Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA Ub Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAA...
Ngày tải lên: 07/03/2014, 03:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢. Direct ... members of the Ras family of small G proteins. The activity of Ras proteins is under tight control of several classes of guanine nucleotide exchange factors (GEFs) and GTPase-act...
Ngày tải lên: 19/02/2014, 18:20
Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx
... 1283–1297. 24 Sakaki-Yumoto M, Kobayashi C, Sato A, Fujimura S, Matsumoto Y, Takasato M, Kodama T, Aburatani H, Asashima M, Yoshida N et al. (2006) The murine homolog of SALL4, a causative gene in ... USA) and flowjo software (TreeStar, Ashland, OR, USA). Mice and teratoma formation C57BL ⁄ 6J mice and MCH:ICR mice were purchased from CLEA Japan (Tokyo, Japan). All of the mice were mai...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf
... 5¢-TCCTCCACTATAAAAGGAAATG-3¢ and DELa forward 5¢-TTATAGTGGAGGAAAATAAGAC-3¢; DELb reverse 5¢-AACAGTCCATTTTAGTCCTT-3¢ and DELb forward 5¢-AAAATGGACTGTTCTTTCTT-3¢; DELc reverse 5¢-TACCTAGAAGAAAGAACAGT-3¢ ... several in-house antibodies against PTB, hnRNP A1 ⁄ A2 ⁄ C and H proteins and commercial antibodies against ASF ⁄ SF2 (Zymed, Carlsbad, CA, USA), SC35 (Sigma) and SRp55 (1H4 antibody, Zyme...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx
... prepare RNA ⁄ DNA hetero- duplexes, a 44 nucleotide long R01 RNA (5¢-GGGCG AAUUCAAAACAAAACAAAAC UAGCACCGUAAAGC Leishmania LeIF is an eIF 4A- like RNA helicase M. Barhoumi et al. 5096 FEBS Journal ... HindIII-cut plasmid was used to make a 45 nucleotide long K06 RNA (5¢-GGGC UAGC ACCGUAAAGCAAGUUAAUUCAAAACAAAAGCU-3¢). It was hybridized to the same 5¢ [ 32 P]-labeled DNA oligo- nucleotide...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
... revealed a band of approxi- mately 60 kDa, presumably the a chain of mature MSP (Fig. 1A) . Generation of a band of approxi- mately 30 kDa, presumably the b chain, was also detected by an anti-His ... peritoneal resident macrophages [1–3]. Mature MSP is a disulfide-linked heterodimer with a relative molecular mass of 80–95 kDa, consisting of an a chain of approximat...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a specific receptor for the antiapoptotic ubiquitin-like protein Scythe docx
... 1767–1777. 25 Kawahara H, Kasahara M, Nishiyama A, Ohsumi K, Goto T, Kishimoto T, Saeki Y, Yokosawa H, Shimbara N, Murata S, et al. (2000) Developmentally regulated, alternative splicing of the Rpn10 ... Kobayashi 1 , Keiji Tanaka 2 , Hideyoshi Yokosawa 1 and Hiroyuki Kawahara 1 1 Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, Japa...
Ngày tải lên: 30/03/2014, 11:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in ADP-bound and nucleotide-free forms. ... glycerol dehydratase-reactivating factor reactivates the inacti- vated hologlycerol dehydratase in a similar manner. Both dehydratase-reactivating factors exist as a 2 b 2 het...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... cellu- lar networks allows the simplification of the set of equations by assuming a steady state of the intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary ... design of bacterial strains based on mathematical models. Nishio et al. [15] provided simulation data of their model and discussed the agreement with literature experimental dat...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... becomes feasible for libraries in which a larger number of amino acids are varied simultaneously. Primordial protein catalysts may have had to manage with significantly fewer than the 20 amino acids ... in clinical isolates. Such rapid laboratory evolution may be useful to better anticipate the natural evolution of bacterial antibiotic resistance. Hydrolysis of aztreonam requires a...
Ngày tải lên: 19/02/2014, 12:20