Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette Nicole Poulsen 1,2 and Nils Kro ¨ ger 1,2,3 1 Biochemie I, Universita ¨ t Regensburg, Germany 2 School of Chemistry & Biochemistry, 3 School of Materials Science & Engineering, Georgia Institute of Technology, Atlanta, GA, USA Diatoms (Bacillariophyceae) are a group of unicellular algae that are of enormous ecological importance, being responsible for about 40% of the primary bio- logical production in the oceans [1,2]. In addition to their role in global carbon cycling, diatoms have recently attracted interdisciplinary interest because of their extraordinary ability to produce intricately shaped, nanostructured silica as their cell wall material [3–5]. In contrast to the wide interest in diatom biology, genetic manipulation of diatoms is still in its infancy. With the recent completion of the Thalassiosira pseu- donana genome project [6] and establishment of an expressed sequence tag (EST) databank for Phaeod- actylum tricornutum [7], there is now an urgent demand for genetic tools to analyze the function of diatom genes in vivo. Genetic transformation meth- ods are at present available for the diatom species Keywords Cylindrotheca fusiformis; diatom transformation; green fluorescent protein (GFP); inducible gene expression; nitrate reductase Correspondence N. Kro ¨ ger, School of Chemistry & Biochemistry, Georgia Institute of Technology, 770 State St, Atlanta, GA 30332-0400, USA Fax: +1 404 894 7452 Tel: +1 404 894 4228 E-mail: nils.kroger@chemistry.gatech.edu Website: http://www.chemistry.gatech.edu/ faculty/kroger/ Notes Nucleotide sequence data for cffcpA-1A and CfNR are available in the GenBank database under accession numbers DQ060240 and DQ060241 (Received 25 March 2005, revised 7 May 2005, accepted 11 May 2005) doi:10.1111/j.1742-4658.2005.04760.x Research in diatom biology has entered the postgenomic era since the recent completion of the Thalassiosira pseudonana genome project. How- ever, the molecular tools available for genetic manipulation of diatoms are still sparse, impeding the functional analysis of diatom genes in vivo. Here we describe the first method for inducible gene expression in transgenic diatoms. This method uses a DNA cassette containing both promoter (Pnr) and terminator (Tnr) elements derived from the nitrate reductase gene of the diatom Cylindrotheca fusiformis. By using green fluorescent protein (gfp) cDNA as a reporter gene, it is demonstrated that gene expression under the control of the Pnr ⁄ Tnr cassette is switched off when cells are grown in the presence of ammonium ions and becomes switched on within 4 h when cells are transferred to medium containing nitrate. Incubating cells in nitrogen-free medium switches on transcription of the gfp gene, yet gfp mRNA does not become translated into protein. This block on trans- lation is released by the addition of nitrate, resulting in rapid onset of GFP production with a drastically reduced delay time of only 1 h. Altogether we have demonstrated that the Pnr ⁄ Tnr cassette enables inducible gene expres- sion and control of both the level and timing of mRNA and protein expression in transgenic diatoms. Abbreviations BLE (ble), bleomycin binding protein (gene); fcp, fucoxanthin chlorophyll a ⁄ c binding protein gene; egfp (egfp), enhanced green fluorescent protein (gene); NR, nitrate reductase; Pd, promoter of frua3 gene; Pfcp (Tfcp), promoter (terminator) of fucoxanthin chlorophyll a ⁄ c binding protein gene; Pnr (Tnr), promoter (terminator) of C. fusiformis nitrate reductase gene; SOEing, splicing by overlap extension. FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS 3413 P. tricornutum [8], Cylindrotheca fusiformis [9], Cyclo- tella cryptica and Navicula saprophila [10]. So far, in all but one case, only constitutive expression of intro- duced genes has been achieved. The one exception involved expression of a green fluorescent protein (GFP) fusion protein in P. tricornutum, under control of the promoter fcpA, derived from a gene encoding a fucoxanthin chlorophyll a ⁄ c binding protein [8]. In this instance, expression of the GFP fusion protein was repressed after a 7 day incubation in the dark and induced by 24 h exposure of the cells to light [11]. This method is not generally applicable for stud- ies on diatom cell biology as diatom growth is totally inhibited in the dark. For example, analyzing the effect of introduced proteins or RNA-mediated gene interference only at certain developmental stages (e.g. cell division) requires regulated expression of intro- duced genes within a much shorter time scale. There- fore, to study diatom biology using molecular genetic techniques, promoters need to be identified that enable rapid and tightly controlled expression of genes in transgenic diatoms. Previous physiological studies in diatoms have shown that the activity of nitrate reductase (NR), the rate-limiting enzyme in nitrogen assimilation, is regula- ted by the nitrogen source present in the medium. NR activity is suppressed by ammonium and induced when ammonium is replaced by nitrate [12,13]. In the green algae Chlamydomonas reinhardtii [14,15], Chlorella vulgaris [16] and Dunaliella tertiolecta [17], ammo- nium-dependent suppression of NR activity is due to down-regulation of NR gene expression as well as post-transcriptional regulation. These studies have prompted us to speculate that the promoter of the diatom NR gene may be a suitable molecular genetic tool for regulating transgenic protein expression in diatoms. However, the unexpected discovery by gen- ome sequence analysis of a complete urea cycle in the diatom T. pseudonana appeared to imply that a more complex regulatory network may control nitrogen metabolism in diatoms, possibly also involving the NR step [6]. Therefore, a thorough analysis was required of the applicability of diatom NR promoters to drive inducible gene expression in transgenic diatoms. Only recently the first two sequences of diatom NR genes have become available from T. pseudonana [6] and P. tricornutum [18], yet in neither organism has NR gene expression been analyzed as a function of the nitrogen source in the medium. In this study we have isolated the NR gene (CfNR) from a genomic DNA library of the diatom C. fusiformis and analyzed CfNR levels in response to different nitrogen sources. Using GFP as reporter protein, we have demonstrated that the 5¢-UTR and 3¢-UTR of CfNR allow control of both the timing and level of expression of introduced genes in transgenic C. fusiformis. Results Increasing the efficiency of C. fusiformis transformation Previously, DNA fragment Pd, from the 5¢-UTR of the frua3 gene, was the only established promoter in C. fusiformis to drive expression of the selection mar- ker protein bleomycin-binding protein (BLE), as well as other introduced proteins [9]. However, only mod- erate numbers of transformants and relatively low lev- els of heterologous protein expression were obtained [9]. In contrast, promoter fcpA from a gene encoding a fucoxanthin chlorophyll a ⁄ c binding protein (fcp) has been successfully used to obtain high expression levels of foreign proteins in transgenic P. tricornutum [19]. This promoter is constitutively active in light but not functional in C. fusiformis (N. Kro ¨ ger, unpub- lished observation). Therefore, the promoter of a C. fusiformis fcp gene has been isolated and tested for its applicability in C. fusiformis transformations. Prim- ers were designed based on a C. fusiformis fcp cDNA sequence (cffcpA-3) available from the NCBI database (see Experimental procedures) and used to amplify a 441-bp fragment from C. fusiformis genomic DNA. This DNA fragment was used as a probe for screening a C. fusiformis genomic DNA library. From a phage reacting positive in this screen, the sequence of a com- plete fcp gene including 5¢-UTR and 3¢-UTR was determined. This gene contained no introns and sur- prisingly was not identical with the cffcpA-3 cDNA sequence, but perfectly matched the cffcpA-1A cDNA sequence (GenBank accession number AY125580). The two sequences share 93% sequence identity at the nucleotide level. To generate an fcp promoter-based expression vector for C. fusiformis termed pCfcp, 1624 bp of the 5¢-UTR (termed Pfcp) and 504 bp of the 3¢-UTR (termed Tfcp) from the cffcpA-1A genomic DNA were cloned into pBluescript flanking a short region containing three unique restriction sites (EcoRV, XbaI, NotI), allowing easy insertion of genes. The ble gene, which confers resistance to the antibiotic zeocin, was ligated with pCfcp, generating pCfcp-ble. This plasmid was used for C. fusiformis transformation by microparticle bombard- ment, yielding typically 36 ± 4 zeocin-resistant trans- formants per 10 7 cells (using 1 lg plasmid), whereas an average of only 11 ± 1 zeocin-resistant transformants per 10 7 cells were obtained using 1 lg plasmid pPd-ble Inducible promoter for transgenic diatoms N. Poulsen and N. Kro ¨ ger 3414 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS (the transformant numbers represent averages from three transformation experiments). Thus, C. fusiformis transformation using the new plasmid pCfcp-ble was 3–4 times more efficient than the previous method. Cloning of the NR gene from C. fusiformis and mRNA expression studies Degenerate primers corresponding to the highly conserved NR motifs W-W-Y-K-P-E ⁄ D-Y ⁄ F and W-N-L-M-G-M were used in RT-PCR yielding a 375- bp product which exhibited 69% and 77% sequence identity with the corresponding NR sequence regions from T. pseudonana and P. tricornutum, respectively. Screening of the C. fusiformis genomic DNA library, using the 375-bp PCR product as a probe, led to the identification of a phage clone that contained the entire C. fusiformis NR gene (CfNR) on a single 5.4-kb BamHI DNA fragment. RACE PCR was used to determine the 5¢ end of the CfNR cDNA, allowing unequivocal identification of the gene’s start codon. On the basis of these data, the CfNR gene is made up of 2619 bp of intron-less sequence encoding a 873- amino acid polypeptide which exhibits 69% and 72% sequence identity with the predicted polypeptide sequences of the NR genes from T. pseudonana and P. tricornutum, respectively (Fig. 1). To investigate the effect of the nitrogen source on expression of the CfNR gene, C. fusiformis cells were preconditioned for 2 weeks in medium containing ammonium chloride as the sole nitrogen source (ammo- nium medium). After being washed with nitrogen-free medium, the cells were transferred to medium contain- ing ammonium (NH 4 + ), nitrate (NO 3 – ), a 1 : 1 mixture of ammonium and nitrate (NH 4 + ⁄ NO 3 – ) or kept in nitrogen-free medium (–N). After an incubation period of 24 h, NR expression was monitored by RT-PCR analysis (Fig. 2). The CfNR gene was expressed both in the presence of nitrate and under conditions of nitrogen starvation, but not in ammonium-containing medium. Ammonium proved to be an inhibitor of CfNR expres- sion, as shown by the lack of CfNR mRNA in the pres- ence of equal molar amounts of nitrate and ammonium (Fig. 2). These results demonstrate that the CfNR gene Fig. 1. Alignment of NR polypeptide sequences from diatoms. The sequence alignment was performed using CLUSTALW [40]. C.f., Cylindroth- eca fusiformis NR (this study); P.t., Phaeodactylum tricornutum NR (GenBank accession number AY579336); T.p., Thalassiosira pseudonana NR [6]. Amino acids identical with the CfNR polypeptide sequence are indicated by asterisks. The CfNR polypeptide exhibits the typical NR domain structure containing the molybdopterin domain (aa 54–295), dimerization domain (aa 321–447), heme domain (aa 519–592), FAD domain (aa 623–728) and NADH domain (residues 744–858) [27]. A unique 17-amino-acid insertion in the molybdopterin-binding domain iden- tified in the two other diatom NR genes [18] is also conserved in CfNR (aa 211–227). N. Poulsen and N. Kro ¨ ger Inducible promoter for transgenic diatoms FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS 3415 expression can be easily switched on and off by varying the nitrogen source in the medium. To evaluate the applicability of the CfNR gene’s regulatory elements to drive inducible expression of foreign proteins in trans- genic diatoms, a GFP-based reporter gene system was established. Construction of a vector for inducible gene expression A chimeric gene was constructed consisting of the egfp coding sequence [20] flanked by 775 bp of the 5¢-UTR (termed Pnr) immediately upstream of the start ATG of the CfNR gene and 571 bp of the 3¢-UTR (termed Tnr) immediately after the stop codon. The chimeric gene was cloned into pCfcp-ble yielding plasmid pNICgfp (Fig. 3A). The plasmid DNA (3 lg) was introduced into C. fusiformis by microparticle bom- bardment, and transformants were selected on zeocin- containing plates. From the over 100 zeocin-resistant clones obtained, 33 clones were analyzed for GFP expression by fluorescence microscopy, of which 22 clones were positive. The fluorescence intensities of eight of these clones were quantified by fluorimetry, using excitation at 485 nm and monitoring emission at 510 nm. Owing to the chlorophyll content, C. fusifor- mis wild-type cells exhibited noticeable fluorescence in these measurements, yet fluorescence intensities of dif- ferent GFP-expressing transformants were 7- to 50- fold higher than in wild-type cells (Fig. 3B). Variation in GFP fluorescence intensities between different transformant clones has previously been observed in P. tricornutum expressing GFP or GFP fusion proteins under the control of the constitutive fcp promoter [8,19]. As the introduced genes become randomly integrated into the diatom’s genome [8], the variation in GFP expression levels may result from differences in copy numbers or location of the introduced genes within the genome. Clone 31 exhibited the highest intensity of GFP fluorescence and therefore was cho- sen for further analysis. In growth medium containing ammonium as the sole nitrogen source, the fluores- A B C Fig. 3. Structure of transformation plasmid pNICgfp and analysis of GFP expressing C. fusiformis transformants. (A) Restriction map of the part of plasmid pNICgfp containing the egfp gene flanked by the Pnr ⁄ Tnr cassette and ble gene flanked by cffcpA-1A promoter (Pfcp) and terminator (Tfcp) sequences. (K, KpnI; H, HindIII; E, EcoRI; N, NotI; E105, Eco105I; E5, EcoRV; S, SacI). (B) Fluores- cence intensity (excitation 485 nm, emission 510 nm) of C. fusifor- mis wild-type and transformant clones (C#) expressing GFP. Cell concentration was 1· 10 7 ÆmL )1 for each clone. (C) GFP fluores- cence intensity (excitation 485 nm, emission 510 nm) of transform- ant C31 in different growth media, containing nitrate (1.5 m M KNO 3 ), ammonium (1.5 mM NH 4 Cl) or mixtures of nitrate and ammonium as nitrogen source (nitrate concentration was 1.5 m M, ammonium concentrations were: Q10, 0.15 m M; Q25, 0.06 mM; Q50, 0.03 m M; Q100, 0.0015 mM). Fig. 2. Influence of nitrogen source on the expression of CfNR mRNA. C. fusiformis wild-type cells were grown in ammonium medium and then transferred to different medium containing nitrate (NO 3 – ), ammonium (NH 4 + ), a 1 : 1 mixture of nitrate and ammo- nium (NO 3 – ⁄ NH 4 + ) or lacking any nitrogen (– N). After a 24-h incu- bation period, RNA was isolated from each sample and RT-PCR was performed to analyze CfNR mRNA expression (NR). As a posit- ive control RT-PCR analyses for the constitutively expressed cffcpA-1A mRNA (fcp) were performed using the same RNA prepa- rations. Inducible promoter for transgenic diatoms N. Poulsen and N. Kro ¨ ger 3416 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS cence intensity was slightly above wild-type levels (not shown), yet dramatically increased when ammonium was replaced by nitrate (Fig. 3C). These results show that the Pnr ⁄ Tnr cassette in plasmid pNICgfp retains the inducible property of the regulatory sequences that drive expression of the CfNR gene. As ammonium acted as an inhibitor of CfNR expres- sion (Fig. 2), we investigated the possibility of control- ling the level of GFP expression by growing Clone 31 in medium containing mixtures of ammonium and nitrate. At relative molar concentrations of nitrate vs. ammonium of 50 (Q50) and 100 (Q100), GFP fluores- cence levels were virtually indistinguishable from fluor- escence levels of cells incubated in medium containing only nitrate (Fig. 3C). However, at molar ratios of nitrate to ammonium of 10 (Q10) and 25 (Q25), the lev- els of GFP fluorescence were 44% and 83%, respect- ively, of the fluorescence levels of nitrate-grown cells. Thus, by adjusting appropriate relative concentrations of ammonium and nitrate, it is possible to down-regu- late, rather than completely shut off, the expression of genes that are under control of the Pnr ⁄ Tnr cassette. Decoupling of transcription and translation of gfp mRNA To further evaluate the properties of the Pnr ⁄ Tnr expression cassette, Clone 31 cells preconditioned in ammonium medium were subjected to nitrogen starva- tion, and gene expression was monitored by RT-PCR. In agreement with the result obtained with wild-type cells (Fig. 2, lane –N), expression of both CfNR and gfp genes was found to be switched on in the trans- formant (Fig. 4B). Surprisingly, when fluorimetry (not shown) and fluorescence microscopy were used, no GFP fluorescence was detected in Clone 31 cells (Fig. 4A), indicating the absence of functional GFP. Western blot analysis confirmed that GFP was indeed absent from nitrogen-starved Clone 31 cells (Fig. 4B), ruling out the possibility that GFP was present in a nonfluorescent form. After the addition of nitrate, GFP fluorescence developed in Clone 31 cells (Fig. 4A), demonstrating that inhibition of GFP pro- duction in nitrogen-starved cells was reversible. Alto- gether these results indicate that gfp mRNA did not become translated until nitrate was present, implying that, in nitrogen-starved cells, protein production from genes flanked by the NR promoter (Pnr) and termina- tor (Tnr) is controlled at the post-transcriptional level. On the basis of these results, we assumed that decoupling of mRNA and protein expression in nitro- gen-starved cells may provide a useful tool to obtain control over the timing of gene expression, as the built up pool of transgenic mRNA may very rapidly become translated into protein after the addition of nitrate. To investigate this, we analyzed by fluorimetry the kinetics of GFP production in Clone 31 cells in nitrate medium after preconditioning in ammonium medium and nitro- gen-free medium, respectively. After transfer of ammo- nium-preconditioned cells to nitrate medium, a lag phase of 5 h was observed before GFP expression became noticeable. Beyond this time, fluorescence lev- els increased with a doubling time of 1.5 h (Fig. 5A). RT-PCR analysis demonstrated that gfp mRNA expression started 4 h after the transfer of the cells to nitrate medium, thus preceding the onset of GFP fluorescence by about 2 h. Cells preconditioned in nitrogen-free medium exhibited a comparable rate of increase of GFP fluorescence (2 h doubling time) after A B Fig. 4. Influence of nitrogen source on mRNA expression and the formation of GFP protein. (A) Fluorescence images of C. fusiformis Clone 31 cells in nitrogen-free medium (–N) and in nitrate medium (NO 3 – ). Each micrograph represents an overlay of a transmission light microscopy image and two different fluorescence images. The green color shows GFP fluorescence and the red color depicts chloroplast autofluorescence (bar, 10 lm). (B) Comparison of gfp mRNA expression and GFP protein expression in nitrate medium (NO 3 – ), ammonium medium (NH 4 + ) and nitrogen-free medium (–N). The bottom row shows a GFP-specific western blot from total extracts of Clone 31 cells after 24 h of incubation in the indicated media. The rows above show the results from RT-PCR analysis for gfp mRNA (gfp) expression in Clone 31 cells from the same three cultures. As controls, expression of CfNR mRNA (NR) and the con- stitutive cffcpA-1 A mRNA (fcp) were monitored by RT-PCR using the same RNA preparations. N. Poulsen and N. Kro ¨ ger Inducible promoter for transgenic diatoms FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS 3417 transfer to nitrate medium. However, the lag phase for the onset of GFP fluorescence was drastically reduced to only 1 h, which probably corresponds to the time required for the extremely slow process of GFP chromophore formation [21]. Therefore, addition of nitrate to cells preconditioned on nitrogen-free medium appears to enable virtually instantaneous induction of protein expression from genes that are controlled by the Pnr ⁄ Tnr cassette. Discussion In this study, we have isolated from a C. fusiformis genomic library an fcp gene (cffcpA-1A) and a nitrate reductase gene (CfNR). From these genes 5¢-UTRs (pro- moters) and 3¢-UTRs (terminators) were used to construct a transformation vector for inducible gene expression in C. fusiformis. Flanking the zeocin resist- ance gene ble by promoter (Pfcp) and terminator (Tfcp) regions from cffcpA-1A improved the transformation efficiency for C. fusiformis about fourfold over previ- ously used transformation vectors. Presumably, the increased transformation rate is due to the exceptional strength of the fcp promoters [22]. Therefore, more BLE protein may be produced in C. fusiformis transformants by using a Pfcp-based vector compared with the previ- ously used Pd-containing vectors, which allows more transformants to grow using extremely high zeocin con- centrations (1 mgÆmL )1 ) required for suppression of C. fusiformis wild-type growth. In future the promoter Pfcp may be a useful tool for generating higher levels of expression of other transgenic proteins. With the CfNR gene sequence in hand, we were able to demonstrate by RT-PCR that CfNR expression can be simply regulated at the transcriptional level by vary- ing the nitrogen source in the medium (Fig. 4). Regu- lation of the NR gene transcript in C. fusiformis is similar to the green alga C. reinhardtii, as, in both organisms, NR mRNA production is switched off in the presence of ammonium and induced by nitrate or nitrogen starvation [23–25]. This regulatory pattern is preserved in the Pnr ⁄ Tnr cassette driving gfp expres- sion in C. fusiformis cells that have been transformed using the pNICgfp plasmid. Remarkably, induction of Pnr ⁄ Tnr-driven gfp expression has different outcomes depending on whether nitrate or nitrogen starvation is used as the inducer. Biosynthesis of GFP is inhibited in nitrogen-free medium, and protein is only produced in the presence of nitrate (Fig. 4B). As the gfp mRNA coding region is a highly unlikely target for post-tran- scriptional regulation in a diatom, we assume that this effect is mediated by regions in the CfNR-derived 5¢- UTR or 3¢-UTR of the gfp mRNA. Nutrient-depend- ent, post-transcriptional regulation of eukaryotic gene expression mediated by the UTRs of mRNA molecules is well characterized for iron metabolism in mammals [26], and recently evidence has been presented that the stability of NR mRNA in the green alga Chlorella vul- garis is mediated via the 5¢-UTR [27]. Therefore, we speculate that the UTRs in the CfNR mRNA may contain target sites for nitrate-dependent regulators of translation or mRNA stability. Interestingly, in C. fusi- formis, mRNA expression of AMT (encoding ammo- nium transporter proteins) and NAT (encoding nitrate transporter proteins) genes becomes strongly up-regu- lated when cells are transferred from ammonium medium to –N medium [28,29], suggesting that the expression of different proteins involved in nitrogen metabolism may be controlled by the same mechanism. However, it is at present unknown if nitrogen-starved A B Fig. 5. Kinetics of gfp mRNA and GFP protein expression in C. fusi- formis. (A) Development of fluorescence intensity in Clone 31 (C31) and wild-type (wt) cells. Cells were preconditioned in ammonium medium and then transferred either directly to nitrate medium (NO 3 – ) or incubated for 24 h in nitrogen-free medium before nitrate was added (–N ⁄ NO 3 – ). The x-axis indicates the time after addition of nitrate. (B) RT-PCR analysis of gfp mRNA expression in Clone 31 cells. Cells were preconditioned in ammonium medium and then directly transferred to nitrate medium. Hours indicate the time after addition of nitrate. At each time point RT-PCRs were performed using primers specific for gfp mRNA (gfp) and the constitutively expressed cffcpA-1A mRNA (fcp), respectively. Inducible promoter for transgenic diatoms N. Poulsen and N. Kro ¨ ger 3418 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS cells synthesize AMT and NAT protein or if transla- tion of AMT and NAT mRNAs is inhibited, as we have demonstrated for gfp mRNA. Exploiting the ability of the Pnr ⁄ Tnr cassette to decouple the transcription of a chosen gene from its translation into protein represents a valuable experi- mental tool. The subsequent addition of nitrate enables rapid protein production from introduced genes. Furthermore, the addition of both nitrate and appro- priate concentrations of ammonium allows, within lim- its, the control of the amount of induced protein. The observed lag phase of 1 h for Pnr ⁄ Tnr-controlled pro- tein expression most likely represents an underestimate of the speed of induction, because de novo formation of fluorescent GFP from the unfolded polypeptide is a very slow process, exhibiting a half time of 84.3 min [21]. The following observation is consistent with this assumption. In a Saccharomyces cerevisiae transform- ant carrying the gfp gene under control of the GAL1 promoter, GFP fluorescence starts 2.5 h after galactose addition [30], yet GAL1-controlled expression of other S. cerevisiae proteins already occurs < 10 min after induction with galactose [31]. Therefore, we expect that the experimental methods developed in the present work should allow analysis of the role of diatom pro- teins in short-lived cellular processes such as cyto- kinesis and valve and girdle band formation which are completed in less than 1 h. In future, analysis of cell division or valve formation in C. fusiformis transform- ants carrying a gene of interest under control of the Pnr ⁄ Tnr cassette may be performed as outlined in the following. A transformant grown in ammonium med- ium will be starved of silicic acid to arrest the cells at the G1 ⁄ S boundary [32]. After subsequent incubation in nitrogen-free medium to induce mRNA expression, silicic acid will be added to initiate cell division and sil- ica formation. Concomitantly with or at appropriate times after silicic acid replenishment, nitrate will be added to induce instantaneous expression of the pro- tein of interest, allowing observation of the protein’s influence on the progression of the cell cycle and the silica biogenesis. As the regulation of NR expression appears to be very similar throughout the diatom realm [12,13], the Pnr ⁄ Tnr cassette of C. fusiformis rep- resents a paradigm for establishing inducible gene expression systems also in other diatom species. Experimental procedures Culture conditions C. fusiformis was grown as described previously [33] under constant light and in artificial seawater medium containing 1.5 mm KNO 3 as sole nitrogen source (nitrate medium). Where indicated, nitrate was not included in the medium (nitrogen-free medium) or replaced by 1.5 mm NH 4 Cl (ammonium medium) or a mixture of 0.75 mm NH 4 Cl + 0.75 mm KNO 3 (ammonium + nitrate medium). Cloning of the cffcpA-1A gene To generate a selection marker for use in C. fusiformis,we first cloned the fcp gene and used its promoter and termina- tor sequences to drive expression of the zeocin resistance gene ble. To this end, C. fusiformis genomic DNA was extracted [33] and gene-specific oligonucleotides (sense: fcp1 5¢-AGAGCGAACTTGGTGCCCAG-3¢; antisense: fcp2 5¢-GCACGTCCGTTGTTCAATTC-3¢) were designed based on a C. fusiformis fcp precursor cDNA sequence available from the NCBI database (cffcpA-3; GenBank accession number AY125583). Thirty cycles of PCR produced a 441- bp DNA fragment, which was cloned into the pGEMT vector (Promega, Madison, WI, USA) and sequenced. The sequence obtained matched perfectly the database sequence. To screen the C. fusiformis genomic DNA library (in kEMBL3) [33] the 441-bp fcp DNA fragment was used as a probe after labeling with digoxygenin (Roche, Mannheim, Germany) according to the manufacturer’s instructions. Phage DNA of one positive clone was analyzed by diges- tion with different restriction enzymes and subsequent Southern blotting using the same probe as above. Two BamHI-digested DNA fragments (1.9 kb and 1.46 kb) that hybridized to the probe were cloned into the BamHI site of pUC18 and sequenced, resulting in pUC18 ⁄ fcp1.9kb (cover- ing 278 bp of fcp coding sequence preceded by 5¢-UTR) and pUC18 ⁄ fcp1.46kb (covering 357 bp of the fcp coding sequence followed by 3¢-UTR). Construction of vector pCfcp for constitutive gene expression The 1.9-kb insert of the pUC18 ⁄ fcp1.9kb plasmid was sub- cloned into the KpnI–PstI sites of pBluescriptII SK+, gen- erating pBluescript ⁄ fcp1.9kb. To introduce a cloning site between the 5¢-UTR and 3¢-UTR of the fcp gene, a short 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGC TACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢. The resulting 165-bp PCR product contained an Eco105I restriction site (underlined) and an EcoRV (bold) and XbaI (italic) restriction site, which were both introduced by the antisense primer. The PCR product, which covered part of the 5¢-UTR starting 12 bp upstream of the start ATG, was then cloned into the Eco105I–XbaI sites of pBluescript ⁄ fcp1.9kb, generating pBluescript ⁄ fcp1.6kb, which covers bp )12 to ) 1613 upstream of the fcp gene’s start ATG. The fcp terminator was ampli- N. Poulsen and N. Kro ¨ ger Inducible promoter for transgenic diatoms FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS 3419 fied by PCR from pUC18 ⁄ 1.46kb using the sense pri- mer 5¢-G AAT GCGGCCGCATTGCTTGTTGAGAAATA GG-3¢, which introduced a NotI restriction site (under- lined) and the antisense primer 5¢-CG GAGCTCTGG AAGCATGAAGTACTGCCA-3¢, which introduced a SacI restriction site (underlined). The 524-bp PCR product was digested with NotI and SacI and cloned into the NotI ⁄ SacI sites of pBluescript ⁄ fcp1.6kb, generating the C. fusiformis expression vector pCfcp. Genes to be inserted into the pCfcp vector require the sequence 5¢-ATCAAAACAACC AAA-3¢ immediately upstream of the start codon because vector pCfcp lacks bp ) 1to)12 of the promoter. Construction of zeocin resistance plasmid pCfcp-ble The ble gene [34] (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI restriction site (underlined). The resulting 386-bp PCR product was digested with NotI and cloned into the EcoRV ⁄ NotI site of pCfcp to generate pCfcp-ble. Cloning of the CfNR gene Extraction of poly(A)-rich RNA from C. fusiformis and synthesis of cDNA coupled to oligo(dT) 25 magnetic beads (Dynal Biotech, Hamburg, Germany) was as described [9]. Degenerate oligonucleotides NR1 (5¢-TGGTGGTAYAAR CCNGANT-3¢) and NR2 (5¢-CATNCCCATNARRTTC CA-3¢) were designed based on the alignment of the deduced amino-acid sequences of nine NR genes from algae and higher plants. The cDNA was used as template for 35 cycles of PCR amplification (15 s 94 °C, 15 s 52 °C, 30 s 72 °C) resulting in a 380-bp DNA product which was cloned into pGEMT vector (Promega) and sequenced. This 380-bp DNA fragment of the CfNR gene was labeled with digoxigenin and used to screen a C. fusiformis genomic DNA library as described above. From a positive phage identified in this screen, a 5.4-kb BamHI DNA fragment was identified by Southern blot analysis, which hybridized with the CfNR-specific probe. This DNA fragment was cloned into the BamHI site of pUC18, generating plasmid Pnr ⁄ BamHI5.4kb. Sequencing of the 5.4-kb insert revealed that it covered the complete CfNR gene including the 5¢-UTR and 3¢-UTR. To determine the 5¢ sequence of the CfNR mRNA, the cDNA was C-tailed as described in [35] and used in a 5 ¢-RACE PCR using antisense primer 5¢-CAGCTAAACCCAATAGTCTG-3¢ and sense primer 5¢-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGI IG-3¢. Thirteen cycles of PCR amplification (12 s 94 °C, 15 s 55 °C, 1.5 min 72 °C) followed by 33 cycles (12 s 94 °C, 15 s 55 °C, 1.5 min 72 °C) with an increment of 5 s at 72 °C per cycle were performed. A  550-bp DNA frag- ment was gel purified and re-amplified in a second PCR using the same antisense primer and the nested sense pri- mer 5 ¢-GGCCACGCGTCGACTAGTAC-3¢. The resulting product was cloned into pGEMT vector and sequenced. Construction of the inducible expression plasmid pNICgfp A 456-bp HindIII–EcoRI DNA fragment from plasmid Pnr ⁄ BamHI5.4kb covering part of the 5¢-UTR of the CfNR gene was cloned into the HindIII–EcoRI sites of pBlue- scriptII SK+, generating pNRp. To create the Pnr–gfp hybrid DNA fragment, the Gene SOEing technique (splicing by overlap extension) [36] was used. The first PCR for Gene SOEing was performed using Pnr ⁄ BamHI5.4kb as the tem- plate with the sense primer SOE-1 (5¢-CCTCTTCTAGC GAGTCTGG-3¢) and antisense primer SOE-2 (5¢-CTC GTTGCTCACCATTGTTCAGCGTTGATTTTT-3¢). The second PCR was performed on an egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAAT GCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site (underlined). The third PCR was carried out with both the first two PCR products and primers SOE-1 and SOE-4. The resulting PCR product was digested with EcoRI and NotI and cloned into the EcoRI–NotI sites of pNRp. This resulted in a chimeric gene with Pnr (775 bp) fused to egfp (pPnr-gfp). To introduce Tnr from the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3¢,which introduced a NotI site (underlined) and a SacI site (bold). The resulting 592-bp DNA fragment was digested with NotI and SacI and cloned into the NotI–SacI sites of pPnr-gfp yielding pPnr-gfp-Tnr. The final step of cloning involved the digestion of pPnr-gfp-Tnr with SacI (blunted) and KpnI and cloning into the BamHI (blunted)–KpnI sites of the zeocin resistance plasmid pCfcp-ble (see above) yielding pNICgfp. All PCR products were checked for the correct sequence by DNA sequencing. Diatom transformation C. fusiformis was transformed by microparticle bombard- ment using the Biolistic PDS-1000 ⁄ He Particle Delivery system (Bio-Rad, Hercules, CA, USA) as described [9]. For selection of transformants, bombarded cells were plated on artificial seawater medium containing 1.5% agar and 1mgÆ mL )1 zeocin. After 8 days of incubation of the plates under C. fusiformis standard growth conditions (see above), Inducible promoter for transgenic diatoms N. Poulsen and N. Kro ¨ ger 3420 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS individual clones were picked from the plates and inocula- ted into liquid artificial seawater medium containing 1mgÆmL )1 zeocin. RT-PCR Total RNA was isolated from 5 · 10 7 cells using 1 mL TRI reagent (Sigma, St Louis, MO, USA) according to the manufacturer’s instructions. Contaminating DNA was removed from the RNA preparation by DNase treatment, followed by an additional RNA purification step using TRI reagent. RNA concentration was determined photo- metrically at 260 nm and estimated by agarose gel electro- phoresis. For first strand cDNA synthesis, 5 lg total RNA, 25 pmol oligonucleotide 5¢-GCCGCCGAATTCC CAG(T) 18 -3¢, 500 lm dNTPs and 100 U Superscript III reverse transcriptase (Invitrogen) were incubated in a 20 lL reaction mix (1· RT buffer; Invitrogen) at 50 °C for 1 h. After heat inactivation at 70 °C for 15 min, 1 lL of the reverse transcription reaction mix was used in a 50 lL PCR using 30 cycles for amplification. For the cffcpA-1A PCR, the first strand cDNA was diluted 1 : 50 before amplification, and for gfp and CfNR PCR the first strand cDNA was used undiluted. Studies on CfNR gene expression To investigate the effect of the type of nitrogen source on the production of CfNR mRNA, cells were grown in ammonium medium under constant illumination and agi- tation. After reaching a density of  1.5 · 10 6 cellsÆmL )1 , cells were harvested by centrifugation (2800 g, 5 min) and washed three times with nitrogen-free medium. The washed cells were then resuspended in nitrogen-free med- ium or medium containing either nitrate, ammonium, or a 1 : 1 mixture of nitrate and ammonium. After 24 h of incubation, the cells were harvested for RNA isolation, and RT-PCR was performed. To study the kinetics of CfNR expression, cells were grown in ammonium med- ium as described above, and then transferred to fresh medium containing nitrate. Equal aliquots of cells were harvested every other hour for RT-PCR analysis and hourly for fluorescence measurements. The same type of kinetic analysis was performed in a second experiment, in which cells were incubated for 24 h in nitrogen-free med- ium before the addition of nitrate. To exert control on the amount of expressed GFP protein, cells were grown to a cell density of  1.5 · 10 6 cellsÆmL )1 in ammonium medium, washed three times with nitrogen-free medium and resuspended in nitrogen-free medium to a final cell density of 0.5 · 10 6 cellsÆmL )1 . After a 24 h incubation period, protein expression was induced by the addition of various concentrations of NH 4 Cl (final concentrations: 0.15 mm, 0.06 mm, 0.03 mm, 0.015 mm) immediately fol- lowed by the addition, to each sample, of KNO 3 to a final concentration of 1.5 mm. The cells were grown for a further 24 h before fluorescence measurements were taken. Fluorescence measurements of GFP A Shimadzu RF-5301PC spectrofluorophotometer was used for fluorescence measurements of diatom cells at ambient temperature. The excitation wavelength was 485 nm, the emission maximum was at 510 nm, and the slit width at both wavelengths was 5 nm. Cell suspensions were either directly loaded into the quartz cuvette (kinetic measure- ments) or concentrated 10-fold before measurements (from cells grown in ammonium ⁄ nitrate medium). Western blot analysis Separation of proteins by SDS ⁄ PAGE [37], Coomassie staining of SDS gels [38], and western blot analysis [39] were performed according to standard protocols. For western blot analysis, 1.25 · 10 6 cells were harvested from the respective medium, the cells were rapidly lysed by incuba- tion for 5 min in SDS sample buffer at 95 °C, and equal aliquots of the extracts were subjected to SDS ⁄ PAGE. For detection of GFP, a specific antibody (developed in rabbit; Clontech, Mountain View, CA, USA) was used and an anti- rabbit IgG–alkaline phosphatase conjugate (Sigma) as the secondary antibody. Microscopy analysis Confocal imaging was performed using an inverted Zeiss LSM 510 laser scanning microscope and a 63 · oil immer- sion objective (Carl Zeiss AG, Jena, Germany). For imaging the expression of GFP and the chloroplast autofluores- cence, excitation lines of an argon ion laser of 488 nm were used with a 505 ⁄ 550-nm bandpass filter for GFP and exci- tation lines of an HeNe laser of 543 nm with a 585 long pass filter for chloroplast autofluorescence in the multitrack facility of the microscope. Acknowledgements We are grateful to the following people from the Uni- versita ¨ t Regensburg: Michael Leiss for experimental assistance in the initial phase of the project, Peter Heg- emann for help with spectrofluorimetry, Guido Gross- mann for assistance with confocal microscopy, and Gerhard Lehmann for technical assistance. We are indebted to Ju ¨ rgen Stolz for critically reading the manuscript. We thank Kirk Apt (Martek Biosciences, Columbia, MD, USA) for providing an egfp-containing plasmid. This work was supported by the DFG (SFB- 521-A2) and the Fonds der Chemischen Industrie. N. Poulsen and N. Kro ¨ ger Inducible promoter for transgenic diatoms FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS 3421 References 1 Field C, Behrenfeld M, Randerson J & Falkowski P (1998) Primary production of the biosphere: integrat- ing terrestrial and oceanic components. Science 281, 237–240. 2 Nelson D, Treguer P, Brzezinski M, Leynaert A & Que- guiner B (1995) Production and dissolution of biogenic silica in the ocean: revised global estimates, comparisons with regional data and relationship to biogeneic sedi- mentation. Global Biogeochem Cycles 9, 359–372. 3 Sumper M & Kro ¨ ger N (2004) Silica formation in dia- toms: the function of long-chain polyamines and silaf- fins. J Mater Chem 14, 1–8. 4 Coradin T & Lopez P (2003) Biogenic silica patterning: simple chemistry or subtle biology? Chembiochem 4, 251–259. 5 Hildebrand M & Wetherbee R (2003) Components and control of silicification in diatoms. Prog Mol Subcell Biol 33, 11–57. 6 Armbrust EV, Berges JA, Bowler C, Green BR, Marti- nez D, Putnam NH, Zhou S, Allen AE, Apt KE, Bechner M, et al. (2004) The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and meta- bolism. Science 306, 79–86. 7 Montsant A, Jabbari K, Maheswari U & Bowler C (2005) Comparative genomics of the pennate diatom Phaeodactylum tricornutum. Plant Physiol 137, 500–513. 8 Apt K, Kroth Pancic P & Grossman A (1996) Stable nuclear transformation of the diatom Phaeodactylum tri- cornutum. Mol Gen Genet 252, 572–579. 9 Fischer H, Robl I, Sumper M & Kro ¨ ger N (1999) Tar- geting and covalent modification of cell wall and mem- brane proteins heterologously expressed in the diatom Cylindrotheca fusiformis (Bacillariophyceae). J Phycol 35, 113–120. 10 Dunahay T, Jarvis E & Roessler P (1995) Genetic trans- formation of the diatoms Cyclotella cryptica and Navi- cula saprophila. J Phycol 31, 1004–1012. 11 Kilian O & Kroth PG (2005) Identification and charac- terization of a new conserved motif within the prese- quence of proteins targeted into complex diatom plastids. Plant J 41, 175–183. 12 Lomas M (2004) Nitrate reductase and urease enzyme activity in the marine diatom Thalassiosira weissflogii (Bacillariophyceae): interactions among nitrogen sub- strates. Mar Biol 144, 37–44. 13 Gao Y, Smith GJ & Alberte RS (1993) Nitrate reduc- tase from the marine diatom Skeletonema costatum (bio- chemical and immunological characterization). Plant Physiol 103, 1437–1445. 14 Quesada A & Fernandez E (1994) Expression of nitrate assimilation related genes in Chlamydomonas reinhardtii. Plant Mol Biol 24, 185–194. 15 Fernandez E, Schnell R, Ranum LP, Hussey SC, Silflow CD & Lefebvre PA (1989) Isolation and characteriza- tion of the nitrate reductase structural gene of Chlamy- domonas reinhardtii. Proc Natl Acad Sci USA 86, 6449–6453. 16 Cannons AC & Shiflett SD (2001) Transcriptional regu- lation of the nitrate reductase gene in Chlorella vulgaris: identification of regulatory elements controlling expres- sion. Curr Genet 40, 128–135. 17 Song B & Ward B (2004) Molecular characterization of the assimilatory nitrate reductase gene and its expres- sion in the marine green alga Dunaliella tertiolecta (Chlorophyceae). J Phycol 40, 721–731. 18 Allen AE, Ward BB & Song BK (2005) Characteriza- tion of diatom (Bacillariophyceae) nitrate reductase genes and their detection in marine phytoplankton com- munities. J Phycol 41, 95–104. 19 Zaslavskaia L, Lippmeier J, Shih C, Ehrhardt D, Gross- man A & Apt K (2001) Trophic obligate conversion of an photoautotrophic organism through metabolic engi- neering. Science 292, 2073–2075. 20 Zhang G, Gurtu V & Kain SR (1996) An enhanced green fluorescent protein allows sensitive detection of gene transfer in mammalian cells. Biochem Biophys Res Commun 227, 707–711. 21 Reid BG & Flynn GC (1997) Chromophore formation in green fluorescent protein. Biochemistry 36, 6786– 6791. 22 Kro ¨ ger N (2001) The sweetness of diatom molecular engineering. J Phycol 37, 657–658. 23 Loppes R, Radoux M, Ohresser MC & Matagne RF (1999) Transcriptional regulation of the Nia1 gene encoding nitrate reductase in Chlamydomonas reinhard- tii: effects of various environmental factors on the expression of a reporter gene under the control of the Nia1 promoter. Plant Mol Biol 41, 701–711. 24 Fernandez E & Cardenas J (1982) Regulation of the nitrate-reducing system enzymes in wild-type and mutant strains of Chlamydomonas reinhardtii. Mol Gen Genet 186, 164–169. 25 Fernandez E & Cardenas J (1989) Genetics and regula- tory aspects of nitrate assimilation in algae. Molecular and Genetic Aspects of Nitrate Assimilation (Wray JL & Kinghorn JR, eds), pp. 101–124. Oxford Science Publi- cations, Oxford. 26 Wilkie GS, Dickson KS & Gray NK (2003) Regulation of mRNA translation by 5¢- and 3¢-UTR-binding fac- tors. Trends Biochem Sci 28, 182–188. 27 Campbell WH (1999) Nitrate reductase structure, func- tion and regulation: bridging the gap between biochem- istry and physiology. Annu Rev Plant Physiol Plant Mol Biol 50, 277–303. 28 Hildebrand M & Dahlin K (2000) Nitrate transporter genes from the diatom Cylindrotheca fusiformis (Bacil- Inducible promoter for transgenic diatoms N. Poulsen and N. Kro ¨ ger 3422 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS [...]... Poulsen and N Kroger ¨ 29 30 31 32 33 34 lariophycea): mRNA levels controlled by nitrogen source and by the cell cycle J Phycol 36, 702–713 Hildebrand M (2005) Cloning and functional characterization of ammonium transporters from the marine diatom Cylindrotheca fusiformis (Bacillariophceae) J Phycol 41, 105–113 Li J, Wang S, VanDusen WJ, Schultz LD, George HA, Herber WK, Chae HJ, Bentley WE & Rao G (2000)... ¨ domain conservation in a protein family associated with diatom cell walls Eur J Biochem 239, 259–264 Gatignol A, Durand H & Tiraby G (1988) Bleomycin resistance conferred by a drug-binding protein FEBS Lett 230, 171–175 FEBS Journal 272 (2005) 3413–3423 ª 2005 FEBS Inducible promoter for transgenic diatoms 35 Poulsen N & Kroger N (2004) Silica morphogenesis by ¨ alternative processing of silaffins... diatom Thalassiosira pseudonana J Biol Chem 279, 42993–42999 36 Horton RM, Cai ZL, Ho SN & Pease LR (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 37 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 38 Wilson CM (1983) Staining of proteins on gels: comparisons... (2000) Green fluorescent protein in Saccharomyces cerevisiae: real-time studies of the GAL1 promoter Biotechnol Bioeng 70, 187–196 Yarger JG, Halverson HO & Hopper JE (1984) Regulation of galactokinase (GAL1) enzyme accumulation in Saccharomyces cerevisiae Mol Cell Biochem 61, 173– 182 Martin-Jezequel V, Hildebrand M & Brzezinski MA (2000) Silicon metabolism in diatoms: implications for growth J Phycol... comparisons of dyes and procedures Methods Enzymol 91, 236–247 39 Kroger N & Wetherbee R (2000) Pleuralins are involved ¨ in theca differentiation in the diatom Cylindrotheca fusiformis Protist 151, 263–273 40 Thompson JD, Higgins DG & Gibson TJ (1994) Clustal-W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix... Higgins DG & Gibson TJ (1994) Clustal-W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 3423 . A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette Nicole Poulsen 1,2 and. SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAAT GCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site