robust nonlinear control of a hypersonic aircraft based on sliding mode control

Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... Reliability Analysis of a Power System Based on the Multi-State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, ... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are ... b inary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. So there can be several states of...
  • 4
  • 407
  • 0
báo cáo hóa học: "Principal components analysis based control of a multi-dof underactuated prosthetic hand" docx

báo cáo hóa học: "Principal components analysis based control of a multi-dof underactuated prosthetic hand" docx

Ngày tải lên : 19/06/2014, 08:20
... University of Pavia, Via Ferrata 1, 27100 Pavia, Italy. 2 ARTS Lab, Scuola Superiore Sant’Anna, V.le Piaggio 34, 56025 Pontedera (PI), Italy. 3 EUCENTRE Foundation, Via Ferrata 1, 27100 Pavia, Italy. Authors’ ... Iberall T, Arbib MA: Schemas for the control of hand movements: an essay on cortical localization. Vision and Action: The Control of Grasping Norwood, NJ: AblexGoodale MA 1990, 163-180. 44. Kamper ... 7:16 http://www.jneuroengrehab.com/content/7/1/16 Page 11 of 13 RESEARC H Open Access Principal components analysis based control of a multi-dof underactuated prosthetic hand Giulia C Matrone 1* , Christian Cipriani 2 , Emanuele...
  • 13
  • 460
  • 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Ngày tải lên : 26/10/2012, 09:07
... outw ustrates a dem axation times [ ster@-BioShut g concentration g tomographic cal concentra graphical sign @C 80n as a carg a conjugate 4 consisting the transfe r cell membran an address ... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... prop tem of sp2-hy ase, π-electron tron shift alon ward-facing o monstration of msec], the axis ttle 14. As a r n at which a b signals in colle ations sufficie nals.[33]. Aft go to the carr e...
  • 11
  • 655
  • 0
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Ngày tải lên : 19/01/2014, 02:20
... introduc e a ted. The di s a ge as indic a e r with unb a n k voltage a nced load w o ntrol signa l t , the capaci t w hen the D C o ad changes b y an arrow e d dead bea t s tortion of t h a ted ... current and r ter is used t r y of the out p C VSI (Volt a g h the earth. a ic system w r ay of PV p a f or dc applic from the P V i ons such as u ch an array u that can ad a u strated in F a t ... i ltage so tha t t s for variou s m mar y a nd their rel a y stems are a d of a T V aria b t ora ge o n P rof. D r I VERSIT Y O LOGY c trical Mac h r ives e rter with va r in transfor m and...
  • 9
  • 650
  • 0
TRENDS OF EXTRA-PULMONARY TUBERCULOSIS UNDER REVISED NATIONAL TUBERCULOSIS CONTROL PROGRAMME: A STUDY FROM SOUTH DELHI* pot

TRENDS OF EXTRA-PULMONARY TUBERCULOSIS UNDER REVISED NATIONAL TUBERCULOSIS CONTROL PROGRAMME: A STUDY FROM SOUTH DELHI* pot

Ngày tải lên : 06/03/2014, 04:20
... prevalence of EPTB, ii) to draw comparison between annual case detection of PTB and EPTB, and iii) to assess outcome of DOTS in extra-pulmonary form of disease in a locality in Delhi. MATERIAL AND METHODS Present ... the Categories I or II), the observation of quality assurance in case management is also believed to have been contributory. Whereas, information, education and communication (IEC) campaigns ... management. In conclusion, annual case detection has improved for both pulmonary and extra- pulmonary TB under Revised National TB Control Programme employing a DOTS strategy. Cure of infectious disease...
  • 7
  • 361
  • 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Ngày tải lên : 07/03/2014, 21:20
... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5Â-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3Â and antisense primer 5Â-GAAT GCGGCCGCTCAGTCCTGCTC ... egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5Â-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3Â) and antisense primer SOE-4 (5Â-GAAT GCGGCCGCTTACT TGTAACAGCTCGTCCATG-3Â), ... Silflow CD & Lefebvre PA (1989) Isolation and characteriza- tion of the nitrate reductase structural gene of Chlamy- domonas reinhardtii. Proc Natl Acad Sci USA 86, 6449–6453. 16 Cannons AC &...
  • 11
  • 668
  • 0
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

Ngày tải lên : 08/03/2014, 04:22
... Association of Artificial Intelligence. Rada Mihalcea. 2003. The role of non-ambiguous words in natural language disambiguation. In Pro- ceedings of the Conference on Recent Advances in Natural Language ... Machine Translation, pages 101–112. Rada Mihalcea and Dan I. Moldovan. 1999. An auto- matic method for generating sense tagged corpora. In Proceedings of the 16 th Conference of the Amer- ican Association ... Topic signatures can be useful in a number of Natural Language Process- ing (NLP) applications, such as Word Sense Disambiguation (WSD) and Text Summarisation. Our method takes ad- vantage of the...
  • 6
  • 471
  • 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires

One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires

Ngày tải lên : 16/03/2014, 15:35
... Letters One-dimensional organic nanostructures: A novel approach based on the selective adsorption of organic molecules on silicon nanowires Eric Salomon * , Antoine Kahn Department of Electrical ... the nanowires. In the latter case, chemisorption of suitable organic molecules on the nanowires leads to a well-defined one-dimensional aggregation and changes the metallic character of the nanowires ... surface following the evap- oration of 4 Å of THAP are displayed in Fig. 3a and b. Each molecule appears as a six-pronged shape with six bright lobes and a dark center. The six-pronged shape...
  • 5
  • 465
  • 0
Pfam: A Comprehensive Database of Protein Domain Families Based on Seed Alignments pptx

Pfam: A Comprehensive Database of Protein Domain Families Based on Seed Alignments pptx

Ngày tải lên : 16/03/2014, 16:20
... /pub/databases/ Pfam. There are two main data files: pfam, which contains the annotation and alignments of all Pfam families, and swissPfam, which contains the Pfam domain organization for each ... the families lack family level annotation. Currently available fully automatic methods are thus not suitable for a high quality family -based classification system.Couldacombinationofmanual and automatic ... kazal, Fibronectin type III, and response regulator receiver domains.Pfam-Afamilieshave perma- nent accession numbers and form a library of HMMs available for searching and automatic annotation...
  • 16
  • 389
  • 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Ngày tải lên : 23/03/2014, 09:21
... cause cellular distur- bances than chimera of tetracycline repressor and eukaryotic transactiva- tion domains. Thus, in a comprehensive comparison of on- and off-states, a steady cellular background ... tetracycline-controlled transcriptional activa- tor (tTA) [10] or reverse tetracycline-controlled tran- scriptional activator (rtTA) [8]. A third system [11] is based on concomitant expression of ... for transporter mRNA and GAPDH mRNA. With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single blot. OCT, organic cation transporter; CAT, cationic amino acid transporter. Transporter...
  • 8
  • 331
  • 0
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

Ngày tải lên : 18/06/2014, 15:20
... As shown in Figure 2a, saturation of binding was achieved at a concentration of 60–70 nM of AF488-MCP-1. Since the internalization assay is to be used as a measure of pharmacodynamic effect of ... blood after only one hour incubation with the CCR2 antagonist. The sensitivity of the assay, or the ability of the assay to demonstrate inhibition of ligand internalization at low concentrations of ... retrospective analysis of phase one data. Instrument set-up, MESF calibration and data analysis A Becton Dickenson FACSCalibur instrument using 488 argon and red-diode lasers was calibrated daily using...
  • 12
  • 829
  • 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

Ngày tải lên : 18/06/2014, 15:20
... peritoneal cavity is a common site of ovarian cancer presentation or recurrence usually accompanied by ascites [3]. Massive ascites and the associated abdominal disten- tion can cause anorexia, nausea, ... in a compassionate patient treatment in which the DTA-H19 plasmid was intraperitoneally injected into the peritoneum of a woman with advanced and recurrent ovarian carcinoma. Following several ... performed the statistical analy- sis, and drafted the manuscript. AC participated in the study design and coordination. TL participated in the analyses of the ovarian ascites fluid. SA participated in...
  • 11
  • 559
  • 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

Ngày tải lên : 18/06/2014, 19:20
... analysis of literature. Transplantation 1997, 64:1261-1273. 15. Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S, Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related ... read and approved the final manuscript. Acknowledgements We thank Galadriel Bonnel for the revision of the manuscript in English. We thank FNAIR (National association of ESRD patients), especially ... care professionals with informa- tion regarding the psychosocial and physical impact of kidney transplantation [4,5]. Kidney transplantation is the therapy of choice for end- stage renal failure...
  • 12
  • 520
  • 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

Ngày tải lên : 19/06/2014, 10:20
... operation of a context-aware computerized application. While many technologies that are often made wearable (such as music players or telephones) function nearly as well (or sometimes better) as ... unadulterated PU foam sample and that of the PPy-coated PU foams sample were similar showing regions of elastic and inelastic responses to force. Problems such as repeatability and long-term aging ... washability of components is important to the preservation of normal user patterns of care and main- tenance of clothing. In the torso integration, the raw pilot test data indicates that foam...
  • 7
  • 748
  • 0
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

Ngày tải lên : 19/06/2014, 10:20
... produced not by a reallo- cation of attention but by mechanical destabilization, albeit along a temporal rather than a spatial dimension, brought about by articulation and respiratory patterns during ... that per- formance of the secondary cognitive task produced a change in the allocation of attention that uniquely affected ApEn values. How such reallocation is thought to occur remains a matter ... the automaticity of postural con- trol remains the subject of ongoing debate [18]. As an alternative measure of postural control, approxi- mate entropy (ApEn) has been used to quantify COP var- iability...
  • 7
  • 603
  • 0

Xem thêm