Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx

Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast Mourad Barhoumi1, N K Tanner2, Josette Banroques2,3, Patrick Linder2 and Ikram Guizani1 ´ Laboratoire d’Epidemiologie et d’Ecologie Parasitaire, Institut Pasteur de Tunis, Tunisia ´ ´ ´ ´ ` Departement de Microbiologie et Medicine Moleculaire, Centre Medical Universitaire, Geneve, Switzerland ´ ´ ´ Centre de Genetique Moleculaire, CNRS, Gif-sur-Yvette, France Keywords ATPase; DEAD box; eIF4AIII; Leishmaniasis; unwindase Correspondance ´ I Guizani, Laboratoire d’Epidemiologie et d’Ecologie Parasitaire, Institut Pasteur de Tunis, 13 Place Pasteur, BP74, 1002 Tunis, Tunisia Fax: +216 71 791 833 Tel: +216 71 844 171 E-mail: ikram.guizani@pasteur.rns.tn (Received July 2006, revised 15 September 2006, accepted 18 September 2006) doi:10.1111/j.1742-4658.2006.05506.x LeIF, a Leishmania protein similar to the eukaryotic initiation factor eIF4A, which is a prototype of the DEAD box protein family, was originally described as a Th1-type natural adjuvant and as an antigen that induces an IL12-mediated Th1 response in the peripheral blood mononuclear cells of leishmaniasis patients This study aims to characterize this protein by comparative biochemical and genetic analysis with eIF4A in order to assess its potential as a target for drug development We show that a Histagged, recombinant, LeIF protein of Leishmania infantum, which was purified from Escherichia coli, is both an RNA-dependent ATPase and an ATP-dependent RNA helicase in vitro, as described previously for other members of the DEAD box helicase protein family In vivo experiments show that the LeIF gene cannot complement the deletion of the essential TIF1 and TIF2 genes in the yeast Saccharomyces cerevisiae that encode eIF4A In contrast, expression of LeIF inhibits yeast growth when endogenous eIF4A is expressed off only one of its two encoding genes Furthermore, in vitro binding assays show that LeIF interacts with yeast eIF4G These results show an unproductive interaction of LeIF with translation initiation factors in yeast Furthermore, the 25 amino terminal residues were shown to enhance the ability of LeIF to interfere with the translation machinery in yeast The leishmaniases constitute a group of diverse, worldwide-distributed, parasitic diseases caused by protozoan parasites of the genus Leishmania that are transmitted by female sandflies Leishmania are Trypanosomatidae protozoans having two main stages in their life cycle: intracellular amastigotes in the macrophage of mammalian host and motile promastigotes in the sandfly midgut [1] At least 20 species of Leishmania are pathogenic to humans Leishmaniases range from mild, often self-healing, cutaneous lesions to mucocutaneous, severely mutilating lesions, to fatal visceral leishmaniasis The clinical outcome of leishmanial infections depends on a complex interplay involving the host, vector, parasite and environmental determinants The annual incidence is two million cases in 88 countries The mainstay therapy is based on the use of pentavalent antimonials; no efficient vaccine is yet available [2] A number of Leishmania antigens have been cloned and characterized with respect to the immune responses elicited during experimental murine or natural human infections [3–13] Among these antigens, LeIF was described originally as an antigen that induces an IL12-mediated Th1 response in the peripheral Abbreviations eIF, eukaryotic initiation factor; EJC, exon junction complex; 5-FOA, 5-fluoro-orotic acid; GST, glutathione S-transferase; PABP, polyA-binding protein; PBMC, peripheral blood mononuclear cells; SD, synthetic dextrose; SF2, superfamily 5086 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al blood mononuclear cells (PBMC) of leishmaniasis patients, which also acts as a Th1-type natural adjuvant [8,10,11,14] Its importance in host–parasite interactions is not clear yet; several studies have highlighted its immunomodulatory properties on cells of healthy donors [8] Along with two other antigens, stress inducible protein (ST11) and thiol-specific antioxidant (TSA), LeIF is part of a trifusion recombinant protein vaccine, leish-111f, which proved efficient in significantly reducing the parasite load and size of the lesion in mice and in primate models [15] These recombinant proteins, when administered as a cocktail, were efficient for immunotherapy [16] Immunomodulatory activity leading to production of IL12 is thought to occur via a yet unknown receptor [14], as supported by the existence of a polarity in the molecule with respect to the levels of cytokine induced; the 226 amino terminal residues are sufficient for this activity [8,11,14] LeIF protein contains 403 residues and it shows high sequence similarity to the mammalian translation initiation factor eIF4A and to other homologues in lower and higher eukaryotes It is expressed both in the promastigote and amastigote parasite forms of all the different Leishmania species tested [8] Its role in the biology of the parasite is unknown In silico predictions and expression levels seem to indicate an involvement in the translation process [17], although recent alignments of the LeIF protein from Leishmania braziliensis and Leishmania major with eIF4A from other organisms show some divergence [18] The purpose of this work is to characterize the LeIF protein by a comparative biochemical and genetic analysis with its apparent homologue in yeast, eIF4A, in order to assess its potential as a target for drug development The eIF4A-like proteins are the archetype of the DEAD box family of proteins [19] The DEAD box helicases belong to superfamily (SF2) in the classification of Gorbalenya and Koonin [20] All members of the DEAD box family share nine conserved amino acid motifs [21–24], including the sequence Asp-GluAla-Asp (D-E-A-D) that inspired their name Members of the DEAD box family are found in a wide range of organisms, including bacteria and eukaryotes ranging from yeast to humans, and they are implicated in virtually every cellular process involving RNA These include transcription, ribosomal biogenesis, pre-mRNA splicing, RNA export, translation, and RNA degradation [25–27] In vitro analyses of purified proteins show an RNA-dependent ATPase activity and in some cases ATP-dependent unwinding activity [28–31] The solved crystal structures of various DEAD box proteins, including yeast eIF4A, show a core structure that Leishmania LeIF is an eIF4A-like RNA helicase consists of two RecA-like domains connected by a flexible linker [21,32–34] The tertiary structure of this core can be largely superimposed on the solved crystal structures of other SF1 and SF2 helicases, which suggests a common mechanistic theme among these helicases [21,34] The eIF4A-like helicases are close to the minimal size constituting the core structure alone [21,24,34] Translation initiation in eukaryotes involves a series of steps that result in the recruitment of a translation-competent 80S ribosome to the initiation codon of an mRNA The process is catalyzed by a large number of eukaryotic initiation factors (eIFs) Among these factors, eIF4A is part of the translation initiation complex eIF4F that binds to the cap structure of mRNAs, in conjunction with eIF4E and eIF4G, to promote the binding of the 40S ribosomal subunit to the mRNA and the subsequent scanning for the initiation AUG codon [35,36] eIF4A has been proposed to facilitate the ‘melting’ of secondary structures in the 5¢ untranslated region of the mRNA during the scanning process [35–38] Translation initiation in trypanosomatidae protozoans is not well characterized; translation factors were identified according to their sequence similarities to known factors in other organisms Among these factors, polyA-binding protein (PABP) from Trypanosoma cruzi, Trypanosoma brucei and L major have been identified [39–41] The eIF4F components of L major have been predicted [17], and the analysis of the eIF4E component of the eIF4F complex has been initiated [42] However, little is known regarding the role of these factors in translation In this work we studied the biochemical properties of purified, recombinant, LeIF protein from Leishmania infantum, and we demonstrate that it is an RNA-dependent ATPase and an ATP-dependent RNA helicase Sequence alignments show that LeIF is closely related to known eIF4A factors, but its closest homologue in humans is DDX48, also known as eIF4AIII, which plays a role in nonsense-mediated mRNA decay and nuclear mRNA splicing [43–46] Genetic studies in the yeast Saccharomyces cerevisiae provided evidence that LeIF can impair cell growth and can associate with yeast proteins involved in translation initiation, although it is not able to complement the deletion of the yeast-encoded eIF4A Finally, in vitro coimmunoprecipitation experiments show that LeIF interacts with the yeast translation initiation factor eIF4G Our results also point to the importance of the 25 amino terminal residues in enhancing the ability of the protein to interfere with the translation machinery of yeast All this confirms an unproductive interaction of FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5087 Leishmania LeIF is an eIF4A-like RNA helicase M Barhoumi et al LeIF with translation initiation factors in yeast and interest for it as a potential drug target Results Sequence analysis LeIF protein of L infantum has 98% and 100% identity with LeIF proteins of L braziliensis and L major, respectively [11] The alignment shown in Fig and summarized in Table compares the LeIF protein of L infantum with eIF4A-like proteins from humans, mouse and yeast IF41 and IF42 are identical between mice and humans while DDX48 shows only three differences IF41 and IF42, also called eIF4AI and eIF4AII, are known translation initiation factors in mammalians, as is eIF4A in yeast [35] IF42 is functionally equivalent to IF41 but its tissue-specific expression and developmental regulation is somewhat different DDX48 is involved in splicing and nonsensemediated mRNA decay [44–46] It cannot substitute for IF41 in ribosome binding assays, it inhibits translation in vitro in reconstitution experiments, and its affinity for eIF4G is somewhat different from that of eIF4AI [47] Fal1 (for eIF4A-Like) is a nucleolar protein involved in ribosomal biogenesis [48] It has 56% identity with yeast eIF4A, and it cannot substitute for eIF4A in vivo Fig Sequence comparison of L infantum LeIF with eIF4A homologues CLUSTALW alignment shows the comparison of the predicted amino acid sequences of L infantum eIF4A (LieIF), with the eIF4A-like proteins from human (Hu), and yeast (Sc) The mouse equivalents are essentially the same as the human Conserved motifs found in RNA helicases, are as indicated in light blue (Q, I–VI) Identical amino acids shared between the proteins are shown in magenta and green Asterisk indicates fully conserved residues; colon means that substitutions are conserved; period means that substitutions are semiconserved 5088 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al Leishmania LeIF is an eIF4A-like RNA helicase Table Protein characteristics and sequence homology to LeIF The L infantum LeIF protein sequence was used to find similar proteins using BLAST2.0 on the EMBnet web site (http://www.ch.embnet.org) using the SwissProt and TrEMBL databases and the default settings CLUSTALW analyses were also carried out on the EMBnet site with the default setting All values are relative to LeIF Molecular mass (m) and pKi were calculated through ExPASy web site (http://www.expasy.org/) Hu, human; Mus, mouse; Sc, S cerevisiae %Similarity includes conserved and semiconserved substitutions E value, a measure of the expected random matches % Similarity E Value LeIF DDX48_Hu (P38919) DDX48_Mus (Q91VC3) IF42_Hu (Q14240) IF42_Mus (P10630) IF41_Hu (P60842) IF41_Mus (P60843) eIF4A_Sc (P10081) Fal1_Sc (Q12099) 403 411 411 407 45327 46871 46840 46402 5.83 6.30 6.30 5.33 — 55.6 55.6 56.3 — 85.9 85.9 84.6 — e)118 e)118 e)117 406 46154 5.32 56.1 84.1 e)115 394 399 44566 45213 5.02 9.09 54.6 52.6 83.4 83.9 e)109 e)104 The mammalian protein with the closest similarity to LeIF is DDX48, although the predicted pKi of LeIF is intermediate between the IF proteins and DDX48 The differences on the sequence level seem to be randomly distributed on the carboxyl terminal RecA-like domain (domain 2) while they tend to be more clustered in the amino terminal domain (domain 1) In particular, the most notable differences are seen in the sequence upstream of the isolated, highly conserved phenylalanine of the recently identified Q motif [49] and between motifs I and II The LeIF protein has all the conserved motifs characteristic of DEAD box helicase (motifs Q, I, Ia, Ib, II, III, IV, V, and VI) that are known to be important for ATP binding and hydrolysis, for RNA binding and for RNA unwinding This prompted us to characterize its biochemical activities and compare them to yeast eIF4A LeIF protein has an RNA-dependent ATPase activity We subcloned the LeIF gene into a pET22b plasmid containing a carboxyl terminal His6 tag, expressed the protein in the Origami Escherichia coli strain and purified the soluble protein by nickel-nitrilotriacetic acid agarose chromatography (Fig 2) We estimated the protein to be greater than 90% pure after this column We also cloned, expressed and purified a mutant in motif I (K76A) as a control; a similar mutation in eIF4A disrupts ATP binding and ATPase activity [49,50] The identity of the proteins was verified using antibodies raised against His and LeIF (data not shown) The purified recombinant proteins were used in ATPase assays that measured the free phosphate released, in the presence of commercially available total yeast RNA, with a colorimetric assay based on molybdate- elF4A % Identity Δ25LeIF pKi LeIF m (Da) GST-elF4G Length (aa) MW Protein (Accession no.) 209 K 124 K 80.0K 49.0K 34.8K 28.9K 20.6K Fig Expression and purification of the proteins used Aliquots of purified His6-LeIF, His6-D25LeIF, His6-eIF4A and GST-eIF4G protein were resolved by SDS polyacrylamide gel and stained with Coomassie brilliant blue The positions of the Bio-Rad prestained markers (in kDa) are indicated at the left The K76A mutant of LeIF had purity similar to LeIF (not shown) Malachite Green [49,51] The optimal reaction conditions were determined for the wild-type LeIF and yeast eIF4A proteins LeIF showed a sharp peak around pH 6.0, and there was little activity at pH 5.0 or below and a gradual decrease at pH 6.5 and above A similar profile was obtained for eIF4A Likewise, both LeIF and eIF4A were more active with acetate ions than chloride, with a peak activity around 10–20 mm The divalent cation optimum was 1–5 mm for LeIF and 1– mm for eIF4A The ATPase activity for both proteins was saturated at the RNA concentration typically used (500 ngỈlL)1), but LeIF showed saturation at a FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5089 Leishmania LeIF is an eIF4A-like RNA helicase M Barhoumi et al lower concentration (around 100–200 ngỈlL)1 RNA) than eIF4A, which suggested a higher affinity for RNA This was consistent with electrophoretic mobility shift assays (EMSA) that indicated LeIF had roughly a two-fold higher affinity (data not shown) ATPase activity was directly proportional to the enzyme concentration for both proteins, which showed that they were probably functional as monomers As expected the LeIF mutant with a substitution in motif I (K76A) showed no significant ATPase activity The amount of ATP hydrolyzed for LeIF and eIF4A increased in a time-dependent manner in the presence of saturating concentrations of total yeast RNA (Fig 3A) Thus, the LeIF protein exhibited an RNAdependent ATPase activity that is characteristic of proteins from the DEAD box family A 50 The nucleotide specificity of LeIF protein was assessed using different NTPs and dNTPs Both ATP and dATP were efficiently hydrolyzed in the presence of RNA, as was found for eIF4A [49] The other NTPs and dNTPs had no effect As shown in Fig 3, the Michaelis–Menten parameters were determined with variable concentrations of ATP at saturating concentrations of RNA We determined the Km for ATP of LeIF to be 350 ± 120 lm, the kcat was 72 ± s)1 and the kcat ⁄ Km was 0.21 ± 0.7 s)1Ỉlm)1 LeIF was inhibited by ADP, which had a binding affinity similar to that for ATP We also determined the kinetic parameters for eIF4A However, ADP binds eIF4A with a higher affinity than ATP [49], which made our measurements less reliable, especially at higher ATP concentrations Nevertheless, the values were in the same range as those for LeIF with a Km of 250 ± 90 lm, a kcat of 39 ± s)1 and a kcat ⁄ Km of 0.16 ± 0.06 s)1Ỉlm)1 These values of eIF4A are similar to those obtained by other workers [30,52] [PO4]µM 40 LeIF protein has an ATP-dependent RNA helicase activity in vitro 30 20 10 0 B 20 40 60 Time (min) 80 100 0.7 Velocity (µM/min) 0.6 0.5 0.4 0.3 0.2 0.1 0 0.5 1.0 1.5 2.0 [ATP] mM 2.5 3.0 3.5 Fig Kinetic measurements of the ATPase activity of LeIF (A) An example of a time course for the ATPase activity of 540 nM LeIF with nM (n), 50 nM (s), 100 nM (+), 400 nM (m), mM (r), or mM (n) ATP in the presence of 500 ngỈlL)1 RNA The control consisted of mM ATP and no RNA (h) The K76A mutant control of LeIF showed ATPase activity comparable to the control (not shown) (B) Michaelis–Menten plot of the medium values of three independent experiments 5090 To test whether LeIF has an RNA unwinding activity in vitro, we constructed two RNA ⁄ DNA heteroduplexes containing 44 or 45 nucleotide long RNAs and a 16 nucleotide long DNA that could hybridize on either the 5¢ or 3¢ end of the RNAs (Fig 4A) It was previously shown that RNA ⁄ DNA duplexes are substrates for RNA helicases as long as the single-stranded region is RNA; it functions as the initial binding site for the proteins [21,51,53] As shown in Fig 4B,C, LeIF and eIF4A were able to unwind both the 5¢ and the 3¢ duplexes when they were in 20-fold excess of the substrate There was significant unwinding in the absence of ATP, which probably reflected the intrinsic affinity of the protein for the RNA at these high protein concentrations However, there was approximately 30% more unwinding activity in the presence of ATP This relatively poor ATP-dependent helicase activity of eIF4A proteins has been noted previously [53] The 5¢ duplex was unwound more efficiently than the 3¢ duplex with both proteins, but we not consider this evidence for directionality Rather, this probably reflects the intrinsic properties of the duplexes themselves Although the same oligonucleotide was hybridized on both RNAs (calculated DG ẳ 19.8 kcalặmol)1 under standard conditions), the 5¢ duplex had a slightly lower Tm, which probably resulted because the 5¢ duplex RNA (K06) could form a moderately stable (calculated DG ẳ 4.5 kcalặmol)1) intramolecular hairpin that could compete for the FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al Leishmania LeIF is an eIF4A-like RNA helicase A B LeIF eIF4A LeIF eIF4A 15 30 60 15 30 60 15 30 60 Duplex 15 30 60 Duplex Duplex Olgo C 100 %Free 80 mM ATP no ATP 60 Duplex LeIF eIF4A Duplex LeIF eIF4A 40 0 15 30 60 15 30 60 15 30 60 15 30 60 20 Time(min) Fig Unwinding activity of LeIF (A) The same 5¢ [32P] end-labeled DNA oligonucleotide was hybridized to two RNA transcripts that yielded 3¢ and 5¢ duplexes (B) Time course for ATP-dependent unwinding of 3¢ and 5¢ duplexes by LeIF protein Briefly, 50 nM of duplex were incubated with lM protein with or without mM ATP, at 30 °C, for the times indicated in minutes To prevent reannealing of the displaced [32P]-labeled oligonucleotide, lM cold DNA oligonucleotide was added as a competitor Products were separated on a 15% polyacrylamide gel, which was then subject to autoradiography and quantification (C) Comparison of the relative helicase activities of LeIF to yeast eIF4A oligonucleotide binding site (NK Tanner, unpublished data) Thus, it is important to incorporate the properties of the substrates when interpreting the unwinding activity of the helicases LeIF cannot complement the deletion of eIF4A Our biochemical analyses showed that LeIF had very similar properties to yeast eIF4A However, this provided only circumstantial evidence that LeIF is a translation initiation factor Consequently, we used genetic studies in the yeast S cerevisiae to understand the potential role of LeIF in the translation initiation process In order to test whether the LeIF gene can complement the deletion of the essential TIF1 and TIF2 genes in yeast, which encode eIF4A, we subcloned the LeIF gene into both low and high copy number yeast plasmids, p415-PL-ADH and p424-PL-ADH, respectively, containing strong, constitutively expressed, ADH promoters [49] We also cloned the LeIF gene in an equivalent plasmid containing a galactose-inducible promoter p424-PL-GAL As a control, the yeast eIF4A gene was cloned into the same vectors The various constructs were transformed into the yeast strain SS13-3A, where both chromosomal copies of the essential eIF4A genes were deleted and eIF4A was expressed off the YCplac33-TIF1 (CEN-URA3) plasmid [49] Because this plasmid contained a URA3 marker we could selectively eliminate it from transformed cells by plating them on 5-fluoro-orotic acid (5-FOA)-containing medium Thus, the protein encoded by the transforming plasmid could ensure growth of the yeast only if it had the ability to complement for the missing function Protein expression was verified by western blot analysis of cell extracts separated on 12% SDS Laemmli gels and revealed with anti-HA IgG (data not shown) None of the LeIF-containing plasmids were able to support yeast growth at any temperature tested (18 °C, 30 °C, and 36 °C) These data showed that LeIF could not substitute for the yeast eIF4A Likewise, purified LeIF protein did not support translation in an in vitro reconstitution assay using rabbit reticulocytes (M Altmann, University of Bern, Switzerland, unpublished data) In experiments similar to those previously described, we also transformed a yeast strain deleted for the FAL1 gene, encoding the Fal1 protein, which has a clearly different function from eIF4A, with the various LeIF constructs None of them supported growth on 5-FOA-containing medium (data not shown) Thus, LeIF cannot substitute for the Fal1 protein LeIF protein inhibits cells growth While our in vivo complementation assays failed to reveal a role for the LeIF protein, we did notice that cells expressing the protein were less vigorous after transformation It is possible that LeIF was interfering with the cellular machinery by interacting with, and sequestering, yeast factors involved in translation We tested this by transforming the various LeIF constructs into the yeast SS3 strain that has the TIF2 gene replaced by a cassette carrying the URA3 gene and a second TIF1 gene under the control of the CYC1- FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5091 100 000 M Barhoumi et al 10 000 1000 100 10 Leishmania LeIF is an eIF4A-like RNA helicase LeIF 25LeIF eIF4A Control Fig Dominant-negative phenotype of the LeIF gene Yeast SS3 cells were transformed with the plasmids containing the LeIF gene, the D25LeIF gene, yeast TIF1 (eIF4A) or the p424-PL plasmid alone (control) Cells were grown in liquid minimum (SD) medium lacking tryptophan to the same density, serially diluted and lL of each dilution was spotted onto SD minus Trp-containing plates The plates were incubated at 30 °C The numbers refer to the amount of dilution GAL promoter Because the expression of the TIF1 gene under its own promoter is several-folds lower than that of the TIF2 gene [54], this strain produces less eIF4A protein on glucose-containing medium than a normal strain, but it can be induced for higher eIF4A production on galactose-containing medium This strain was previously used to see dominant-negative phenotypes of eIF4A mutations [54] Cells expressing the full-length LeIF showed strongly reduced growth on glucose-containing medium compared to the cells transformed with the vector alone or with the plasmid carrying the TIF1 gene (Fig 5) The difference in growth however, was not observed on galactosecontaining medium (data not shown) Cells constitutively expressing yeast eIF4A also showed slightly reduced growth relative to cells with the plasmid alone, but not nearly as strongly as with LeIF (Fig 5) This presumably reflected the altered stoichiometry of the translation initiation factors that caused inefficient assembly of the initiation complex The first 25 amino terminal residues interfere with translation machinery in yeast In order to identify the part of LeIF protein that is implicated in this inhibition, we cloned a construct of LeIF that was missing the first 25 amino terminal residues (D25LeIF) This construct was made because the amino termini showed the most differences between proteins (Table 1) and because a similar construct of 5092 yeast eIF4A could complement growth (NK Tanner, unpublished data) As shown in Fig 5, expression of the D25LeIF protein showed the same growth profile as overexpression of eIF4A Thus these amino terminal residues enhanced the ability of LeIF to interfere with the cellular machinery We verified this result by measuring the doubling time of cells expressing the various constructs in liquid culture containing glucose Cells were grown at 30 °C with continuous shaking in minimal medium lacking tryptophan [synthetic dextrose (SD)-Trp] The absence of revertants or loss of plasmids was verified at the end of the incubation by streaking culture aliquots on SD-Trp plates Three independent cultures were made for full-length LeIF and two independent cultures were made for the other constructs The cells expressing full-length LeIF grew about 50% less rapidly than the cells transformed with the plasmid alone, with a doubling time of 5.0 h versus 2.5 h, respectively Overexpression of eIF4A showed a slight inhibitory effect (3.0 h) as did the D25LeIF (3.3 h) To rule out the possibility that the deletion of the amino terminus affected the expression or stability of the protein, total cellular proteins were extracted from exponentially growing cells (D600 ¼ 0.8), separated on an SDS Laemmli gel, transferred to nitrocellulose membrane and analyzed by a western blot analysis using anti-HA and anti-LeIF IgG The results showed that the recombinant HA-tagged D25LeIF protein had a stable expression comparable to the HA-tagged LeIF protein (data not shown) Interaction between LeIF protein and GST-eIF4G in vitro The dominant-negative phenotype that we observed with the LeIF protein suggested that it was capable of interacting nonproductively with the yeast translation initiation factors, which resulted in translation inhibition However, a more trivial explanation was that expression of the LeIF protein had a general toxic effect on the cells that was unrelated to translation per se This possibility was unlikely because increased expression of yeast eIF4A largely reversed the effect Nevertheless, we decided to verify that LeIF could interact with components of the eIF4F complex Previous studies in yeast have shown that the 542–883 fragment of eIF4G interacts with eIF4A in vitro [55] We purified this fragment, which was expressed in E coli as a glutathione S-transferase (GST) fusion protein (Fig 2) and used it to generate a glutathione-sepharose affinity column The LeIF recombinant proteins [wild- FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al Leishmania LeIF is an eIF4A-like RNA helicase +eIF4G eIF4A Load +eIF4G Control +eIF4G Load LeIF Load 25 LeIF 124 K 80.0K 49.0K 34.8K 28.9K Fig Interaction between recombinant His6-LeIF, His6-D25LeIF or His6-eIF4A with GST-eIF4G in vitro Five micrograms of GSTeIF4G (+ eIF4G) or buffer alone (Control + GST) were incubated with GSH-Sepharose beads and lg of LeIF, D25LeIF or eIF4A as described in Experimental procedures Proteins retained by the matrix were eluted with glutathione and resolved by SDS ⁄ PAGE The blot was then probed with anti-His-tag (shown), anti-LeIF, antieIF4A, and anti-GST IgG Lanes Load correspond to the purified proteins loaded onto the matrix, + eIF4G correspond to proteins bound to eIF4G and subsequently eluted with glutathione, and Control is LeIF protein eluted from the matrix without GST-eIF4G The positions of marker proteins (in kDa) are indicated at the left type (wt) and D25LeIF] were then loaded onto columns with the bound eIF4G and washed The retained proteins were eluted with reduced glutathione, separated on an SDS Laemmli gel, transferred to a nitrocellulose membrane and then subjected to western blot analysis using anti-GST, anti-LeIF and anti-His-tag IgGs As a control, we carried out the same experiment with recombinant yeast eIF4A The results showed that recombinant LeIF and D25LeIF were capable of binding to the column with the yeast GST-eIF4G fusion, but not to GST alone (Fig 6) Similarly, the yeast eIF4A was retained on the GST-eIF4G column Interestingly, a minor degradation product of LeIF was preferentially retained on the column by the GST-eIF4G in some experiments, probably as a result of protease cleavage while bound to the matrix The visible contaminants on the Coomassie blue-stained gel were extracted and sequenced with a MALDI-TOF mass spectrometer; the 23 kDa fragment corresponds to the carboxyl terminal region consisting of domain and residues just amino terminal to motif III Although previous studies showed it is the amino terminal domain of eIF4A that binds to eIF4G [56], recent NMR studies indicate that, although both domains and interact with the middle domain of eIF4G, it is the carboxy terminal domain that forms the main interactions [52] The result that the LeIF carboxyl terminal domain was selectively retained in some experiments would imply that the LeIF interactions with eIF4G are similar to those of eIF4A Regardless, these results show that LeIF protein can interact with yeast eIF4G in vitro, and they suggest that a similar interaction could occur in vivo We used the purified eIF4G to determine whether it would enhance the ATPase activity of LeIF as previously observed with eIF4A [56] The eIF4G elution buffer, probably the glutathione, was strongly inhibitory in the ATPase assay, and the eIF4G required extensive dialysis against the binding buffer We found up to a 50% enhancement of the ATPase of eIF4A and a smaller enhancement with LeIF However, the primary effect of eIF4G is to enhance the affinity of eIF4A for the RNA [56], and our conditions may not have been optimized to see this More extensive kinetic analyses are needed, but these preliminary experiments show a small eIF4G-dependent enhancement of the ATPase activity of both eIF4A and LeIF Discussion The antigenic properties of Leishmania LeIF protein are well characterized Indeed all studies highlight the peculiar and unique characteristics of this protein that lead researchers to consider it as a Th1-type natural adjuvant and as an immunotherapeutic molecule against intracellular pathogens However, little is known about its biological role The sequence homology with eIF4A implies a role as a translation initiation factor [10,11] although other sequence analysis shows a more distant relationship [18] The Leishmania genome encodes for two genes annotated as eIF4A (http://www.genedb.org/) These identical isoforms, borne by chromosome 1, are identified in L infantum as LinEIF4A1 (LinJ01.0780 and LinJ01.0790), which encode for LeIF protein Another gene, LinEIF4A2 (LinJ28.1600) on chromosome 28, encodes for a similar protein that has only 49% identity with LeIF, and it is predicted to be 14 amino acids shorter This work was undertaken to characterize the biochemical properties of the LeIF protein and to compare its biochemical and genetic properties with its counterpart in yeast, eIF4A The in vitro biochemical studies show that LeIF protein is an RNA-dependent ATPase that has the ability to unwind RNA ⁄ DNA heteroduplexes in an ATPdependent manner As is true of the other DEAD box proteins characterized, nucleotide binding and hydro- FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5093 Leishmania LeIF is an eIF4A-like RNA helicase M Barhoumi et al lysis activity of LeIF is dependent on the presence of RNA, and it is specific to ATP and dATP [21,22,24,34] This ATPase activity can be abolished by a mutation of the conserved lysine (K76A) in motif I, which is consistent with studies of other helicases, such as eIF4A [50] and yeast Has1 [57]; this confirms the importance of this motif in nucleotide binding Indeed, crystallographic analyses of yeast eIF4A [32] and viral NS3 [58] have shown that this residue contacts the a, b and sometimes c phosphates of the bound NTP The LeIF protein has a Km for ATP binding around 350 lm, which is similar to that reported for other DEAD box proteins such as human p68 [59], yeast eIF4A ([30,52] and this study), yeast Has1 [57] and E coli DbpA [60] This value, which is below the cellular concentration of ATP (5–10 mm), indicates that LeIF can bind and hydrolyze ATP in the cell cytoplasm The kcat measured for ATP hydrolysis by LeIF, 1.2 min)1, is in the range of kcat values for eIF4A (1 min)1 for the mammalian factor [61] and 0.65 min)1 for the yeast factor; this study), E coli SrmB (1.2 min)1 [62]) and RNA helicase II (1.9 min)1 [63]) but is much lower than that of yeast Ded1 (300 min)1 [28]), yeast Prp22p (400 min)1 [31]) and E coli DbpA (600 min)1 [60]) This relatively weak ATPase activity measured in vitro could reflect low intrinsic catalytic activity Alternatively, the lack of post-translational modifications in the recombinant protein or the absence of specific substrates may contribute to the low activity Of the DEAD box proteins that have been studied biochemically, only DbpA from E coli shows a strong RNA substrate specificity [60,64] It also may be due to the absence of protein cofactors; the ATPase and helicase activities of eIF4A purified from rabbit reticulocyte lysates are increased in the presence of eIF4F, eIF4B and eIF4H [30,53] Recently, it was shown that cpc3 – the central domain of eIF4G that binds eIF4A – stimulates the ATPase activity by about 40-fold by lowering the K RNA by 10-fold and by m raising the kcat by 4-fold [56] We see only a slight eIF4G-specific enhancement of the ATPase activity with eIF4A and LeIF, but our assay conditions were probably not optimized Nevertheless, our results are consistent with the published data, which implies a functional interaction between eIF4A and LeIF with eIF4G The recombinant LeIF protein exhibits poor ATPdependent duplex unwinding activity in vitro as shown previously for eIF4A [30] The unwinding in the absence of ATP is found significant, which is consistent with an intrinsic (ATP-independent) affinity of the protein for RNA We demonstrate that LeIF protein can exert its activity in a bidirectional way and unwind 5094 RNA ⁄ DNA heteroduplexes that have either a 3¢ duplex relative to the loading strand or a 5¢ duplex This suggests that LeIF acts nonprocessively, and it is only capable of unwinding short RNA duplexes The majority of RNA helicases studied so far are thought to have directional unwinding Nevertheless, Ded1, eIF4A and p68 were reported to unwind duplexes in both directions in vitro [49,51,59] Although LeIF has similar biochemical properties to the eIF4A proteins from other organisms, there are some differences between LeIF and the yeast eIF4A that include a wider range for the optimum magnesium concentration, a similar affinity for ATP and ADP, and a higher affinity for RNA These differences could reflect fundamental differences in the dynamics of the interaction of the protein within the eIF4F complex or within the translation machinery In this regard, the eIF4B protein has not been described so far and was not uncovered by the Leishmania or Trypanosoma sp genome projects (http://www.genedb.org/) Translation initiation in mammals and yeast is well studied; it involves many RNA–RNA, protein–RNA, and protein–protein interactions In contrast, knowledge about the process of protein synthesis in Trypanosomatidae protozoans is inferred by indirect evidence, such as sequence similarities between individual translation factors with homologues from higher eukaryotes Recently, Dhalia et al [17] reported the in silico identification of multiple potential homologues of the three eIF4F components, eIF4E, eIF4A, and eIF4G These putative eIF4F components are expressed at similar levels and relative stoichiometry as those described for yeast and other eukaryote systems [17] In particular, the L major LmEIF4A1, which shows 100% identity with LeIF, is readily detected in the promastigote as a very abundant protein, which also is true for eIF4A from mammals and yeast [65,66] Nevertheless, our results show that LeIF cannot substitute for the yeast eIF4A in spite of the high sequence identity between the two proteins Moreover, it does not support translation in vitro in reconstitution assays (M Altmann, unpublished data) However, these results are not surprising because the mammalian proteins not support growth in yeast either [67] Expression of LeIF in genetically engineered yeast strains where endogenous eIF4A is expressed off only one its two encoding genes results in severe growth inhibition Our experimental results exclude the possibility of a general toxic effect, or a difference in the expression levels or stability of LeIF in yeast; this suggests that LeIF can interact with the endogenous yeast factors within the translation initiation complex Interestingly, our results also emphasized the role of the FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al 25 amino terminal residues of LeIF in its interactions with the cellular machinery Deletion of this part (D25LeIF), which is the part most divergent from eIF4A, abolishes the severe dominant-negative phenotype of LeIF However, this variant also did not complement the eIF4A double-deletion strain on 5-FOA plates The simplest explanation for our results is that LeIF protein can assemble with the yeast proteins to form stable, but nonproductive, interactions that inhibit translation initiation The stability or severity of these interactions are correlated with the 25 amino terminal residues because deletion of them gives a slight dominant-negative phenotype that is comparable to that obtained with overexpression of the yeast eIF4A on the same ADH promoter Thus, both D25LeIF and the excess eIF4A sequester the translation initiation factors in a more transient, or less inhibitory, fashion This implies that full-length LeIF also could act as a translational inhibitor of the mammalian host cells In higher eukaryotes, eIF4A is assumed to be recruited to the mRNA through its interaction with eIF4G, which acts as a molecular adapter that coordinates all steps in translation initiation [68] It was also shown that interactions between this fragment and eIF4A are important for translation initiation and cell growth in yeast [55] Our in vitro binding assay demonstrated that LeIF can interact with the central domain of yeast eIF4G, preferentially through its carboxy terminal domain, as has been previously noted for eIF4A [52] It is likely that this interaction occurs in vivo as well and that this is, at least partially, the cause of the dominant-negative phenotype This is further supported by data showing that Leishmania LmEIF4G protein can bind both LmEIF4A1 and human eIF4A in vitro [17] The role of the 25 amino terminal residues is unclear, but they may form interactions with other factors such as eIF4E In our sequence comparisons, LeIF shows the closest similarity with DDX48 However, with the exception of two to four spliced genes, the vast majority of trypanosomatid mRNA processing involves trans-splicing; no exon junction complex (EJC) has been identified [69,70] Nonsense-mediated mRNA decay, which is associated with the very early steps of translation, has been described in yeast to humans [71], but it is unknown so far in trypanosomatids [69] Furthermore, a recent study indicates that TbEIF4AIII in T brucei, which is similar to LmEIF4A2 in Leishmania, is the closest orthologue to eIF4AIII [72] Taken together, it is unlikely that LeIF plays the same role as DDX48 within the promastigotes and amastigotes of Leishmania Yeast too lacks an EJC, although the downstream Leishmania LeIF is an eIF4A-like RNA helicase sequence element probably serves a similar role in nonsense-mediated decay [71] Although there is evidence that DDX48 is more closely related to Fal1 than to eIF4A in yeast [18], it is unlikely that they play the same roles because Fal1 is located predominantly in the nucleolus, and it is thought to be involved in ribosome biogenesis [48] Thus, a DDX48-like function probably does not exist in yeast either It is therefore intriguing that it is the amino terminus that shows the highest sequence divergence among these proteins (LeIF, DDX48, eIF4A and Fal1; Fig and data not shown) Because it is the amino terminus of LeIF that confers the strong dominant-negative phenotype in yeast, it is possible that this short sequence modifies the function of the RecA domains or alters their interactions with other factors Our results provide evidence for the potential involvement of LeIF in the translation machine in Leishmania This is further supported by data recently published that used RNAsi in T brucei [72] The high identity scores of Leishmania sp LeIF with proteins from other Trypanosomatidae species, such as T brucei and T cruzi (http://www.genedb.org/), which are pathogens responsible for human African trypanosomiasis and Chagas disease, respectively, provides evidence that LeIF could be functional homologue of eIF4A, and that they all use similar mechanisms for translation initiation This is supported by the similar biochemical properties of LeIF and yeast eIF4A Nevertheless, definitive evidence must wait for the development of an in vitro translation system for Leishmania However, the potential interactions of these proteins with the host systems in the particular context of each infectious process also will need to be defined Antigenic properties of LeIF, a cytosolic protein, could result from the infectious process when macrophages are lysed and the amastigotes, and the contents of the parasitophorous vacuoles, are released and scavenged by macrophages LeIF could also be involved in direct interactions with the host cell and thereby constitute a virulence factor It will be important to see if LeIF expression affects translation in mammalian cells as it does in yeast, and whether it has cytotoxic effects because of its sequence similarity to eIF4AIII In this regard, it is interesting that Leishmania EF1a, which is another ubiquitous protein with antigenic properties [73], is able to diffuse into the cytosol of L donovani infected macrophages and inactivate them [74] EF-1a plays an important role in eukaryotic protein biosynthesis by binding aminoacyl-tRNAs and positioning them in the A site of ribosomes However, the cytoplamic Leishmania EF-1a binds the host’s Scrhomology-2-containing tyrosine phosphatase (SHP-1) FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5095 Leishmania LeIF is an eIF4A-like RNA helicase M Barhoumi et al and thereby activates it; this leads to macrophage deactivation [74] It also is interesting to note that some of the proposed Leishmania pathoantigens are conserved proteins that are organized into multimolecular complexes to form subcellular particles; homologues of some of them are involved in autoimmune diseases [75] Finally, it is interesting that DDX48 was shown to be an autoantigen in pancreatic cancers [76] Clearly, additional work will be needed to clarify the role of LeIF in Leishmania infections To conclude, our results support using LeIF as a potential drug target Experimental procedures Cloning and mutagenesis The entire LeIF gene, and the sequence coding for the protein deleted for the first 25 amino terminal residues, were amplified from genomic DNA of L infantum parasite by PCR using 5¢ oligonucleotides containing SpeI and NdeI sites and a 3¢ oligonucleotide containing an XhoI site The sequences of oligonucleotides used for PCR amplification were as follow: (1) the entire LeIF gene 5¢ oligo (LeIF2_up; GCGCGACTAGTCATGGCGCAGAATGATAAGATCG) and 3¢ oligo (LeIF2_low; GCGCGCTCGAGCTCAC CAAGGTAGGCAGCGAAG; the underlined nucleotide was a silent mutation added to disrupt a stable hairpin in the oligo); (2) the LeIF deletion 5¢ oligo (GCGCGACTAG TCATATGCCGTCCTTCGAC) and the 3¢ oligo as above A mutation in motif I (K76 fi A) of LeIF was made using the fusion PCR technique [77] In brief, the 5¢ and 3¢ regions flanking the site of mutation were independently PCR amplified with oligonucleotides containing the mutation and the oligonucleotides specific to the 5¢ or 3¢ ends of the ORF (LeIF2_up & LeIF2_low) The two PCR fragments were purified on a 0.9% agarose gel, and a second PCR reaction was done with an aliquot of each fragment and the 5¢ and 3¢ flanking oligonucleotides The PCR products were purified on 0.9% agarose gel and cloned into a Bluescript plasmid (Stratagene, La Jolla, CA, USA) cut with SpeI and XhoI Sequences were confirmed by DNA sequencing Protein expression and purification LeIF variants were subcloned into a pET-22b vector (Novagen, San Diego, CA, USA) cut with NdeI and XhoI, and they were expressed in the Origami E coli strain (Novagen) Cultures were inoculated with single colony and grown overnight in Luria-Bertani (LB) medium containing ampicillin (100 lgỈmL)1) Five hundred millilitres of fresh medium was then inoculated with 10 mL of the overnight culture and incubated at 30 °C with shaking The bacterial 5096 cultures were induced with 0.4 mm isopropyl thio-b-d-galactoside at D600 of 0.4 and incubated for an additional three hours Cells were harvested by centrifugation The pellet was then resuspended in mL of lysis buffer (20 mm Tris-base pH 8.0, 300 mm NaCl and 10 mm imidazole) containing mm phenylmethanesulfonyl fluoride Cells were lysed by adding lysozyme to a final concentration of 10 mgỈmL)1 and the solution was incubated on ice for 30 with occasional mixing The lysed cells were sonicated (4 · 20 s) to reduce viscosity, and then centrifuged for 30 at 15 000 r.p.m in a SS34 rotor (Sorvall, Boston, MA, USA) at °C The supernatant was loaded onto a mL nickel-nitrilotriacetic acid-agarose column (Ni-nitrilotriacetic acid; Qiagen, Hilden, Germany) equilibrated with lysis buffer The column was washed with 20 mL of lysis buffer containing 20 mm imidazole and the protein was eluted with lysis buffer containing 100 mm imidazole The eluted protein was stored until needed in 50% glycerol at )80 °C Protein concentration was determined by the BioRad (Hercules, CA, USA) Protein Assay with BSA as the standard Purity and concentrations were verified on a 12% Coomassie-stained SDS polyacrylamide gel Yeast eIF4A expression and purification were as previously described [49] ATPase assays and analysis We used a colorimetric assay based on molybdate-Malachite Green as described previously [49,51] Buffer conditions were optimized for LeIF protein (50 mm potassium acetate, 20 mm Mes pH 6.0, mm magnesium acetate, 100 lgỈmL)1 BSA, and mm dithiothreitol) or for eIF4A (same as for LeIF except with mm magnesium acetate) Reactions were in 50 lL volume containing 25 ngỈlL)1 of protein, mm ATP and 500 ngỈlL)1 of total yeast RNA (type III Sigma; Sigma-Aldrich, St Louis, MO, USA; phenol-chloroform extracted) Reactions were incubated at 30 °C for various times, stopped by adding lL of 0.5 m EDTA, pH 8.0, and pipetted into 96 well microtiter plate to which 150 lL of molybdate-Malachite Green was added Absorbance was measured at 630 nm The phosphate concentration was determined from a dilution series of known phosphate concentration (0–60 lm) measured at the same time The background signal was determined by measuring the reactions in the absence of protein, in the absence of RNA substrate or in the absence of ATP Data were analyzed using kaleidagraph 3.6 (Synergy, Reading, PA, USA) Unwinding assay Preparations of substrates were similar to those described previously [49,51] Briefly, to prepare RNA ⁄ DNA heteroduplexes, a 44 nucleotide long R01 RNA (5Â-GGGCG AAUUCAAAACAAAACAAAACUAGCACCGUAAAGC FEBS Journal 273 (2006) 50865100 ê 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al AAGCU-3¢) was transcribed off a HindIII-cut pGEM-3Z using T7 RNA polymerase The RNA transcribed was annealed to a 5¢ [32P]-labeled DNA oligonucleotide (5¢-ATC GTGGCATTTCGTT-3¢), complementary to the underlined RNA sequence This substrate is called 3¢ duplex because it has the double-stranded region at the 3¢ end of the RNA transcript Another HindIII-cut plasmid was used to make a 45 nucleotide long K06 RNA (5¢-GGGCUAGC ACCGUAAAGCAAGUUAAUUCAAAACAAAAGCU-3¢) It was hybridized to the same 5¢ [32P]-labeled DNA oligonucleotide at the sequence underlined This substrate is called 5¢ duplex Unwinding assays of LeIF were carried out in the presence of a 25-fold excess of unlabeled DNA oligonucleotide (trap DNA) because the oligonucleotide would efficiently reanneal under our reaction conditions Reactions were in 10 lL volumes consisting of 50 nm duplex, 12.5 lm unlabeled oligonucleotide, 20 mm Mes, pH 6.0, 50 mm potassium acetate, mm magnesium acetate, 10 mm dithiothreitol, 0.1 mgỈmL)1 BSA, lL)1 RNasin (Promega, Madison, WI, USA), various concentrations of protein and mm ATP were used Assays with eIF4A were the same except mm magnesium acetate was used Reactions were incubated at 37 °C for various times and then quenched by placing them on ice A lL solution of 40% glycerol, 10 mm EDTA, 0.025% Bromophenol Blue and 0.025% Xylene Cyanole was added and the sample was loaded onto a 0.75 mm thick 15% polyacrylamide gel (29 : 1) The gel was subjected to electrophoresis in a MiniProtean apparatus (Bio-Rad) at °C for h at 16 W with 100 mm Tris-base, 90 mm boric acid and mm EDTA running buffer The radioactive bands within the gel were detected with a Cyclone phosphoimager (Packard [PerkinElmer], Wellesley, MA, USA) and quantified using the optiquant software (Packard) Yeast strains, vectors and genetic manipulation Yeast manipulations, including media preparations, growth conditions, and 5-fluoro-orotic acid (5-FOA) selection, were carried out according to standard techniques [78] The LeIF gene cloned into the Bluescript vector was subcloned into p415-PL and p424-PL vectors containing two HA tags, and SpeI, NdeI, and XhoI restriction sites [49] Complementation was tested by transforming the eIF4A-deletion strain, SS13-3A (tif1::HIS3 tif2::ADE2), containing the YCplac33TIF1 (CEN-URA3) plasmid [49] We also transformed a strain (DFAL1 YDK1-1C) deleted for the Fal1 gene (fal1::KANMX4 with FAL1-pRSA416) [48] To assay for dominant negativity of LeIF we used strain SS3 (tif2::URA3-CYC1-GAL-TIF1) [54] In vitro binding assays We obtained a plasmid (pGEX-6P1-542–883) encoding for residues 542–883 of yeast eIF4G fused to the carboxyl Leishmania LeIF is an eIF4A-like RNA helicase terminus of GST as a kind gift of M Altmann [55] The protein was expressed in E coli and extracted as described above The protein was then loaded on a Glutathione Sepharose 4B column according to the manufactor’s recommendations (Amersham-Pharmacia, Uppsala, Sweden) The protein was eluted with glutathione and assayed for purity on an SDS Laemmli gel (Fig 2) About lg of recombinant GST-eIF4G was immobilized on approximately 75 lL of glutathione-sepharose 4B resin that was suspended in 300 lL of binding buffer (20 mm Tris-base, 150 mm NaCl This material was incubated with approximately lg of LeIF or eIF4A in a final volume of 500 lL binding buffer for h at °C Following four washing steps with mL of binding buffer, bound proteins were eluted with 30 mm glutathione in 50 mm Tris-base, pH 8.0 and resolved by SDS ⁄ PAGE The retained proteins were eluted, separated on an SDS Laemmli gel, transferred to nitrocellulose membrane and then subjected to western blot analysis with rabbit anti-LeIF primary polyclonal antibodies (1 : 1000 dilution), anti-HA IgG (1 : 5000), anti-His-tag (1 : 2000, Cell Signaling, Danvers, MA, USA) and with rabbit anti-GST (1 : 15000 dilution; a kind gift of O Deloche, University of Geneva, Switzerland) Antigen–antibody complexes were revealed using peroxydase-coupled secondary antibodies and diamino-benzidine Acknowledgements We thank Michael Altmann for providing us with pGEX-6P1-eIF4G and Gerhard Wagner for sending us a preprint of his paper We thank Sayda Kamoun for help with preparation of rabbit anti-LeIF, Olivier ` Deloche for the anti-GST IgG and Monique Doere for excellent technical help We are grateful to Olivier Cordin for technical help, advice, and fruitful discussions This study received financial support from the UNICEF ⁄ UNDP ⁄ World Bank ⁄ WHO special programme for research and training in tropical diseases, TDR (ID: A30134), from the Tunisian Ministry of Scientific Research, Technology and Development of Competencies (Contrat programme 2004-08 grant to IG) and by a Swiss National Science Foundation grant to PL References de Almeida MC, Vilhena V, Barral A & Barral-Netto M (2003) Leishmanial infection: analysis of its first steps A review Mem Inst Oswaldo Cruz 98, 861–870 Herwaldt BL (1999) Leishmaniasis Lancet 354, 1191– 1199 Echeverria P, Dran G, Pereda G, Rico AI, Requena JM, Alonso C, Guarnera E & Angel SO (2001) Analysis of the adjuvant effect of recombinant FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5097 Leishmania LeIF is an eIF4A-like RNA helicase 10 11 12 13 14 M Barhoumi et al Leishmania infantum Hsp83 protein as a tool for vaccination Immunol Lett 76, 107–110 Handman E, Button LL & McMaster RW (1990) Leishmania major: production of recombinant gp63, its antigenicity and immunogenicity in mice Exp Parasitol 70, 427–435 Handman E, Symons FM, Baldwin TM, Curtis JM & Scheerlinck JP (1995) Protective vaccination with promastigote surface antigen from Leishmania major is mediated by a TH1 type of immune response Infect Immun 63, 4261–4267 Masina SMMG, Demotz SO & Fasel NJ (2003) Protection against cutaneous leishmaniasis in outbred vervet monkeys using a recombinant histone H1 antigen J Infect Dis 188, 1250–1257 Mougneau E, Altare F, Wakil AE, Zheng S, Coppola T, Wang ZE, Waldmann R, Locksley RM & Glaichenhaus (1995) Expression cloning of a protective Leishmania antigen Science 268, 563–566 Probst P, Skeiky YA, Steeves M, Gervassi A, Grabstein KH & Reed SG (1997) A Leishmania protein that modulates interleukin (IL)-12, IL-10 and tumor necrosis factor-alpha production and expression of B7–1 in human monocyte-derived antigen-presenting cells Eur J Immunol 27, 2634–2642 Ramiro MJ, Zarate JJ, Hanke T, Rodriguez D, Rodriguez JR, Esteban M, Lucientes J, Castillo JA & Larraga V (2003) Protection in dogs against visceral leishmaniasis caused by Leishmania infantum is achieved by immunization with a heterologous prime-boost regime using DNA and vaccinia recombinant vectors expressing LACK Vaccine 21, 2474–2484 Skeiky YA, Guderian JA, Benson DR, Bacelar O, Carvalho EM, Kubin M, Badaro R, Trinchieri G & Reed SG (1995) A recombinant Leishmania antigen that stimulates human peripheral blood mononuclear cells to express a Th1-type cytokine profile and to produce interleukin 12 J Exp Med 181, 1527–1537 Skeiky YA, Kennedy M, Kaufman D, Borges MM, Guderian JA, Scholler JK, Ovendale PJ, Picha KS, Morrissey PJ, Grabstein KH et al (1998) LeIF: a recombinant Leishmania protein that induces an IL-12-mediated Th1 cytokine profile J Immunol 161, 6171–6179 Tonui WK, Mejia JS, Hochberg L, Mbow ML, Ryan JR, Chan AS, Martin SK & Titus RG (2004) Immunization with Leishmania major exogenous antigens protects susceptible BALB ⁄ c mice against challenge infection with L major Infect Immun 72, 5654–5661 Webb JR, Kaufmann D, Campos-Neto A & Reed SG (1996) Molecular cloning of a novel protein antigen of Leishmania major that elicits a potent immune response in experimental murine leishmaniasis J Immunol 157, 5034–5041 Borges MM, Campos-Neto A, Sleath P, Grabstein KH, Morrissey PJ, Skeiky YA & Reed SG (2001) Potent 5098 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 stimulation of the innate immune system by a Leishmania brasiliensis recombinant protein Infect Immun 69, 5270– 5277 Skeiky YA, Coler RN, Brannon M, Stromberg E, Greeson K, Crane RT, Webb JR, Campos-Neto A & Reed SG (2002) Protective efficacy of a tandemly linked, multi-subunit recombinant leishmanial vaccine (Leish-111f) formulated in MPL adjuvant Vaccine 20, 3292–3303 Badaro R, Lobo I, Nakatani M, Muinos A, Netto EM, Coler RN & Reed SG (2001) Successful use of a defined antigen ⁄ GM-CSF adjuvant vaccine to treat mucosal Leishmaniasis refractory to antimony: a case report Braz J Infect Dis 5, 223–232 Dhalia R, Reis CR, Freire ER, Rocha PO, Katz R, Muniz JR, Standart N & de Melo Neto OP (2005) Translation initiation in Leishmania major: characterisation of multiple eIF4F subunit homologues Mol Biochem Parasitol 140, 23–41 Linder P (2003) Yeast RNA helicases of the DEAD-box family involved in translation initiation Biol Cell 95, 157–167 Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen PJ, Nishi K, Schnier J & Slonimski PP (1989) Birth of the D-E-A-D box Nature 337, 121–122 Gorbalenya AE & Koonin EV (1993) Helicases: amino acid sequence comparisons and structure-function relationships Curr Opin Struct Biol 3, 419–429 Cordin O, Banroques J, Tanner NK & Linder P (2006) The DEAD-box protein family of RNA helicases Gene 367, 17–37 Rocak S & Linder P (2004) DEAD-box proteins: the driving forces behind RNA metabolism Nat Rev Mol Cell Biol 5, 232–241 Silverman E, Edwalds-Gilbert G & Lin RJ (2003) DExD ⁄ H-box proteins and their partners: helping RNA helicases unwind Gene 312, 1–16 Tanner NK & Linder P (2001) DExD ⁄ H box RNA helicases: from generic motors to specific dissociation functions Mol Cell 8, 251–262 de la Cruz J, Kressler D & Linder P (1999) Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families Trends Biochem Sci 24, 192–198 Fuller-Pace FV (1994) RNA helicases: modulators of RNA structure Trends Cell Biol 4, 271–274 Schmid SR & Linder P (1992) D-E-A-D protein family of putative RNA helicases Mol Microbiol 6, 283–291 Iost I, Dreyfus M & Linder P (1999) Ded1p, a DEADbox protein required for translation initiation in Saccharomyces cerevisiae, is an RNA helicase J Biol Chem 274, 17677–17683 Okanami M, Meshi T & Iwabuchi M (1998) Characterization of a DEAD box ATPase ⁄ RNA helicase protein of Arabidopsis thaliana Nucleic Acids Res 26, 2638– 2643 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS M Barhoumi et al 30 Rogers GW Jr, Richter NJ & Merrick WC (1999) Biochemical and kinetic characterization of the RNA helicase activity of eukaryotic initiation factor 4A J Biol Chem 274, 12236–12244 31 Wagner JD, Jankowsky E, Company M, Pyle AM & Abelson JN (1998) The DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release from the spliceosome and unwinds RNA duplexes EMBO J 17, 2926–29237 32 Benz J, Trachsel H & Baumann U (1999) Crystal structure of the ATPase domain of translation initiation factor 4A from Saccharomyces cerevisiae – the prototype of the DEAD box protein family Structure Fold Des 7, 671–679 33 Caruthers JM, Johnson ER & McKay DB (2000) Crystal structure of yeast initiation factor 4A, a DEAD-box RNA helicase Proc Natl Acad Sci USA 97, 13080– 13085 34 Caruthers JM & McKay DB (2002) Helicase structure and mechanism Curr Opin Struct Biol 12, 123–133 35 Gingras AC, Raught B & Sonenberg N (1999) eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation Annu Rev Biochem 68, 913–963 36 Pain VM (1996) Initiation of protein synthesis in eukaryotic cells Eur J Biochem 236, 747–771 37 Hershey JWB & MW (2000) Pathway and mechanism of initiation of protein synthesis In Translational Control of Gene Expression (Sonenberg N, Hershey JWB & Mathews M, eds), pp 33–88 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA 38 Rhoads RE (1999) Signal transduction pathways that regulate eukaryotic protein synthesis J Biol Chem 274, 30337–30340 39 Bates EJ, Knuepfer E & Smith DF (2000) Poly(A)-binding protein I of Leishmania: functional analysis and localisation in trypanosomatid parasites Nucleic Acids Res 28, 1211–1220 40 Batista JA, Teixeira SM, Donelson JE, de Kirchhoff LV & CM (1994) Characterization of a Trypanosoma cruzi poly(A)-binding protein and its genes Mol Biochem Parasitol 67, 301–312 41 Hotchkiss TL, Nerantzakis GE, Dills SC, Shang L & Read LK (1999) Trypanosoma brucei poly(A) binding protein I cDNA cloning, expression, and binding to untranslated region sequence elements Mol Biochem Parasitol 98, 117–129 42 Yoffe Y, Zuberek J, Lewdorowicz M, Zeira Z, Keasar C, Orr-Dahan I, Jankowska-Anyszka M, Stepinski J, Darzynkiewicz E & Shapira M (2004) Cap-binding activity of an eIF4E homolog from Leishmania RNA 10, 1764–1775 43 Chan CC, Dostie J, Diem MD, Feng W, Mann M, Rappsilber J & Dreyfuss G (2004) eIF4A3 is a novel component of the exon junction complex RNA 10, 200–209 Leishmania LeIF is an eIF4A-like RNA helicase 44 Ferraiuolo MA, Lee CS, Ler LW, Hsu JL, Costa-Mattioli M, Luo MJ, Reed R & Sonenberg N (2004) A nuclear translation-like factor eIF4AIII is recruited to the mRNA during splicing and functions in nonsense-mediated decay Proc Natl Acad Sci USA 101, 4118–4123 45 Palacios IM, Gatfield D, St Johnston D & Izaurralde E (2004) An eIF4AIII-containing complex required for mRNA localization and nonsense-mediated mRNA decay Nature 427, 753–757 46 Shibuya T, Tange TO, Sonenberg N & Moore MJ (2004) eIF4AIII binds spliced mRNA in the exon junction complex and is essential for nonsense-mediated decay Nat Struct Mol Biol 11, 346–351 47 Li Q, Imataka H, Morino S, Rogers GW Jr, Richter-Cook NJ, Merrick WC & Sonenberg N (1999) Eukaryotic translation initiation factor 4AIII (eIF4AIII) is functionally distinct from eIF4AI and eIF4AII Mol Cell Biol 19, 7336–7346 48 Kressler D, de la Cruz J, Rojo M & Linder P (1997) Fal1p is an essential DEAD-box protein involved in 40S-ribosomal-subunit biogenesis in Saccharomyces cerevisiae Mol Cell Biol 17, 7283–7294 49 Tanner NK, Cordin O, Banroques J, Doere M & Linder P (2003) The Q motif: a newly identified motif in DEAD box helicases may regulate ATP binding and hydrolysis Mol Cell 11, 127–138 50 Rozen F, Edery I, Meerovitch K, Dever TE, Merrick WC & Sonenberg N (1990) Bidirectional RNA helicase activity of eucaryotic translation initiation factors 4A and 4F Mol Cell Biol 10, 1134–1144 51 Cordin O, Tanner NK, Doere M, Linder P & Banroques J (2004) The newly discovered Q motif of DEADbox RNA helicases regulates RNA-binding and helicase activity EMBO J 23, 2478–2487 52 Oberer M, Marintchev A & Wagner G (2005) Structural basis for the enhancement of eIF4A helicase activity by eIF4G Genes Dev 19, 2212–2223 53 Rogers GW Jr, Richter NJ, Lima WF & Merrick WC (2001) Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F J Biol Chem 276, 30914– 30922 54 Schmid SR, Buser P, Coppolecchia R, Fischli A & Linder P (1993) Analysis of the genes encoding eIF-4A from yeast In Protein Synthesis and Targeting in Yeast (Brown AJP, Tuite MF & McCarthy JEG, eds), pp 131–142 Springer-Verlag, Berlin 55 Dominguez D, Altmann M, Benz J, Baumann U & Trachsel H (1999) Interaction of translation initiation factor eIF4G with eIF4A in the yeast Saccharomyces cerevisiae J Biol Chem 274, 26720–26726 56 Korneeva NL, First EA, Benoit CA & Rhoads RE (2005) Interaction between the NH2-terminal domain of eIF4A and the central domain of eIF4G modulates RNA-stimulated ATPase activity J Biol Chem 280, 1872–1881 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5099 Leishmania LeIF is an eIF4A-like RNA helicase M Barhoumi et al 57 Rocak S, Emery B, Tanner NK & Linder P (2005) Characterization of the ATPase and unwinding activities of the yeast DEAD-box protein Has1p and the analysis of the roles of the conserved motifs Nucleic Acids Res 33, 999–1009 58 Yao N, Hesson T, Cable M, Hong Z, Kwong AD, Le HV & Weber PC (1997) Structure of the hepatitis C virus RNA helicase domain Nat Struct Biol 4, 463–467 59 Hirling H, Scheffner M, Restle T & Stahl H (1989) RNA helicase activity associated with the human p68 protein Nature 339, 562–564 60 Tsu CA & Uhlenbeck OC (1998) Kinetic analysis of the RNA-dependent adenosinetriphosphatase activity of DbpA, an Escherichia coli DEAD protein specific for 23S ribosomal RNA Biochemistry 37, 16989–16996 61 Lorsch JR & Herschlag D (1998) The DEAD box protein eIF4A A minimal kinetic and thermodynamic framework reveals coupled binding of RNA and nucleotide Biochemistry 37, 2180–2193 62 Nishi K, Morel-Deville F, Hershey JW, Leighton T & Schnier J (1988) An eIF-4A-like protein is a suppressor of an Escherichia coli mutant defective in 50S ribosomal subunit assembly Nature 336, 496–498 63 Flores-Rozas H & Hurwitz J (1993) Characterization of a new RNA helicase from nuclear extracts of HeLa cells which translocates in the 5¢-to 3¢ direction J Biol Chem 268, 21372–21383 64 Fuller-Pace FV, Nicol SM, Reid AD & Lane DP (1993) DbpA: a DEAD box protein specifically activated by 23s rRNA EMBO J 12, 3619–3626 65 Duncan R, Milburn SC & Hershey JW (1987) Regulated phosphorylation and low abundance of HeLa cell initiation factor eIF-4F suggest a role in translational control Heat shock effects on eIF-4F J Biol Chem 262, 380–388 66 von der Haar T & McCarthy JE (2002) Intracellular translation initiation factor levels in Saccharomyces cerevisiae and their role in cap-complex function Mol Microbiol 46, 531–544 67 Prat A, Schmid SR, Buser P, Blum S, Trachsel H, Nielsen PJ & Linder P (1990) Expression of translation initiation factor 4A from yeast and mouse in Saccharomyces cerevisiae Biochim Biophys Acta 1050, 140–145 5100 68 Hentze MW (1997) eIF4G: a multipurpose ribosome adapter? Science 275, 500–501 69 Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, Berriman M, Sisk E, Rajandream MA, Adlem E, Aert R et al (2005) The genome of the kinetoplastid parasite, Leishmania major Science 309, 436–442 70 Mayer MG & Floeter-Winter LM (2005) Pre-mRNA trans-splicing: from kinetoplastids to mammals, an easy language for life diversity Mem Inst Oswaldo Cruz 100, 501–513 71 Conti E & Izaurralde E (2005) Nonsense-mediated mRNA decay: molecular insights and mechanistic variations across species Curr Opin Cell Biol 17, 316–325 72 Dhalia R, Marinsek N, Reis CR, Katz R, Muniz JR, Standart N, Carrington M & de Melo Neto OP (2006) The two eIF4A helicases in Trypanosoma brucei are functionally distinct Nucleic Acids Res 34, 2495–2507 73 Kamoun-Essghaier S, Guizani I, Strub JM, Van Dorsselaer A, Mabrouk K, Ouelhazi L & Dellagi K (2005) Proteomic approach for characterization of immunodominant membrane-associated 30- to 36-kiloDalton fraction antigens of Leishmania infantum promastigotes, reacting with sera from Mediterranean visceral leishmaniasis patients Clin Diagn Lab Immunol 12, 310–320 74 Nandan D & Reiner NE (2005) Leishmania donovani engages in regulatory interference by targeting macrophage protein tyrosine phosphatase SHP-1 Clin Immunol 114, 266–277 75 Chang KP & McGwire BS (2002) Molecular determinants and regulation of Leishmania virulence Kinetoplastid Biol Dis 1, 1–7 76 Xia Q, Kong XT, Zhang GA, Hou XJ, Qiang H & Zhong RQ (2005) Proteomics-based identification of DEAD-box protein 48 as a novel autoantigen, a prospective serum marker for pancreatic cancer Biochem Biophys Res Commun 330, 526–532 77 Karreman C (1998) Fusion PCR, a one-step variant of the ‘megaprimer’ method of mutagenesis Biotechniques 24, 736,740,742 78 Guthrie C & Fink GR (1991) Guide to Yeast Genetics and Molecular Biology In Methods in Enzymology (Abelson JN & Simon MI, series eds) 194, Academic Press, San Diego FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS ... Trypanosoma sp genome projects (http://www.genedb.org/) Translation initiation in mammals and yeast is well studied; it involves many RNA? ? ?RNA, protein? ? ?RNA, and protein? ? ?protein interactions In. .. However, little is known regarding the role of these factors in translation In this work we studied the biochemical properties of purified, recombinant, LeIF protein from Leishmania infantum, and we demonstrate... an eIF4A-like RNA helicase M Barhoumi et al LeIF with translation initiation factors in yeast and interest for it as a potential drug target Results Sequence analysis LeIF protein of L infantum