Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 Tarnjit K Khera1, Andrew D Dick1,2 and Lindsay B Nicholson1,2 Department of Cellular and Molecular Medicine, School of Medical Sciences, University of Bristol, UK Department of Clinical Sciences South Bristol, Academic Unit of Ophthalmology, University of Bristol, UK Keywords FXR1; macrophages; RNA-binding proteins; TGF-b1; TNF-a Correspondence T K Khera, Department of Cellular and Molecular Medicine, School of Medical Sciences, University Walk, Bristol, BS8 1TD, UK Fax: +44 117 3312091 Tel: +44 117 3312012 E-mail: t.khera@bristol.ac.uk Website: http://www.bris.ac.uk/cellmolmed/ air/ (Received 26 February 2010, revised 11 April 2010, accepted 20 April 2010) doi:10.1111/j.1742-4658.2010.07692.x Tumour necrosis factor-a (TNF-a) is a key mediator of inflammation in host defence against infection and in autoimmune disease Its production is controlled post-transcriptionally by multiple RNA-binding proteins that interact with the TNF-a AU-rich element and regulate its expression; one of these is Fragile X mental retardation-related protein (FXR1) The anti-inflammatory cytokine transforming growth factor-b1 (TGF-b1), which is involved in the homeostatic regulation of TNF-a, causes posttranscriptional suppression of lipopolysaccharide (LPS)-induced TNF-a production We report here that this depends on FXR1 Using RAW 264.7 cells and bone marrow-derived macrophages (BMDMu) stimulated with LPS and TGF-b1, we show that TGF-b1 inhibits TNF-a protein secretion, whereas TNF-a mRNA expression remains unchanged This response is recapitulated by the 3¢-UTR of TNF-a, which is known to bind FXR1 TGF-b1 induces FXR1 with a pattern of expression distinct from that of tristetraprolin, T-cell intracellular antigen 1, or human antigen R When FXR1 is knocked down, TGF-b1 is no longer able to inhibit LPS-induced TNF-a protein production, and overexpression of FXR1 suppresses LPSinduced TNF-a protein production Targeting the p38 mitogen-activated protein kinase pathway of LPS-treated cells with small molecule inhibitors can induce FXR1 protein and mRNA expression In summary, TGF-b1 opposes LPS-induced stabilization of TNF-a mRNA and reduces the amount of TNF-a protein, through induction of expression of the mRNAbinding protein FXR1 Introduction Tumour necrosis factor-a (TNF-a) is a key mediator of inflammation, during which it plays a crucial role in the early phase of a host’s defence against infection [1,2] It is also produced during autoimmune inflammatory diseases, where it contributes to tissue damage [3,4] Septic shock is an extreme example of dysregulated inflammation, in which TNF-a is expressed rapidly and at high levels [5–8] To limit the potentially devastating effects that can follow the release of TNF-a, its expression is under strict control It is regulated at the level of transcription, pre-mRNA processing, mRNA stability, translation, Abbreviations ARE, AU-rich element; BMDMu, bone marrow-derived macrophages; CMV, cytomegalovirus; FXR1, Fragile X mental retardation-related protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HuA, human antigen R; IL, interleukin; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; Q-PCR, quantitative PCR; RFP, red fluorescent protein; siRNA, small interfering RNA; TGF-b1, transforming growth factor-b1; TIA-1, T-cell intracellular antigen 1; TNF-a, tumour necrosis factor-a; TTP, tristetraprolin 2754 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al and retention at the plasma membrane [9–13] The TNF-a mRNA 3¢-UTR contains AU-rich elements (AREs) AREs, which are found in many cytokine, inflammatory gene and oncogene mRNAs, are targets for binding proteins that regulate mRNA stability [14] Mice with targeted deletion of the TNF-a ARE show spontaneous production of TNF-a and develop chronic inflammatory arthritis and inflammatory bowel disease [15] Multiple RNA-binding proteins that interact with the TNF-a ARE and regulate its expression have been identified These include tristetraprolin (TTP), T-cell intracellular antigen (TIA-1), TIA-1related protein, human antigen R (HuA), AU-rich element binding factor 1, and Fragile X mental retardation-related protein (FXR1) [16–22] FXR1 is a homologue of the Fragile X mental retardation syndrome protein, and, together with Fragile X mental retardation-related protein 2P, forms the Fragile X mental retardation-related family of RNA-binding proteins [23] Targeted deletion of FXR1 produced a mouse that died soon after birth, but macrophage cell lines generated from these animals had enhanced TNF-a protein production as compared with wild-type macrophages [21] The expression of several other proinflammatory proteins was also affected by FXR1 deficiency, but the cytokines involved in the induction of FXR1 remain uncharacterized The regulation by the anti-inflammatory cytokine transforming growth factor-b1 (TGF-b1) of the proinflammatory cytokine TNF-a via the induction of FXR1 is the focus of this article TGF-b1, a member of the large transforming growth factor-b superfamily [24,25], is an anti-inflammatory cytokine that can regulate TNF-a Loss of TGF-b1 is associated with chronic inflammation, indicating that a failure to produce anti-inflammatory factors (i.e TGF-b1) or defective signalling by anti-inflammatory cytokines can contribute to the pathogenesis of inflammatory autoimmune diseases [26,27] Both recombinant TGF-b1 protein and antibodies against TNF-a have been shown to be protective against collagen type II arthritis in mice, whereas recombinant TNF-a protein or antibodies against TFG-b1 increased the severity of this disease, emphasizing the opposing effects of these cytokines in vivo [28] Other studies have shown that TGF-b1 can suppress TNF-a production during infection, increasing the severity of disease [29–32] In the present study, we show for the first time that TGF-b1 regulates TNF-a post-transcriptionally via the induction of FXR1 expression TGF-b1 induces the expression of this RNA-binding protein, which can downregulate lipopolysaccharide (LPS)-induced TNF-a protein production Furthermore, inhibition of FXR1 production can abolish the suppression of TNF-a TGF inhibits LPS induction of TNF via FXR1 protein production induced by TGF-b1 FXR1 therefore plays an important role in the negative regulation of TNF-a Results TGF-b1 inhibits LPS-induced TNF-a protein production by a TNF-a mRNA expressionindependent mechanism TGF-b1 is known to destabilize the mRNA of LPSinduced chemokines and regulate the mRNA stability of various other genes [33] It was reported to inhibit TNF-a protein production without concomitant alterations in the levels of mRNA, although the mechanism was unknown [34,35] Bone marrow-derived macrophages (BMDMu) and RAW 264.7 cells treated with LPS (100 pgỈmL)1 to lgỈmL)1) for h produced TNF-a protein in a dosedependent fashion, maximum production being reached at 100 ngỈmL)1 (Fig S 1A,B) When TGF-b1 (10 ngỈmL)1) [35] was added to either BMDMu or RAW 264.7 cells treated with LPS (100 ngỈmL)1) for h, the level of TNF-a protein induced showed a decrease (Fig 1A,B) The response of the BMDMu was comparable to that of the RAW 64.7 cells Assessment by intracytoplasmic staining and flow cytometry gave results comparable to those obtained by measurement of the TNF-a protein concentration by ELISA (Fig S1A–C) To determine whether TGF-b1-dependent inhibition of LPS-induced TNF-a protein production occurred at the level of transcription, RAW 264.7 cells were stimulated as above (Fig 1C) LPS treatment for h increased TNF-a mRNA levels, as compared with the nontreated or TGF-b1-treated controls, and the addition of TGF-b1 with LPS had no effect on the level of TNF-a mRNA Therefore, changes in TNF-a protein production not correlate with changes in TNF-a mRNA expression, and, as expected, the control of TNF-a induction is not solely transcriptional Addition of TGF-b1 induces the expression of factors that target the TNF-a 3¢-UTR Most cytokines contain an ARE in the 3¢-UTR of their mRNA, which modulates stability [36] To determine whether TGF-b1 induced the expression of factors that targeted the TNF-a 3¢-UTR, the TNF-a 3¢-UTR was cloned into the pGL3 control vector after the luciferase ORF (SV40–Luc–TNF-3¢-UTR; Fig 2A) RAW 264.7 cells were cotransfected with SV40–Luc–TNF-3¢-UTR and a Renilla control, and FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2755 TGF inhibits LPS induction of TNF via FXR1 T K Khera et al Fig TGF-b1 can suppress LPS-induced TNF-a protein production, without significant changes in mRNA expression BMDMu (A) and RAW 264.7 cells (B) were treated with 100 ngỈmL)1 LPS for h To some samples, 10 ngỈmL)1 TGF-b1 was added at the same time as LPS (TGF-b1 ⁄ LPS) TNF-a production was quantified by flow cytometry and ELISA RAW 264.7 cells were treated as above, and relative TNF-a mRNA expression was quantified using Q-PCR and normalized to GAPDH expression (C) Nontreated cells were used as a control; n = 3–4, *P < 0.05 treated with LPS and TGF-b1; untreated cells acted as controls In unstimulated cells, no luciferase protein expression was seen LPS treatment induced luciferase expression (Fig 2B), whereas the simultaneous addition of TGF-b1 with LPS led to a reduction in luciferase activity from 100% to 43.5 ± 14.1% (P = 0.01) In agreement with published data, these experiments show that the TNF-a 3¢-UTR is sufficient to give LPS the ability to stabilize mRNA [12], but they also demonstrate that this process is regulated by TGF-b1 Induction of FXR1 expression by TGF-b1 leads to post-transcriptional downregulation of TNF-a protein Many RNA-binding proteins, such as TTP, TIA-1, HuA, TIA-1-related protein, and FXR1, are known to bind to the ARE in the 3¢-UTR of cytokines, including 2756 TNF-a, and regulate translation We therefore studied the effect of TGF-b1 on RNA-binding proteins, including the mRNA expression of HuA (Fig 3A), TIA-1 (Fig 3B), and TTP (Fig 3C) LPS induced an increase in HuA expression and a decrease in TIA-1 expression, but TGF-b1 did not have an effect on these mRNA levels As the production of these proteins was not induced by TGF-b1, they were not likely candidates for mediating its effects As expected [37], LPS induced TTP mRNA expression, although, unexpectedly, TGF-b1 decreased the LPS-induced increase in TTP levels TTP is a negative regulator of TNF-a [38], so the reduction in its level in the presence of TGF-b1 is not consistent with a role in controlling TNF-a protein production following TGF-b1 stimulation The patterns of FXR1 mRNA expression in BMDMu (Fig 3D) and RAW 264.7 cells (Fig 3E) FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al A TGF inhibits LPS induction of TNF via FXR1 production (Fig 4C) These findings show that TGFb1-induced inhibition of TNF-a protein production is reversed when FXR1 is inhibited B Overexpression of FXR1 can suppress LPS-induced TNF-a protein production Fig TGF-b1 can inhibit LPS-induced protein production via the 3¢-UTR of TNF-a (A) Schematic representation of the SV40–Luc– TNF-3¢-UTR plasmid used (B) The SV40–Luc–TNF-3¢-UTR plasmid was cotransfected into RAW 264.7 cells with Renilla, also on a constitutive promoter After 24 h, the cells were treated with 100 ngỈmL)1 LPS, with addition of 10 ngỈmL)1 TGF-b1 alone or at the same time as LPS Luciferase expression was normalized using Renilla Cells treated with LPS alone were set at 100% luciferase expression and the nontreated cells at 0% luciferase expression; n = 3, *P < 0.05 were different LPS treatment did not alter the level of FXR1 mRNA, but this was increased by TGF-b1 (P = 0.009), and this induction was augmented when TGF-b1 and LPS were present together (P = 0.009) in RAW 264.7 cells TGF-b1 alone and TGF-b1 with LPS also induced FXR1 protein production in this system (Fig 3F) As expected, two different isoforms of FXR1 were visualized by western blotting with antibody against FXR1 following the addition of TGF-b1 and TGF-b1 ⁄ LPS [39,40] The pattern of FXR1 induction suggests that it could play a role in regulating TNF-a protein expression in cells treated with TGF-b1 To test this directly, FXR1 was inhibited with small interfering RNA (siRNA) (Fig 4A) FXR1 siRNA inhibited FXR1 mRNA expression by 74% as compared with a control siRNA Inhibition of FXR1 protein production was assessed by using RAW 264.7 cells treated with TGF-b1 for h (Fig 4Ba) and RAW 264.7 cells stably transfected with FXR1 under a cytomegalovirus (CMV) promoter (FXR1-OE cells; Fig 4Bb) In both the RAW 264.7 cells treated with TGF-b1 and the FXR1-OE cells, siRNA led to the greatest inhibition of FXR1 protein production, so siRNA was used for all experiments In the control siRNA-transfected cells, LPS induced TNF-a protein production, and the addition of TGF-b1 suppressed TNF-a protein production by 63% When FXR1 was inhibited, TGF-b1 was no longer able to suppress LPS-induced TNF-a protein To determine whether FXR1 overexpression is sufficient to oppose the effects of LPS on TNF-a secretion from RAW 264.7 cells, the FXR1-OE cells were compared with control cells transfected with red fluorescent protein (RFP) under a CMV promoter (RFP-OE cells) Increased expression of FXR1 protein in these cell lines could be detected by western blot (Fig 5A) and by quantitative PCR (Q-PCR) (Fig 5B), and FXR1 mRNA expression was 5.5-fold higher in FXR1-OE cells than in RFP-OE cells TNF-a protein from these cells treated with LPS for h was quantified At all concentrations of LPS, TNF-a protein production was suppressed in FXR1-OE cells as compared with controls (Fig 5C) This effect was relatively greater at lower LPS concentrations, and shows directly that overexpression of FXR1 can suppress TNF-a protein production However, the effects of consistent inhibition were partially reversed by increasing the stimulus driving TNF-a protein production This could be because higher amounts of LPS lead to increased TNF-a protein production as measured by ELISA and intracellular staining (Fig S1A–C) Inhibition of p38 mitogen-activated protein kinase (MAPK) can induce FXR1 production in LPS-treated cells LPS is known to activate the p38 MAPK pathway, which is important, for example, in the stabilization of chemokine mRNA TGF-b1 opposes LPS-induced chemokine stabilization by inhibiting p38 MAPK [33] To determine whether this signalling pathway was involved in FXR1 induction, SB203580, a cell-permeable p38 MAPK inhibitor, was used RAW 264.7 cells were treated with LPS (100 ngỈmL)1) and 0–10 lm SB203580 for h, and FXR1 protein (Fig 6A) and mRNA (Fig 6B) were quantified This treatment led to substantial upregulation of FXR1 protein production as well as an increase in mRNA levels Further experiments showed that the MAPKAP kinase inhibitor also induced FXR1 mRNA expression (Fig 2C) These inhibitors were also tested with BMDMu treated with LPS A negative control inhibitor (SB202474) did not lead to expression of FXR1 mRNA, whereas the MAPKAP kinase inhibitor and SB203580 both induced FXR1 mRNA expression (Fig 6D) These FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2757 TGF inhibits LPS induction of TNF via FXR1 A B C T K Khera et al D E Fig TGF-b1 can induce FXR1 mRNA and protein expression RAW 264.7 cells were treated with 100 ngỈmL)1 LPS and 10 ngỈmL)1, TGF-b1 alone or in combination, for h The relative expression of mRNA was then quantified by Q-PCR, and represented as a fold increase as compared with nontreated control cells GAPDH was used to normalize the results; *P < 0.05; (A) HuA, n = 3; (B) TIA-1, n = 3; and (C) TTP, n = FXR1 mRNA expression was quantified in BMDMu (D), n = 3, and RAW 264.7 cells (E), n = FXR1 protein expression was detected by western blot using RAW 264.7 cells (F) F results show that, in LPS-treated cells, inhibition of p38 MAPK leads to FXR1 induction at the protein and mRNA levels, a pattern consistent with the known signalling properties of TGF-b1 Discussion Regulation of TNF-a plays a central role in autoimmune disease [41–44], and therapy targeting TNF-a is effective in patients with inflammatory disorders such as uveitis and rheumatoid arthritis [45–49] However, this treatment has significant side effects, and better understanding of its control may lead to more selective therapies Here, we investigated the homeostatic regulation of TNF-a by the anti-inflammatory cytokine TGF-b1 and demonstrated that FXR1, an mRNAbinding protein, plays an essential role in this process Building on previous work showing that TGF-b1 can inhibit LPS-induced TNF-a and chemokine production [33,35], we confirmed that this occurs post-transcriptionally We then showed that the TNF 3¢-UTR is a target for factors induced by TGF-b1 that counteract the LPS-induced increased stability of TNF-a mRNA 2758 One of these factors is FXR1, which, unlike other mRNA-binding proteins known to modulate TNF-a, is induced by TGF-b1 but not by LPS The specific role of FXR1 in this process was shown by inhibition by siRNA on the one hand, and stable overexpression of FXR1 on the other These results are consistent with the phenotype of macrophages derived from FXR1) ⁄ ) mice [21] The reporter assay showed more suppression than quantification of TNF-a protein by ELISA or intracellular staining The most likely reason for this is that only the effects of the TNF-a mRNA 3¢-UTR are being taken into account Although the luciferase data show that TGF-b1 can suppress LPSinduced TNF-a production post-transcriptionally, it does not provide information about whether this occurs via mRNA instability and a decrease in the half-life of TNF-a mRNA or via translational suppression TGF-b1 inhibits the action of LPS, in part, by interfering with p38 MAPK-dependent stabilization of multiple mRNAs [33] This has downstream effects on a number of genes, including those for TNF-a [50], interleukin (IL)-3 [51], and IL-8 [52] Inhibiting p38 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al TGF inhibits LPS induction of TNF via FXR1 A 1.2 A FXRI mRNA 0.8 0.6 B 0.4 0.2 Control siRNA siRNA siRNA siRNA Control None B a) RAW 264.7 cells FXR1 C Actin b) FXR1-OE cells FXR1 Actin C LPS TGF-β1/LPS * 125 * Fig Overexpression of FXR1 suppresses LPS-induced TNF-a protein production RAW 264.7 cells were transfected with the RFP-OE or FXR1-OE plasmid and cultured in the presence of G418 for weeks FXR1 protein was detected by western blot (A), and FXR1 mRNA expression was quantified using Q-PCR and normalized using GAPDH; n = 3, *P < 0.05 (B) RFP-OE and FXR1-OE cells were cultured with or without 100–1 ngỈmL)1 LPS for h in the presence of GolgiPlug Intracellular analysis of TNF-a was carried out by flow cytometry (C); n = 3–4, *P < 0.05 TNF-α (%) 100 75 50 25 Control siRNA Fig FXR1 is necessary for TGF-b1-mediated suppression of LPS-induced TNF-a production RAW 264.7 cells were transfected with 50 nM control siRNA or siRNA targeting FXR1 for 24 h (A) TGF-b1, 10 ngỈmL)1, was added h prior to quantification of FXR1 mRNA expression by Q-PCR to induce FXR1 expression The results were normalized using GAPDH; n = 3, *P < 0.05 FXR1 protein was also detected by western blot (Ba), using three siRNAs that target FXR1 FXR1-OE cells were transfected with siRNA as described, and, after 24 h, FXR1 protein was detected by western blot (Bb) RAW 264.7 cells were transfected with siRNA, and, after 24 h, 100 ngỈmL)1 LPS was added plus 10 ngỈmL)1 TGF-b1 for h in the presence of GolgiPlug (C) Intracellular TNF-a was quantified by flow cytometry; n = 3, *P > 0.05 MAPK signalling with specific inhibitors in both a macrophage cell line and primary macrophages treated with LPS led to an increase in FXR1 expression similar to that seen in cells treated with TGF-b1, indicating that this pathway plays a role in the control of FXR1 It is also notable that TGF-b1 did not change the expression of HuA and TIA-1, although it did lead to a significant reduction in TTP mRNA expression, either on its own or in combination with LPS (Fig 3C), in contrast to previously published data showing that TGF-b1 can increase TTP expression in a T-cell line and a human monocytic cell line [53] The reduction of TTP expression by TGF-b1 is difficult to explain, but FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2759 TGF inhibits LPS induction of TNF via FXR1 A C T K Khera et al B Fig Inhibition of the p38 MAPK pathway can induce FXR1 protein production in LPS-treated macrophages RAW 264.7 cells were cultured with 100 ngỈmL)1 LPS for h plus SB203580 FXR1 protein was detected by western blot (A), and relative FXR1 mRNA expression was quantified by Q-PCR (B) The results were normalized using GAPDH; n = 3, *P < 0.05 RAW 264.7 cells were also cultured with 100 ngỈmL)1 LPS for h plus either the negative control inhibitor SB202474 or the MAPKAP kinase inhibitor, and this was followed by FXR1 mRNA quantification by Q-PCR; n = (C) BMDMu were cultured with 100 ngỈmL)1 LPS for h plus either the negative control inhibitor SB202474, SB203580, or the MAPKAP kinase inhibitor, and this was followed by FXR1 mRNA quantification by Q-PCR; n = (D) D is worthy of further investigation, as TTP is a negative regulator of TNF-a On the other hand, TGF-b1, but not LPS alone, significantly increased FXR1 expression, whereas LPS in combination with TGF-b1 further increased FXR1 expression FXR1 is known to bind to the TNF-a mRNA ARE and suppress translation [21] Other mRNA-binding proteins, such as TTP, are known to be controlled by phosphorylation by p38 MAPK ⁄ MK2 There is evidence suggesting that phosphorylation of another member of the FXR1 family, Fragile X mental retardation protein, on Ser 144 may be important in translational repression [54], but the effects of phosphorylation of FXR1 are unknown In this article, we have shown that inhibition of the p38 MAPK pathway can upregulate FXR1, but the mechanism for this remains unknown and is under investigation It is also possible that other anti-inflammatory cytokines may also upregulate FXR1, leading to posttranscriptional regulation of TNF-a and possibly other proinflammatory cytokines This remains an area for further investigation FXR1 is intimately involved in mRNA regulation, but there are other mechanisms in which it may play a role It will be important to determine whether the reported association of FXR1 with the RNA-induced silencing complex protein AGO2 is critical to its action [39,55,56] This work shows the induction of FXR1 by the regulatory cytokine TGFb1 We have focused on the downstream effects of FXR1 on TNF-a, but it is likely that other cytokines will also be regulated by the same mechanisms In other experiments, IL-6 has been reported to be a target for FXR1 [21], and investigation of further potential targets is ongoing 2760 Little is known about FXR1 in human disease, in which it has not been extensively investigated, although it has been identified as an autoantigen in systemic sclerosis [57] We also have scant information on the significance that the different isoforms of FXR1 have in terms of function Although these have been characterized carefully at the molecular level [40], their patterns of expression in inflammatory disease remain to be investigated TNF-a overproduction has been shown to be an important driving force in many autoimmune diseases, including rheumatoid arthritis [58], uveitis [59], multiple sclerosis [60,61], and inflammatory bowel disease [62] Blockade of TNF-a in autoimmune disease has been successfully introduced into the clinic for some of these conditions In many instances, however, these treatments have been associated with impaired host defence against infections [63–65] Understanding the role that FXR1 plays in the control of TNF-a by TGF-b1 could allow the development of therapies that complement the blockade of TNF-a, to give full efficacy while reducing unwanted side effects The study of RNA-binding proteins is therefore essential for the understanding of intracellular regulatory pathways and molecular mechanisms of pathology Experimental procedures BMDMu C57BL ⁄ Ly.5.2 congenic mice were obtained from Charles River Laboratories (Margate, UK), and were reared under specific pathogen-free conditions The mice were maintained in accordance with the Home Office Regulations for FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al TGF inhibits LPS induction of TNF via FXR1 Animal Experimentation, UK Bone marrow cells were obtained by flushing the femurs of mice, and the cells were cultured as previously described [66] in hydrophobic Teflon bags in DMEM containing 10% heat-inactivated fetal bovine serum, 5% normal horse serum, and the supernatant of macrophage colony-stimulating factor-secreting L929 fibroblasts at a final concentration of 15% (v ⁄ v) for days at 37 °C in the presence of 5% CO2 RAW 264.7 cell culture The RAW 264.7 murine cell line was cultured in DMEM supplemented with 10% fetal bovine serum, 10 mL)1 penicillin, 10 lgỈmL)1 streptomycin, and mm l-glutamine (all from Invitrogen, Paisley, UK) Cells were maintained at 37 °C in the presence of 5% CO2 Inhibitors SB203580 was purchased from Promega The negative control inhibitor SB2025880 and MAPKAP kinase (Hsp25) inhibitor were purchased from Calbiochem (Nottingham, UK) Dorset, UK) at the concentrations stated for h in the presence of lgỈmL)1 GolgiPlug (BD Bioscience, Oxford, UK) The cells were washed in buffer containing a balanced salt solution with 0.1% BSA and 0.08% azide (Media Services, University of Bristol, UK), and fixed using Cytofix ⁄ Cytoperm according to the manufacturer’s instructions (BD Pharmingen, Oxford, UK) The cells were stained with rat anti-mouse TNF-a-APC Ig, IgG1 isotype (clone MP6XT22; BD Pharmingen, Oxford, UK) Analysis was carried out using a FACS Canto II and FACS diva 5.0.2 software (BD Biosciences, San Jose, CA, USA) The data are shown as percentage change, using the geometric mean values, with control, nontreated cells set at 0%, and cells treated with only LPS set at 100% ELISA Cells were seeded in macrophage serum-free medium and treated with TGF-b1 or LPS at the concentrations stated for h TNF-a in the supernatant was measured by ELISA according to the manufacturer’s protocol (R&D Systems, Abingdon, UK) Q-PCR Stable cell lines RAW 264.7 cells were electroporated at 300 V and 960 lF with plasmids containing RFP or FXR1 on the CMV promoter (Cambridge Biosciences, Cambridge, UK) After 24 h, 500 lgỈmL)1 G418 (Sigma Aldrich, Dorset, UK) was added to the medium [67], and cells were used after weeks of culture Alterations in mRNA expression were examined by Q-PCR, using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), performed using specific oligonucleotide primers (Table 1, from Sigma Genosys, Dorset, UK) and StepOnePlus (Applied Biosystems, Warrington, UK) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control to normalize the results Flow cytometry Luciferase assay Cells were seeded in macrophage serum-free medium (Invitrogen, Paisley, UK) The cells were treated with TGF-b1 (R&D Systems, Abingdon, UK) or LPS (Sigma Aldrich, The 3¢-UTR of TNF-a was cloned using the following primers: forward, 5¢-CCCGACTACGTGCTCCTCAC-3¢; and reverse, 5¢-TTTATTTCTCTCAATGACCCGT-3¢ (Sigma Table Primers: names and sequences of primers used for Q-PCR The sequences from the database RT (http://medgen.ugent.be/ rtprimerdb/) were used Name Sequence (5¢–3¢) RT database GAPDH Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: RTPrimerDB 2920 FXR1 TNF-a TTP TIA-1 HuA TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA ATAATTGGCAACCAGAACGCCAGG CCACATGGCTCTTGGTCATTTGCT CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC TGCAATAACCCATTTCCCTGGTGC TAGGAACGGATCCACCCAAACACT TTGTCAGCACACAGCGTTCACAAG AGGCTGCTTTGATGTCTTCGGTTG ACTGCAGGGATGACATTGGGAGAA AAGCTTTGCAGATTCAACCTCGCC FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS – RTPrimerDB 147 – – – 2761 TGF inhibits LPS induction of TNF via FXR1 T K Khera et al Genosys, Dorset, UK) The PCR product was purified using the QIAquick PCR purification kit (Qiagen, Crawley, UK) and inserted into the XbaI site in the pGL3 control vector (Promega, Southampton, UK) The plasmid was amplified in Top10 Escherichia coli (Invitrogen, Paisley, UK) and purified using the HiSpeed Plasmid Midikit (Qiagen) A Renilla plasmid (pRL–TK–renilla; Promega) was used as a control RAW 264.7 cells were seeded to a density of 1.5 · 106 cells per well in a six-well plate on the day before transfection, in DMEM containing l-glutamine only On the day of transfection, the cells were washed in Optimem medium (Invitrogen) The plasmids were prepared for transfection [per well, in a 1.5 mL tube: 20 lL of Optimem, lg of each plasmid, and lL of Lipofectamine LTX (Invitrogen) and incubated at room temperature for 30 This mixture was then added slowly to cells in mL of Optimem The cytokines were added on the next day, and luciferase activity was measured Western blot FXR1 protein was examined by western blot analysis, using standard methodologies with a polyclonal antibody against FXR1 raised in goats (ab51970; Abcam, Cambridge, UK) An polyclonal antibody against actin, also raised in goats, was used as a control (Santa Cruz Biotechnology, Heidelberg, Germany) Briefly, cells were scraped off into NaCl ⁄ Pi before resuspension of the pellet in cell lysis buffer (Cell Signaling Technology, Hitchin, UK) The protein was prepared in SDS sample buffer, and boiled for prior to loading onto 10% SDS ⁄ PAGE gels After electrophoresis, the separated proteins were transferred to a nitrocellulose membrane (Amersham Pharmacia, Biotech UK Ltd, Little Chalfont, UK) The membrane was blocked with NaCl ⁄ Tris containing 5% BSA for h, and then incubated with the primary antibody overnight at °C The blots were subsequently washed in NaCl ⁄ Tris-Tween, and then incubated with an appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) Proteins were visualized by enhanced chemiluminescence (Amersham, Little Chalfont, UK), according to the manufacturer’s instructions siRNA Cells were plated in a six-well plate at a density of · 106 cells per well overnight in DMEM containing mm l-glutamine only On the following day, the cells were washed with Optimem and transfected using Lipofectamine RNAiMax (Invitrogen) with 50 nm control siRNA (BLOCK-iT Alexa Fluor Red Fluorescent Control; Invitrogen) or FXR1 siRNA (Invitrogen) for 24 h The following FXR1 siRNA sequences were used: siRNA 1, 5¢-GGG CCC UAA UUA CAC CUC CGG UUA U-3¢; siRNA 2, 5¢-GCA AUC CAU ACA GCU UAC UUG AUA A-3¢; and 2762 siRNA 3, 5¢-GAA GUU GAU AAA U-3¢ GCU UAU GUC CAG Statistical analysis Results are expressed as mean ± standard error of the mean The Mann–Whitney U-test, two-tailed, was used to determine significance Acknowledgements The flow cytometric analysis was carried out with assistance from Dr A Herman and Mr T Curry, Flow Cytometry Facility, Cellular and Molecular Medicine, Bristol University The authors would like to thank Professor N Perkins, University of Bristol, for reviewing the manuscript Mr O Whitton assisted with the preparation for publication of this manuscript This work was supported by grants from the National Eye Research Centre (NERC) and the James Tudor Foundation, and a Royal College of Pathologists ⁄ Jean Shanks Foundation Pilot Award References Vassalli P (1992) The pathophysiology of tumor necrosis factors Annu Rev Immunol 10, 411–452 Beutler B, Greenwald D, Hulmes JD, Chang M, Pan YC, Mathison J, Ulevitch R & Cerami A (1985) Identity of tumour necrosis factor and the macrophagesecreted factor cachectin Nature 316, 552–554 Tincani A, Andreoli L, Bazzani C, Bosiso D & Sozzani S (2007) Inflammatory molecules: a target for treatment of systemic autoimmune diseases Autoimmun Rev 7, 1–7 Clark IA (2007) How TNF was recognized as a key mechanism of disease Cytokine Growth Factor Rev 18, 335–343 Waage A, Halstensen A & Espevik T (1987) Association between tumour necrosis factor in serum and fatal outcome in patients with meningococcal disease Lancet 1, 355–357 Tracey KJ, Beutler B, Lowry SF, Merryweather J, Wolpe S, Milsark IW, Hariri RJ, Fahey TJ 3rd, Zentella A, Albert JD et al (1986) Shock and tissue injury induced by recombinant human cachectin Science 234, 470–474 Parrillo JE (1993) Pathogenetic mechanisms of septic shock N Engl J Med 328, 1471–1477 Cohen J (2002) The immunopathogenesis of sepsis Nature 420, 885–891 Weil D, Brosset S & Dautry F (1990) RNA processing is a limiting step for murine tumor necrosis factor beta expression in response to interleukin-2 Mol Cell Biol 10, 5865–5875 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al 10 Moreira AL, Sampaio EP, Zmuidzinas A, Frindt P, Smith KA & Kaplan G (1993) Thalidomide exerts its inhibitory action on tumor necrosis factor alpha by enhancing mRNA degradation J Exp Med 177, 1675– 1680 11 Han J, Huez G & Beutler B (1991) Interactive effects of the tumor necrosis factor promoter and 3¢-untranslated regions J Immunol 146, 1843–1848 12 Han J, Brown T & Beutler B (1990) Endotoxin-responsive sequences control cachectin ⁄ tumor necrosis factor biosynthesis at the translational level J Exp Med 171, 465–475 13 Biragyn A & Nedospasov SA (1995) Lipopolysaccharide-induced expression of TNF-alpha gene in the macrophage cell line ANA-1 is regulated at the level of transcription processivity J Immunol 155, 674–683 14 Asirvatham AJ, Gregorie CJ, Hu Z, Magner WJ & Tomasi TB (2008) MicroRNA targets in immune genes and the Dicer ⁄ Argonaute and ARE machinery components Mol Immunol 45, 1995–2006 15 Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F & Kollias G (1999) Impaired on ⁄ off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated immunopathologies Immunity 10, 387–398 16 Zhang W, Wagner BJ, Ehrenman K, Schaefer AW, DeMaria CT, Crater D, DeHaven K, Long L & Brewer G (1993) Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1 Mol Cell Biol 13, 7652–7665 17 Vasudevan S, Tong Y & Steitz JA (2008) Cell-cycle control of microRNA-mediated translation regulation Cell Cycle 7, 1545–1549 18 Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M, Maritim B, Chen S, Gueydan C, Kruys V, Streuli M, et al (2000) TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha EMBO J 19, 4154–4163 19 Lai WS, Carballo E, Strum JR, Kennington EA, Phillips RS & Blackshear PJ (1999) Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRNA Mol Cell Biol 19, 4311–4323 20 Gueydan C, Droogmans L, Chalon P, Huez G, Caput D & Kruys V (1999) Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA J Biol Chem 274, 2322–2326 21 Garnon J, Lachance C, Di Marco S, Hel Z, Marion D, Ruiz MC, Newkirk MM, Khandjian EW & Radzioch D (2005) Fragile X-related protein FXR1P regulates proinflammatory cytokine tumor necrosis factor expression at the post-transcriptional level J Biol Chem 280, 5750–5763 TGF inhibits LPS induction of TNF via FXR1 22 Dean JL, Wait R, Mahtani KR, Sully G, Clark AR & Saklatvala J (2001) The 3¢ untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNAstabilizing factor HuR Mol Cell Biol 21, 721–730 23 Bardoni B, Schenck A & Mandel JL (2001) The Fragile X mental retardation protein Brain Res Bull 56, 375–382 24 Miyazono K (2000) Positive and negative regulation of TGF-beta signaling J Cell Sci 113, 1101–1109 25 Dijke PT & Hill CS (2004) New insights into TGF-b-Smad signalling Trends Biochem Sci 29, 265–273 26 Monteleone G, Kumberova A, Croft NM, McKenzie C, Steer HW & MacDonald TT (2001) Blocking Smad7 restores TGF-beta1 signaling in chronic inflammatory bowel disease J Clin Invest 108, 601–609 27 MacDonald TT (1999) Effector and regulatory lymphoid cells and cytokines in mucosal sites Curr Top Microbiol Immunol 236, 113–135 28 Thorbecke GJ, Shah R, Leu CH, Kuruvilla AP, Hardison AM & Palladino MA (1992) Involvement of endogenous tumor necrosis factor alpha and transforming growth factor beta during induction of collagen type II arthritis in mice Proc Natl Acad Sci USA 89, 7375– 7379 29 Mendez-Samperio P, Hernandez-Garay M & Nunez Vazquez A (1998) Inhibition of Mycobacterium bovis BCG-induced tumor necrosis factor alpha secretion in human cells by transforming growth factor beta Clin Diagn Lab Immunol 5, 588–591 30 Dlugovitzky D, Bay ML, Rateni L, Urizar L, Rondelli CF, Largacha C, Farroni MA, Molteni O & Bottaso OA (1999) In vitro synthesis of interferon-gamma, interleukin-4, transforming growth factor-beta and interleukin-1 beta by peripheral blood mononuclear cells from tuberculosis patients: relationship with the severity of pulmonary involvement Scand J Immunol 49, 210–217 31 D’Andrea A, Ma X, Aste-Amezaga M, Paganin C & Trinchieri G (1995) Stimulatory and inhibitory effects of interleukin (IL)-4 and IL-13 on the production of cytokines by human peripheral blood mononuclear cells: priming for IL-12 and tumor necrosis factor alpha production J Exp Med 181, 537–546 32 Chantry D, Turner M, Abney E & Feldmann M (1989) Modulation of cytokine production by transforming growth factor-beta J Immunol 142, 4295–4300 33 Dai Y, Datta S, Novotny M & Hamilton TA (2003) TGFbeta inhibits LPS-induced chemokine mRNA stabilization Blood 102, 1178–1185 34 Hausmann EH, Hao SY, Pace JL & Parmely MJ (1994) Transforming growth factor beta and gamma interferon provide opposing signals to lipopolysaccharide-activated mouse macrophages Infect Immun 62, 3625–3632 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2763 TGF inhibits LPS induction of TNF via FXR1 T K Khera et al 35 Bogdan C, Paik J, Vodovotz Y & Nathan C (1992) Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-beta and interleukin-10 J Biol Chem 267, 23301–23308 36 Grzybowska EA, Wilczynska A & Siedlecki JA (2001) Regulatory functions of 3¢UTRs Biochem Biophys Res Commun 288, 291–295 37 Fairhurst A-M, Connolly J, Hintz K, Goulding N, Rassias A, Yeager M, Rigby W & Wallace P (2003) Regulation and localization of endogenous human tristetraprolin Arthritis Res Ther 5, R214–R225 38 Carballo E, Lai WS & Blackshear PJ (1998) Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin Science 281, 1001– 1005 39 Vasudevan S & Steitz JA (2007) AU-rich-element-mediated upregulation of translation by FXR1 and Argonaute Cell 128, 1105–1118 40 Kirkpatrick LL, McIlwain KA & Nelson DL (1999) Alternative splicing in the murine and human FXR1 genes Genomics 59, 193–202 41 Sivalingam SP, Thumboo J, Vasoo S, Thio ST, Tse C & Fong KY (2007) In vivo pro- and anti-inflammatory cytokines in normal and patients with rheumatoid arthritis Ann Acad Med Singapore 36, 96–99 42 Miossec P, Naviliat M, Dupuy d’Angeac A, Sany J & Banchereau J (1990) Low levels of interleukin-4 and high levels of transforming growth factor beta in rheumatoid synovitis Arthritis Rheum 33, 1180–1187 43 Katsikis PD, Chu CQ, Brennan FM, Maini RN & Feldmann M (1994) Immunoregulatory role of interleukin 10 in rheumatoid arthritis J Exp Med 179, 1517–1527 44 Bucht A, Larsson P, Weisbrot L, Thorne C, Pisa P, Smedegard G, Keystone EC & Gronberg A (1996) Expression of interferon-gamma (IFN-gamma), IL-10, IL-12 and transforming growth factor-beta (TGFbeta) mRNA in synovial fluid cells from patients in the early and late phases of rheumatoid arthritis (RA) Clin Exp Immunol 103, 357–367 45 Robertson M, Liversidge J, Forrester JV & Dick AD (2003) Neutralizing tumor necrosis factor-alpha activity suppresses activation of infiltrating macrophages in experimental autoimmune uveoretinitis Invest Ophthalmol Vis Sci 44, 3034–3041 46 Shakoor N, Michalska M, Harris CA & Block JA (2002) Drug-induced systemic lupus erythematosus associated with etanercept therapy Lancet 359, 579–580 47 Criscione LG & St Clair EW (2002) Tumor necrosis factor-alpha antagonists for the treatment of rheumatic diseases Curr Opin Rheumatol 14, 204–211 48 Dick AD, McMenamin PG, Korner H, Scallon BJ, Ghrayeb J, Forrester JV & Sedgwick JD (1996) Inhibition of tumor necrosis factor activity minimizes target organ damage in experimental autoimmune 2764 49 50 51 52 53 54 55 56 57 58 59 uveoretinitis despite quantitatively normal activated T cell traffic to the retina Eur J Immunol 26, 1018– 1025 Greiner K, Murphy CC, Willermain F, Duncan L, Plskova J, Hale G, Isaacs JD, Forrester JV & Dick AD (2004) Anti-TNFalpha therapy modulates the phenotype of peripheral blood CD4 + T cells in patients with posterior segment intraocular inflammation Invest Ophthalmol Vis Sci 45, 170–176 Brook M, Sully G, Clark AR & Saklatvala J (2000) Regulation of tumour necrosis factor alpha mRNA stability by the mitogen-activated protein kinase p38 signalling cascade FEBS Lett 483, 57–61 Ming XF, Stoecklin G, Lu M, Looser R & Moroni C (2001) Parallel and independent regulation of interleukin-3 mRNA turnover by phosphatidylinositol 3-kinase and p38 mitogen-activated protein kinase Mol Cell Biol 21, 5778–5789 Holtmann H, Winzen R, Holland P, Eickemeier S, Hoffmann E, Wallach D, Malinin NL, Cooper JA, Resch K & Kracht M (1999) Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways Mol Cell Biol 19, 6742–6753 Ogawa K, Chen F, Kim Y-J & Chen Y (2003) Transcriptional regulation of tristetraprolin by transforming growth factor-b in human T cells J Biol Chem 278, 30373–30381 Ceman S, O’Donnell WT, Reed M, Patton S, Pohl J & Warren ST (2003) Phosphorylation influences the translation state of FMRP-associated polyribosomes Hum Mol Genet 12, 3295–3305 Jin P, Zarnescu DC, Ceman S, Nakamoto M, Mowrey J, Jongens TA, Nelson DL, Moses K & Warren ST (2004) Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway Nat Neurosci 7, 113–117 Caudy AA, Myers M, Hannon GJ & Hammond SM (2002) Fragile X-related protein and VIG associate with the RNA interference machinery Genes Dev 16, 2491– 2496 Bolivar J, Guelman S, Iglesias C, Ortiz M & Valdivia MM (1998) The fragile-X-related gene FXR1 is a human autoantigen processed during apoptosis J Biol Chem 273, 17122–17127 Tetta C, Camussi G, Modena V, Di Vittorio C & Baglioni C (1990) Tumour necrosis factor in serum and synovial fluid of patients with active and severe rheumatoid arthritis Ann Rheum Dis 49, 665–667 Santos Lacomba M, Marcos Martin C, Gallardo Galera JM, Gomez Vidal MA, Collantes Estevez E, Ramirez Chamond R & Omar M (2001) Aqueous humor and serum tumor necrosis factor-alpha in clinical uveitis Ophthalmic Res 33, 251–255 FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS T K Khera et al 60 Horwitz DA (2006) Transforming growth factor-beta: taking control of T cells’ life and death Immunity 25, 399–401 61 Hofman FM, Hinton DR, Johnson K & Merrill JE (1989) Tumor necrosis factor identified in multiple sclerosis brain J Exp Med 170, 607–612 62 Van Deventer SJ (1997) Tumour necrosis factor and Crohn’s disease Gut 40, 443–448 63 Nancy RS, Sharon KG, Jong-Hoon L, Evelyne TE & Braun MM (2003) Listeria monocytogenes infection as a complication of treatment with tumor necrosis factor alpha-neutralizing agents Arthritis Rheum 48, 319–324 64 Keane J, Gershon S, Wise RP, Mirabile-Levens E, Kasznica J, Schwieterman WD, Siegel JN & Braun MM (2001) Tuberculosis associated with infliximab, a tumor necrosis factor alpha-neutralizing agent N Engl J Med 345, 1098–1104 65 Lee J-H, Slifman NR, Gershon SK, Edwards ET, Schwieterman WD, Siegel JN, Wise RP, Brown SL, Udall JN Jr & Braun MM (2002) Life-threatening histoplasmosis complicating immunotherapy with tumor necrosis factor alpha antagonists infliximab and etanercept Arthritis Rheum 46, 2565–2570 TGF inhibits LPS induction of TNF via FXR1 66 Munder M, Eichmann K & Modolell M (1998) Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase ⁄ arginase balance: competitive regulation by CD4 + T cells correlates with Th1 ⁄ Th2 phenotype J Immunol 160, 5347–5354 67 Gough PJ, Garden S & Greaves DR (2001) The use of human CD68 transcriptional regulatory sequences to direct high-level expression of class A scavenger receptor in macrophages in vitro and in vivo Immunology 103, 351–361 Supporting information The following supplementary material is available: Fig S1 Dose-dependent induction of TNF-a expression by LPS This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary material supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 277 (2010) 2754–2765 ª 2010 The Authors Journal compilation ª 2010 FEBS 2765 ... Fragile X mental retardation-related protein (FXR1) [16–22] FXR1 is a homologue of the Fragile X mental retardation syndrome protein, and, together with Fragile X mental retardation-related protein. .. induction of FXR1 remain uncharacterized The regulation by the anti-inflammatory cytokine transforming growth factor-b1 (TGF-b1) of the proinflammatory cytokine TNF-a via the induction of FXR1 is... abolish the suppression of TNF-a TGF inhibits LPS induction of TNF via FXR1 protein production induced by TGF-b1 FXR1 therefore plays an important role in the negative regulation of TNF-a Results