on initial recognition of an item not deriving from a business combination if the carrying amount differs from its tax base

Báo cáo " Influence of intradot Coulomb interaction on transport properties of an Aharonov-Bohm interferometer " ppt

Ngày tải lên : 05/03/2014, 14:20

... electron from the ring should jump into the dot Conclusion In conclusion, we obtained the current expression as a function of the intradot Coulomb interaction and the AB phase The AB oscillations of ... via the dot (lead to ring to dot to ring to lead) In this AB device, the quantum dot can be considered as an impurity based on the Anderson model [15] Hence, we want to study the transport as a ... the same context, Bogdan et al [7] and Walter Hofstetter et al [8] studied the combination of the Kondo effect and the Fano effect How the intradot Coulomb interaction influences the phase coherence...

8
249
0

Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

Ngày tải lên : 16/03/2014, 02:20

... germline mutations in cancer candidate genes in glioblastoma, melanoma, and pancreatic carcinoma Cancer Res 67, 3545–3550 16 Fox BP, Tabone CJ & Kandpal RP (2006) Potential clinical relevance of Eph ... in human cancers Hum Mutat 27, 1060– 1061 15 Balakrishnan A, Bleeker FE, Lamba S, Rodolfo M, Daniotti M, Scarpa A, van Tilborg AA, Leenstra S, Zanon C & Bardelli A (2007) Novel somatic and germline ... Results and discussion The juxtamembrane region of the cytosolic domain is a validated autophosphorylation site for Eph kinases and was initially targeted for co-crystallization efforts The juxtamembrane...

10
441
0

Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx

Ngày tải lên : 22/03/2014, 21:20

... ATGTTACATGGCTTCTAGATAACTAG TACAATGTACCGmAAGATCTATTGATC ATGTTACATGGCTTCTAGATAACTAG TACAATGTACCGmAmAGATCTATTGATC ATGTTACATGGCTTCTAGATAACTAG TACAATGTACCG2GGATCTATTGATC ATGTTACATGGCTCCTAGATAACTAG TACAATGTACTCGAAGCTATCTATTGATC ... TACAATGTACTCGAAGCTATCTATTGATC ATGTTACATGAGCTTCGATAGATAACTAG TACAATGTATCATGAAGTACTCTATTGATC ATGTTACATAGTACTTCATGAGATAACTAG TACAATGTATCGCGAAGCGCTCTATTGATC ATGTTACATAGCGCTTCGCGAGATAACTAG TACAATGTACTCGAGCTAGATATCTATTTG ... TACAATGTACCGAAGATCTATTGATC ATGTTACATGGCTTCTAGATAACTAG TACAATGTACCGTGGATCTATTGATC ATGTTACATGGCACCTAGATAACTAG TACAATGTACCGAGAATCTATTGATC ATGTTACATGGCTCTTAGATAACTAG TACAATGTACCGAmAGATCTATTGATC ATGTTACATGGCTTCTAGATAACTAG...

18
329
0

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Ngày tải lên : 23/03/2014, 04:21

... saturation with ms intervals and a total saturation time of s On- resonance irradiation of the protein was conducted at a chemical shift of –0.4 p.p.m and off-resonance at a chemical shift of 30 ... whereas that for melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal, was in the intermediate exchange regime Thus, the conﬁguration at the hemiacetal carbon of galactose may affect the ... domain of EW29 at pH 6.1 and 298K in the sugar-free state Cross-peaks are labeled based on an analysis of through-bond connectivities The side chains of NH2 resonances of asparagines and glutamines...

11
458
0

báo cáo hóa học:" Cross-cultural development of an item list for computer-adaptive testing of fatigue in oncological patients" potx

Ngày tải lên : 20/06/2014, 15:20

... centres by the EORTC Quality of Life Department Items were Page of 10 translated from English into the target languages and then back-translated Details on the translation process are given in the EORTC ... 44 items and commented on them For details on patient characteristics see Table Translation issues The EORTC Quality of Life Department Translation Office translated the item list into the languages ... patient feedback the English item list was translated to Danish, French, German, and Spanish A total of 52 patients at five centres (in Austria, Denmark, France, Spain, and the UK) completed the...

10
461
0

Báo cáo hóa học: " Research Article A Note on Convergence Analysis of an SQP-Type Method for Nonlinear Semideﬁnite Programming" ppt

Ngày tải lên : 22/06/2014, 18:20

... section, we analyze the local quadratic convergence rate of an SQP-type method and then prove that the SQP-type method proposed in is globally convergent The analysis is based on the strong second-order ... that the constraint nondegeneracy condition is a sufficient condition for Robinson constraint qualification In the setting of the problem 1.1 , the constraint nondegeneracy condition holding at a ... 2 Journal of Inequalities and Applications Comparing with the work by Correa and Ramirez 2004 , in this note, we make some modifications to the convergence analysis, and prove that all results...

10
243
0

Báo cáo khoa học: " Effects of liming and gypsum regimes on chemical characteristics of an acid forest soil and its leachates" ppsx

Ngày tải lên : 08/08/2014, 18:21

... organic Of layer was analyzed separately Analytical methods Soil analyses The soil was analyzed before experimentation and at the end of the 20 month leaching period pH determination, the leachate ... investigate changes in the pH, exchangeable cations and base saturation after the addition of different types and quantities of lime and gypsum, and to examine leachate chemistry throughout the 20 month ... resulting from the 20 month experimental conditions TableI shows data on soil pH, organic carbon, exchangeable cations (Al, Ca, Mg, K), exchangeable acidity and base saturation data for the untreated...

12
294
0

Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

Ngày tải lên : 10/08/2014, 05:20

... technical assistance, and the Washington University AIDS Clinical Trials Unit for assistance We thank Brian Duffy for HLA typing and Dr Thalachallour Mohanakumar, Washington University Department of ... interests Abbreviations Because of the relatively long half life of efavirenz, patients who simultaneously discontinue combination antiretroviral therapy are exposed to functional efavirenz monotherapy ... the results DC assisted in study design and data analysis Both authors read and approved the final manuscript Page of (page number not for citation purposes) AIDS Research and Therapy 2006, 3:21...

4
259
0

báo cáo khoa học:" Cross-cultural development of an item list for computer-adaptive testing of fatigue in oncological patients" doc

Ngày tải lên : 12/08/2014, 01:22

... centres by the EORTC Quality of Life Department Items were Page of 10 translated from English into the target languages and then back-translated Details on the translation process are given in the EORTC ... 44 items and commented on them For details on patient characteristics see Table Translation issues The EORTC Quality of Life Department Translation Office translated the item list into the languages ... patient feedback the English item list was translated to Danish, French, German, and Spanish A total of 52 patients at five centres (in Austria, Denmark, France, Spain, and the UK) completed the...

10
453
0

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Ngày tải lên : 14/02/2014, 18:20

... inhibition Both TaLcc1 and MaL are also rather thermostable as compared with many other laccases The stabilization of both the N-termini and C-termini of TaLcc1 and MaL might be a reason for the ... being in the most favourable region of the Ramachandran plot (Table 2) Crystal structure of a Thielavia arenaria laccase Kinetic data Kinetic constants (Km and Vmax) for rMaL, TaLcc1 and ThL were ... plates with a Varioskan kinetic plate reader (Thermo Electron Corporation, Waltham, MA, USA) The reactions were started by addition of substrate, and the rate of substrate oxidation was measured...

13
888
0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Ngày tải lên : 18/02/2014, 06:20

... gi:91782944) was ampliﬁed from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide ... data analysis N is the number of ligands, r is the distance to the central iron atom, and r2 is the Debye–Waller factor The k-range is ˚ 2–13 A) 1 See Table S1 for further details of EXAFS data ... enzymatic catalysis of oxidative carbon– carbon bond cleavage However, a role of Fe2+ as an essential structural component of the active enzyme cannot be deﬁnitely ruled out on the basis of the data...

15
624
0

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Ngày tải lên : 18/02/2014, 16:20

... environment around the binding site upon binding of the diamagnetic Ca2+ (Fig 2C) No other resonances were affected at higher ratios, and the chemical shift variation reached a plateau at an approximately ... investigate the effect of a diamagnetic cation different from Ca2+, we used the lanthanide Lu3+, which has a full f orbital shell with an f14 electronic conﬁguration Lu3+ also has an ionic radius ... temperature factors were used only for the metal ions The presence of metal ions was ascertained by means of anomalous difference maps (DFano) [32] calculated with the Collaborative Computational...

12
704
0

Aircraft measurements over Europe of an air pollution plume from Southeast Asia – aerosol and chemical characterization pot

Ngày tải lên : 15/03/2014, 20:20

... for Monitoring and Evaluation of Long Range Transmission of Air Pollutants in Europe) emission database for the year 2003 These data are based on of cial country reports with adjustments made ... Eloranta, E., Hoff, R., Sachse, G., Barnet, C., Razenkov, I., and Wolf, W.: AIRS views of transport from 1023 July 2004 Alaskan/Canadian ﬁres: Correlation of AIRS CO and MODIS AOD and comparison ... located below the Asian plume in the mid-troposphere These North American air masses had left the East coast of the U.S on 21 March and arrived over Spain and France at about the same time as the...

25
502
0

Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf

Ngày tải lên : 16/03/2014, 16:20

... of Toronto Saturated 2,5-dihydroxybenzoic acid in methanol was used as the matrix solution The sample was dissolved in 20 lL methanol and lL was spotted on the sample target, and then lL of the ... Fig Comparison of VT1, mAb anti-Gb3 and VT2 staining of adult renal frozen sections (A) Serial renal sections from the sample from the 46 yearold (a d) and the 68 year-old (e–h) were stained with ... by their appropriate ligands Glycolipids are dynamic structures, both in terms of their lateral mobility and their organization within the plasma membrane The identiﬁcation of cholesterol and...

13
398
0

Báo cáo khoa học: Interaction of an 40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

Ngày tải lên : 16/03/2014, 18:20

... c-jun, that require their transcriptional activity to be modulated, the transient association and dissociation of transcription factors is advantageous c-jun belongs to a class of cellular genes, ... fraction eluted with M NaCl Analysis of fractions eluting in M NaCl (Fractions 42 and 45, lanes and 2, respectively) on SDS/PAGE revealed a prominent band of 40 kDa (Fig 6C) These data further ... in the formation of complex C1, allows rRLjunRP to bring about maximal activation of c-jun transcription A similar relationship in the concentrations of factors 5S RNA gene-speciﬁc transcription...

11
438
0

Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulﬁde linkage pdf

Ngày tải lên : 30/03/2014, 09:20

... and the NOEs from its a- proton to the amide proton of Phe5, and from its d-proton to the a- proton of Gly7 The valine residue at position was ﬁnally assigned on the basis of NOEs from the a- and ... standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series of NOESY spectra acquired at mixing times of 400, 200, 150, 100 and ... respectively O(j) and 3.2 A One thousand random structures were generated by dyana (v 1.5) that ﬁt the primary sequence and covalent and spatial requirements of mr3e A total of 190 distance constraints,...

7
346
0

Báo cáo khoa học: Identiﬁcation of an antibacterial protein as L-amino acid oxidase in the skin mucus of rockﬁsh Sebastes schlegeli pot

Ngày tải lên : 30/03/2014, 10:20

... surface mucus of the giant African snail, Achatina fulica ´ Ferussac (termed achacin) [26], the albumen gland of the sea hare, Aplysia kurodai (termed aplysianin A) [27], and the ink of the sea ... (138–151) and (436–453) of SSAP are thick underlined catalase on the antibacterial activity of SSAP was examined The addition of catalase almost completely abolished the antibacterial activity of SSAP, ... [33] On the other hand, Geyer et al [35] examined the structure of the glycan moiety of the LAO from the Malayan pit viper, Calloselasma rhodostoma, and assumed that putative binding of the LAO to...

12
470
0

Báo cáo hóa học: " Research Article Strong Convergence of an Implicit Iteration Algorithm for a Finite Family of " potx

Ngày tải lên : 22/06/2014, 22:20

... smooth if and only if the duality map J is single valued and norm-to-norm uniformly continuous on bounded sets of E Recall that if C and D are nonempty subsets of a Banach space E such that C is nonempty ... Optimization Theory and Applications, vol 116, no 3, pp 659–678, 2003 10 R H Martin Jr., “Diﬀerential equations on closed subsets of a Banach space,” Transactions of the American Mathematical Society, ... 96-2221-E-230-003 10 Journal of Inequalities and Applications References H K Xu and R G Ori, An implicit iteration process for nonexpansive mappings,” Numerical Functional Analysis and Optimization, vol 22,...

10
259
0

Báo cáo y học: " Maintenance treatment with esomeprazole following initial relief of non-steroidal anti-inflammatory drug-associated upper gastrointestinal symptoms: the NASA2 and SPACE2 studies'''' doc

Ngày tải lên : 09/08/2014, 10:20

... dimensions pre-specified as relevant to upper GI symptoms on each of the GSRS and QOLRAD questionnaires from baseline to last visit, analysed by analysis of covariance The proportion of patients maintained ... GlaxoSmithKline, and has participated in Speaker's Bureaus for AstraZeneca, TAP Pharmaceutical Products, Inc., and Santarus, Inc (San Diego, CA, USA) RHJ has received consultancy and speaker fees from AstraZeneca, ... (Madison, NJ, USA), and Grỹnenthal GmbH (Aachen, Germany) NJT has participated in consultant advisory boards sponsored by AstraZeneca and has received consultant's research support from TAP Pharmaceutical...

9
412
0

báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

Ngày tải lên : 10/08/2014, 23:20

... in the right hepatic artery [2] Intrahepatic HAPs account for only about 20% of all HAPs and are often a complication of percutaneous procedures such as transhepatic cholangiography, transhepatic ... Selective arteriography may also show active bleeding and anatomic variations such as an anomalous or replaced hepatic artery [6], and can be used in simultaneous diagnosis and treatment The recent extended ... Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K: Transcatheter arterial embolization of ruptured pseudoaneurysms with coils and n-butyl cyanoacrylate J Vasc Intervent Radiol 2000,...

4
309
1