.P AGGAGGAGTTTACAGAAGAGGAGGCTGATGAG 1047mMurf1.R CTCTGTGGTCACGCCCTCTT M1833p65.F: GGCGGCACGTTTTACTCTTT M1857p65.P: CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT... ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA ultracentrifugation followed by dialysis against sterile NaCl/Pi After DNA extraction by successive treatments with DNase I and proteinase K, viral genomes were quantified by a TaqMan real-time... Cardiac ankyrin repeat protein in muscle plasticity L Laure et al 45 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac ankyrin repeat protein is preferentially induced in atrophic myofibers of congenital myopathy and spinal muscular atrophy Pathol Int 53, 653–658 46 Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam AP, Richmonds CR, Leahy P, Li J, Guo W & Andrade FH (2002) A chronic... 13, 364–376 42 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A web-accessible complete transcriptome of normal human and DMD muscle Neuromuscul Disord 12(Suppl 1), S125–S141 43 Nakamura K, Nakada C, Takeuchi K, Osaki M, Shomori K, Kato S, Ohama E, Sato K, Fukayama M, Mori S et al (2002) Altered expression of cardiac ankyrin repeat protein and its homologue, ankyrin repeat protein with PEST and proline-rich... doxorubicin CARP, a nuclear modulator of gene expression in cardiac progenitor cells and cardiomyocytes J Biol Chem 272, 22800– 22808 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien KR (1997) CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway Development 124, 793–804 Kanai H, Tanaka T, Aihara Y, Takeda S, Kawabata M, Miyazono K, Nagai R & Kurabayashi M (2001) Transforming... PCR assay using primers and probes complementary to the inverted terminal repeat region The primer pairs and TaqMan MGB probes used for inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS L Laure et al AACCC-3¢... RM, Opalenik SR, Wolf E, Goppelt A & Davidson JM (2005) CARP, a cardiac ankyrin repeat protein, is up-regulated during wound healing and induces angiogenesis in experimental granulation tissue Am J Pathol 166, 303– 312 53 Grounds MD & Torrisi J (2004) Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis FASEB J 18, 676–682 54 Cohn RD, van Erp C, Habashi JP, Soleimani AA,... atrophic muscles in amyotrophic lateral sclerosis Pathobiology 70, 197–203 44 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiacrestricted ankyrin- repeated protein is differentially induced in Duchenne and congenital muscular dystrophy Lab Invest 83, 711–719 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 683 Cardiac . TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F:. TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al. 680 FEBS Journal 276 (2009)