self generated income in public tertiary education institutions as a proportion of total resources in 2005

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Ngày tải lên : 13/02/2014, 05:20
... of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its ... III.—Ethnography A The Origin and Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s ... Archæology of the various areas in America Art in stone, bone, shell, wood, clay, paper, etc., in these areas [13] LABORATORY WORK A Physical Laboratory Comparing and identifying bones Measuring skulls...
  • 28
  • 665
  • 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... may be described as holistic or “conceptually driven” (Brown) in that they focus on the overall meaning of a passage, and the application of schemata Schemata are mental frameworks based on past ... identify and understand what others are saying This involves understanding a speaker's accent or pronunciation, his grammar and his vocabulary, and grasping his meaning Defined with those characteristics,...
  • 39
  • 1.1K
  • 3
Tài liệu Traumatic Gynecologic Fistula as a Consequence of Sexual Violence in Conflict Settings: A Literature Review doc

Tài liệu Traumatic Gynecologic Fistula as a Consequence of Sexual Violence in Conflict Settings: A Literature Review doc

Ngày tải lên : 12/02/2014, 23:20
... Sudanese in Chad, are also vulnerable to sexual violence When instances of sexual assault are particularly violent, such as in the case of gang rape or insertion of sharp objects into the vagina, ... Amnesty International (2005) In this report, researchers assert that sexual assault has included violent rape and gang rape of women of all ages, and that this violence has increased since 2003 Reports ... associated with childbirth but instead from trauma associated with violent sexual assault Such systematic assault against women and girls in conflict settings has led to an increased prevalence of...
  • 33
  • 841
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20
... for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing two wells containing about  105 cells (C) Normalized b-Gal ... recombination on episomal and on genomic targets, we have shown that the dynamic nature of chromatin renders a site of at least 34 bp in general reactive for recombination However, the assembly of ... histone deacetylases or topoisomerases Histone modifications such as acetylation and phosphorylation play important roles in the regulation of chromatin structure In particular acetylation of the...
  • 7
  • 472
  • 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Ngày tải lên : 07/03/2014, 17:20
... ubiquitinylation of the ASA mutants, suggesting that they may be degraded in a ubiquitin-independent way by the 20S proteasome [17] Glucosidases I and II, as well as ER a1 ,2-mannosidases, play a role ... phosphatase inhibitors on the stability of mutant ASAs Ltk– cells stably expressing the indicated amino acid-substituted ASAs were incubated in the presence of various inhibitors (Lc, Lp, OA, PAO, ... different amino acid-substituted ASAs The results demonstrate that all of these mutant ASAs can be partially stabilized by proteasome inhibition and that the extent of stabilization varies between...
  • 10
  • 504
  • 0
Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx

Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx

Ngày tải lên : 08/03/2014, 22:20
... number of abnormal aspartate residues, spontaneously arising from L-asparaginyl deamidation and/or L-aspartyl isomerization reactions [7] In addition it has been reported that isoaspartate residues, ... [7], are cytoskeletal components, such as ankyrin and bands 4.1 and 4.2, as well as the integral membrane protein band (AE1; the anion transporter) [6] In this respect, asparaginyl deamidation has ... glycosylation of haemoglobin (glycation) has been shown to increase in the course of mismanaged hyperglycaemia in diabetes [27] Haemoglobin is a useful protein marker of this kind of damage, although...
  • 8
  • 412
  • 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Ngày tải lên : 16/03/2014, 00:20
... mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and potential for combination in ... tyrosine kinase activates several signalling pathways, including the ERK1 ⁄ pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of transcription (JAK-STAT) pathway, ... extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2) and protein kinase B (PKB) pathways that act downstream of oncogenic protein kinases [10,11] It is increasingly apparent that BIM as a mediator of tumour...
  • 13
  • 453
  • 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

Ngày tải lên : 22/03/2014, 11:20
... pressures, a recognition of the limits to health care, increasing technology and associated costs, and the increasing perception of health as a business All of these have contributed towards increasing ... the lines seen in the UK and US and to a lesser extent in Canada 9.1 Decline of the welfare state Teeple [11] sees increasing income and wealth inequalities and the weakening of social infrastructures ... low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population in Canada and four comparison...
  • 17
  • 843
  • 0
Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot

Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot

Ngày tải lên : 23/03/2014, 01:20
... contact angle of water was measured as a control on a clean (as defined in experimental section) silicon substrate and was 36.0° The contact angle of water was determined for the polymer brush samples ... of the washing solvent was also investigated The contact angles of water for samples washed in toluene and chloroform were compared The 100c sample had a contact angle of 91.2° The surface washed ... means the sample has a reaction time of 40 hours, was last washed in toluene, and has been hydrolyzed A complete listing of all the polymer brush samples prepared appears in Table 3.2-3 24 Table...
  • 80
  • 375
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... nonspecific deacetylase inhibitor trichostatin A (TSA) resulted in the appearance of a significant amount of acetylated tubulin (Fig 1C, and h; Fig 1D), indicating that both acetylase and deacetylase were...
  • 14
  • 416
  • 0
A History of Natural Resources in Asia pptx

A History of Natural Resources in Asia pptx

Ngày tải lên : 23/03/2014, 06:20
... was disproportionately concentrated in certain geographical areas of the region such as in the lower deltas on the mainland, along the west coast of the Malayan peninsula and the east coast of ... Greg Bankoff and Peter Boomgaard H istorians of Southeast Asia have often ignored the question of natural resources, mainly accepting them as a given and passing on to what they identify as the ... Tobacco was already a very successful crop in China and Southeast Asia at an early stage, while rubber became an important export in Malaysia and Indonesia after 1900 However, there were also introduced...
  • 305
  • 589
  • 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

Ngày tải lên : 18/06/2014, 22:20
... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased ... life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal ... pain, and emotion are the same as in Table The indirect effect of having a chronic condition versus no chronic condition as mediated by physical activity Percentage of the total effect of having...
  • 11
  • 619
  • 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Ngày tải lên : 18/06/2014, 22:20
... (Table 3) as well as clinical data (Table 4) in studied tissues and blood was observed Discussion The critical role of circulating tumor cells in metastatic spread of carcinomas has already been ... may indicate patients in metastasis stage Analysis of results demonstrated that in part of the studied blood samples of cancer patients activity of CGB and GNRH1 was on the same level as in control ... sodium acetate, mM EDTA, 200 mM paraformaldehyde; pH 7.0; SigmaAldrich) μg of total RNA was used for cDNA synthesis Mixture of RNA, universal oligo(d)T 10 primer and RNasefree water was incubated at...
  • 9
  • 460
  • 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

Ngày tải lên : 19/06/2014, 22:20
... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... http://www.jneuroinflammation.com/content/3/1/30 kinases Lyn and Fyn as well as the tyrosine kinase Syk [30,32,52] Activation of these signaling cascades are linked to the synthesis and secretion of proinflammatory ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and...
  • 12
  • 413
  • 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

Ngày tải lên : 20/06/2014, 15:20
... staff of an ambulant out-patient care unit in Essen, attendants of a meeting on "Spirituality and Medicine" in Berlin, a Caritas congress in Kevealer, and a meeting of contemporary Christian songwriters ... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... value in measuring SpR attitudes and engagement of patients coping with life-threatening illness, and in the measurement of distinct aspects of QoL An advantage of our instruments is the clear-cut...
  • 11
  • 425
  • 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

Ngày tải lên : 20/06/2014, 15:20
... self- rated health and discharge from the military was examined The following is a description of key variables used to validate self- rated health ratings: Smoking status Smoking status was assessed ... smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after ... manuscript, was involved in background research and provided final approval of manuscript content SAP was involved in manuscript development, assisted in background research, performed statistical analyses,...
  • 9
  • 301
  • 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Ngày tải lên : 07/08/2014, 18:21
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
  • 5
  • 205
  • 0
Báo cáo y học: "Role of resistin as a marker of inflammation in systemic lupus erythematosus" ppsx

Báo cáo y học: "Role of resistin as a marker of inflammation in systemic lupus erythematosus" ppsx

Ngày tải lên : 09/08/2014, 10:22
... regression analyses as independent variables and resistin as a dependent variable A forward stepwise method was used ESR and S-creatinine were defined as normal or pathological according to standard laboratory ... variables Analyses were also performed with z score total hip and radius as dependent variables using a cutoff value as -1 SD for normal or reduced bone mass Resistin was significantly associated ... in radius remained associated with resistin Oh and colleagues [35] have shown an inverse correlation of resistin to BMD in lumbar spine in an adult male Korean patient cohort also indicating...
  • 9
  • 460
  • 1
báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

Ngày tải lên : 10/08/2014, 22:20
... complications of this presentation are infections of the urinary tract and retention of urine in the vagina We present the case of a post-menopausal woman with adnexal mass and abdominal pain due to ... anatomical area of the right adnexa Our patient had developed a pyosalpinx as a Sequela of labial fusion At laparoscopy the right pyosalpinx was identified and resected, whereas the labia majora ... reported cases is urination anomalies and most commonly infections of the urinary tract Pyosalpinx is most often a complication of pelvic inflammatory disease arising from a variety of causes In post-menopausal...
  • 14
  • 367
  • 0

Xem thêm