Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe 2+ -dependent oxygenase that cleaves b-diketones Stefan Leitgeb, Grit D. Straganz and Bernd Nidetzky Institute of Biotechnology and Biochemical Engineering, Graz University of Technology, Austria Introduction In terms of their physiological functions, which include enzymatic catalysis, ligand binding, and the role of storage proteins, the cupins constitute one of the most diverse superfamilies of proteins known. They have been described from all three domains of life [1,2], and usually occur as metalloproteins. Regardless of their Keywords cupin; nonheme iron; oxygenase; X-ray absorption spectroscopy; b-diketone cleavage Correspondence Bernd Nidetzky, Institute of Biotechnology and Biochemical Engineering, Graz University of Technology, Petersgasse 12 ⁄ I, A-8010 Graz, Austria Fax: +43 316 873 8434 Tel: +43 316 873 8400 E-mail: bernd.nidetzky@tugraz.at (Received 15 October 2008, revised 31 July 2009, accepted 17 August 2009) doi:10.1111/j.1742-4658.2009.07308.x Cupins constitute a large and widespread superfamily of b-barrel proteins in which a mononuclear metal site is both a conserved feature of the struc- ture and a source of functional diversity. Metal-binding residues are con- tributed from two core motifs that provide the signature for the superfamily. On the basis of conservation of this two-motif structure, we have identified an ORF in the genome of Burkholderia xenovorans that encodes a novel cupin protein (Bxe_A2876) of unknown function. Recom- binant Bxe_A2876, as isolated from Escherichia coli cell extract, was a homotetramer in solution, and showed mixed fractional occupancy of its 16.1 kDa subunit with metal ligands (0.06 copper; 0.11 iron; 0.17 zinc). Our quest for possible catalytic functions of Bxe_A2876 focused on Cu 2+ and Fe 2+ oxygenase activities known from related cupin enzymes. Fe 2+ elicited enzymatic catalysis of O 2 -dependent conversion of various b-dike- tone substrates via a nucleophilic mechanism of carbon–carbon bond cleavage. Data from X-ray absorption spectroscopy (XAS) support a five-coordinate or six-coordinate Fe 2+ center where the metal is bound by three imidazole nitrogen atoms at 1.98 A ˚ . Results of structure modeling studies suggest that His60, His62 and His102 are the coordinating residues. In the ‘best-fit’ model, one or two oxygens from water and a carboxylate oxygen (presumably from Glu96) are further ligands of Fe 2+ at estimated distances of 2.04 A ˚ and 2.08 A ˚ , respectively. The three-histidine Fe 2+ site of Bxe_A2876 is compared to the mononuclear nonheme Fe 2+ centers of the structurally related cysteine dioxygenase and acireductone dioxygenase, which also use a facial triad of histidines for binding of their metal cofac- tor but promote entirely different substrate transformations. Abbreviations ARD, acireductone dioxygenase; CDO, cysteine dioxygenase; Dke1, b-diketone-cleaving dioxygenase; DLS, dynamic light scattering; EXAFS, extended X-ray absorption fine structure; QDO, quercetin dioxygenase; RgCarb, Rubrivivax gelatinosus acetyl ⁄ propionyl-CoA carboxylase; SOD, superoxide dismutase; XANES, X-ray absorption near-edge structure; XAS, X-ray absorption spectroscopy. FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5983 low sequence homology, proteins classified as cupins display a common double-stranded b-helix fold that forms a core b-barrel. Two highly conserved histidine- containing motifs separated by a variable intermotif region provide the signature for the superfamily and contribute the residues for metal binding [1,2]. A wide range of catalytic functions, spanning primary enzyme classes EC 1, EC 3, EC 4, and EC 5, have evolved in cupin proteins [3–6]. Because the metal center usually fulfils an essential role in catalysis by cupin enzymes, there is the fundamental question of how the structures of cupin proteins determine metal-binding recognition as well as reactivity in chemical transformations. Func- tional annotation of cupin proteins from sequence and 3D structural data alone is a challenging task [7], as reflected by the recent addition of several new protein structures (Protein Data Bank identifiers of selected examples: 2PFW, 1VJ2, 2OZJ, 3ES1, 3EBR, 3FJS, 3ES4, 3D82, 3BCW, 3CEW, and 3CJX) to the data- base without assignment of a putative function. Metal promiscuity in several cupin enzymes, including super- oxide dismutase (SOD) (Fe 2+ ,Mn 2+ ) [8], acireductone dioxygenase (ARD) (Ni 2+ ,Fe 2+ ) [9,10], quercetin dioxygenase (QDO) (Cu 2+ ,Fe 2+ ) [11,12], and homo- protocatechuate 2,3-dioxygenase (Mn 2+ ,Fe 2+ ) [13,14], further adds to the complexity of structure–function relationships. Fe 2+ cupins have recently attracted special atten- tion because of the important roles that they play in cell biology, such as DNA ⁄ RNA repair [15] and O 2 sensing [16]. Their ability to promote a wealth of O 2 -dependent transformations has raised interest among enzymologists and bioinorganic chemists. In contrast to their catalytic versatility, the protein me- tallocenters that bind the Fe 2+ display a remarkably conserved structure [2,17–19]. A facial triad of two histidines and one carboxylate residue (aspartate or glutamate), exemplified by the metal centers of a large class of 2-ketoglutarate-dependent oxygenases, was long thought to form the canonical primary coordination sphere for the Fe 2+ cofactor, as shown in Fig. S1A [18]. With the expansion of the structural basis for Fe 2+ cupins, it has recently become clear that the original two-motif structure of cupins, as in germin (Fig. S1B), is also capable of forming a mononuclear nonheme center for Fe 2+ , in which three histidines are coordi- nated. Structurally characterized cupin oxygenases har- boring this alternative Fe 2+ site are cysteine dioxygenase (CDO) (Protein Data Bank identifier: 2ATF) [20], ARD (Protein Data Bank identifier: 1VR3) [21], QDO (Protein Data Bank identifiers: 1Y3T and 1JUH) [11,12], gentisate 1,2-dioxygenase (Protein Data Bank identifiers: 2D40 and 3BU7) [22,23], and b-diketone-cleaving dioxygenase (Dke1) (Protein Data Bank identifier: 3BAL) [24]. Pirins are nuclear proteins that also contain a three-histidine cen- ter for Fe 2+ (Protein Data Bank identifiers: 1J1L and 1TQ5), and were recently shown to display QDO activ- ity [25,26]. Advances in our knowledge of structure–activity relationships for these and other three-histidine cen- ters of Fe 2+ is currently limited by insufficient bio- chemical evidence, and would benefit from the characterization of novel cupin oxygenases of this group. We identified an ORF in the genome of the polychlorinated biphenyl-degrading proteobacterium Burkholderia xenovorans through a database search in which the cupin signature and the sequence of Dke1 from Acinetobacter johnsonii were used as queries. The deduced primary structure of the novel cupin protein Bxe_A2876 (UniProtKB: Q140Z1) and a structural model derived from it suggested a cupin protein featuring a three-histidine metal site. To examine the unknown function of Bxe_A2876, we performed a detailed biochemical characterization of the recombinant protein produced in Escherichia coli. A screening for O 2 -dependent enzyme activities elic- ited by different combinations of metal and substrate revealed that the Fe 2+ form of Bxe_A2876 was an efficient catalyst of carbon–carbon bond cleavage in b-diketone substrates. X-ray absorption spectroscopy (XAS) was used to examine the coordination of Fe 2+ in the active site of the resting enzyme. The best fit of the extended X-ray absorption fine structure (EX- AFS) data indicated a five-coordinate or six-coordi- nate Fe 2+ center that involves three nitrogen donors from the histidine imidazole, one oxygen donor from a carboxylate side chain, and one or two oxygen donors from water. The Fe 2+ center of b-diketone- cleaving oxygenase has not been previously character- ized structurally. Results Structural properties of Bxe_A2876 Figure 1A shows a multiple alignment of the deduced primary structure of Bxe_A2876 with the sequences of Dke1 and a structurally characterized cupin protein from Rubrivivax gelatinosus PM1 (Protein Data Bank identifier: 2O1Q) that has been functionally annotated as acetyl ⁄ propionyl-CoA carboxylase (RgCarb). The three proteins share a high amount of sequence iden- tity (equal to or > 50%) and homology (equal to or > 70%). A homology model of Bxe_A2876 was there- b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al. 5984 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS fore constructed, and the obtained fold was aligned with the crystallographically determined structures of the subunits of Dke1 (Protein Data Bank identifer: 3BAL) and RgCarb (Fig. S2). Residue conservation in the cupin two-motif structure of Bxe_A2876 suggests a three-histidine metal center as in Dke1 and RgCarb (Fig. 1A). A close-up view of the nonheme metal site in the structural model of Bxe_A2876 is given in Fig. 1B. It supports the proposed mode of coordina- tion with His60, His62 and His102 as metal ligands. Note that the coordinating histidines are contributed from b-strands of the central cupin barrel, suggesting a rather rigid metal-binding site. Residues in the immedi- ate vicinity of the metal center (Glu96, Thr105, Met115, Phe117 and Leu121 in Bxe_A2876) are con- served in the modeled structure relative to the experi- mentally determined protein structures. It is therefore interesting to note that the crystal structures of Dke1 and RgCarb were both solved for the respective Zn 2+ - bound proteins. However, Dke1 requires Fe 2+ to be active as a b-diketone-cleaving oxygenase. The first coordination sphere of Fe 2+ could thus be different from that of Zn 2+ seen in the enzyme structure (see Discussion). On an SDS ⁄ polyacrylamide gel of recombinant Bxe_A2876 isolated from E. coli BL21(DE3), the puri- fied protein migrated as a single band to the approxi- mate position in the gel that was expected from its predicted subunit size of 16 kDa (Fig. S3, lane 3). Prior to purification and intein-tag cleavage, the bacte- rial cell extract displayed a clear protein band of a size corresponding to the  75 kDa mass for the fusion of Bxe_A2876 and the IMPACT tag (Fig. S3, lane 2). We used dynamic light scattering (DLS) to evaluate the multiplicity of protomers in a preparation of Bxe_A2876 as isolated, and results unambiguously showed the protein to be tetrameric. The calculated molecular mass based on DLS data was 73 kDa, and corresponds reasonably with the predicted molecular mass of 64.4 kDa for the Bxe_A2876 homotetramer. The relative distribution of secondary structure elements of Bxe_A2876 derived from CD spectroscopic data (Fig. 2) agreed very well with the findings from the structure modeling studies. Metal-dependent reactivities of Bxe_A2876 The protein as isolated from E. coli cell extracts showed mixed fractional occupancy of its 16.1 kDa subunit with metal ligands (0.06 copper; 0.11 iron; 0.17 zinc). We focused the quest for possible enzymatic A B Fig. 1. Sequence analysis and structure modeling for Bxe_2876. (A) Multiple sequence alignment of Bxe_A2876 with Acinetobac- ter johnsonii Dke1 (AjDKE) and RgCarb (RgCAR). The sequence alignment was performed with ALIGNX as a component of VECTOR NTI 9.0.0, using standard settings. Secondary structure elements were manually assigned using the crystal structure of RgCarb (Protein Data Bank: 2O1Q). H indicates a-helix, and –> indicates b-strand. Metal ligands are shown in bold, and conserved residues are shown in italic. (B) Predicted active site of Bxe_A2876 expanded 6 A ˚ around the metal center. Figures were created with PYMOL 0.99 [53]. Fig. 2. CD spectrum of Bxe_A2876. Evaluation of the data was performed with DICHROWEB. The inset shows the distribution of secondary structure elements. [h] MRE is the mean residual molar ellipticity. S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5985 functions of Bxe_A2876 on O 2 -dependent substrate transformations catalyzed by members of the cupin superfamily. Considering the structural similarity to Dke1, special emphasis was placed on enzymatic reac- tions involving Fe 2+ as cofactor. Reactions that could have been promoted by a Zn 2+ protein were not inves- tigated. Preparations of Bxe_A2876 reconstituted with Fe 2+ or Cu 2+ were completely inactive against superoxide. These proteins did not consume detectable amounts of O 2 when one of the following substrates was offered to a protein solution containing 7 lm metal sites: xanthine in the presence of 2-ketoglutarate; cat- echol; or quercetin. However, when a series of b-dike- tones were tested in combination with the Fe 2+ protein (see below), the activity of Bxe_A2876 towards O 2 was markedly stimulated as compared with controls that contained apoprotein or lacked a putative substrate. The Cu 2+ form of Bxe_A2876 did not show activity under otherwise identical reaction conditions. The activity of Fe 2+ Bxe_A2876 with b-diketones was characterized by comparing measurements of con- sumption of O 2 and substrate with the formation of detectable products. Figure S4 shows that conversion of 2,4-pentanedione (5 mm) proceeded with depletion of a molar equivalent of dissolved O 2 . HPLC analysis of the products of the enzymatic transformation revealed that Bxe_A2876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate. Kinetic characterization of Fe 2+ Bxe_A2876 The activity of Bxe_A2876 in the O 2 -dependent con- version of b-diketones was strictly dependent on the Fe 2+ cofactor. We determined catalytic constants (k cat ) for different preparations of Bxe_A2876 whose frac- tional occupancy with Fe 2+ varied between 0.1 and 0.9. Whereas the apparent value of k cat that was calcu- lated from the V ⁄ [E] ratio (where V is the reaction rate and [E] is the molar concentration of the 16 kDa protein subunit) increased linearly with increasing fractional saturation of the metal site in Bxe_A2876, the k cat determined from the molar concentration of Fe 2+ -containing active sites was constant. It had a value of  0.8 s )1 for air-saturated reaction conditions at athmospheric pressure ( 250 lm O 2 ). It was noted that the dithiothreitol used in the intein cleavage step of the purification protocol caused irreversible inacti- vation of the purified enzyme (data not shown). We therefore believe that dithiothreitol could be a source of variation in the k cat of Bxe_A2876 preparations as isolated. However, attempts to replace dithiothreitol with b-mercaptoethanol (45 mm) or hydroxylamine (50 mm) in the purification proved fruitless. The dura- tion of exposure of Bxe_A2876 to dithiothreitol was therefore kept as short as possible, and repeated cycles of buffer exchange were used after the purification to carefully remove any of the dithiothreitol still present in solution. The reported kinetic data are for the of Bxe_A2876 exhibiting a k cat of 0.8 s )1 . The Michaelis constant for 2,4-pentanedione was 5.1 lm (± 0.3 lm) and independent of the fractional occupancy of Bxe_A2876 with Fe 2+ . To characterize substrate structural requirements for the reaction catalyzed by Bxe_A2876, we tested a series of b-diketones and related compounds in a two- step assay. Enzyme substrates were first identified by their ability to elicit O 2 consumption by Fe 2+ Bxe_A2876, and initial rate kinetic data were then acquired by measuring spectroscopically the conversion of the respective substrate. Previously reported molar extinction coefficients for each active compound [27] were confirmed and used in the determination of reaction rates under conditions of apparent saturation of the enzyme with the respective substrate. The following k cat values were obtained: 0.4 s )1 for 3,5- heptanedione; 0.4 s )1 for 2,4-octanedione; 0.2 s )1 for 2,4-nonanedione; and 3.5 s )1 for 2-acetylcyclohexa- none. By way of comparison, k cat values of Bxe_A2876 were lower, by about one order of magnitude, than the corresponding k cat values of Dke1 [28]. Bxe_A2876 was inactive towards 3,3-dimethylpentanedione, 1,3- cyclohexanedione, and 4-methyl-2-oxovalerate, and these compounds are likewise not turned over by Dke1. Bond cleavage selectivity Unlike 2,4-pentanedione, whose symmetrical molecular structure dictates that its conversion by Bxe_A2876 can yield only a single pair of products, carbon–carbon bond cleavage in substrates harboring a different sub- stituent on either side of the central b-diketone moiety can proceed in one of two possible ways, each leading to a characteristic pair of products. Scheme 1 shows the possible reaction coordinates for 1-phenyl-1,3- butanedione. We used HPLC analysis to determine the distribution of products obtained upon enzymatic con- version of a series of b-diketone substrates, which are listed in Tables 1 and S4. The results reveal that the bond cleavage selectivity of Bxe_A2876 was strongly influenced by the structural properties of the substitu- ents. The turnover number of the enzyme also showed a large substituent effect. b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al. 5986 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS Scheme 1. Possible cleavage pathways of 1-phenyl-1,3-butanedione during enzymatic conversion by Bxe_A2876. Table 1. Relative turnover numbers and cleavage ratios of 2,4-pentanedione and substituted variants. Activity measurements were per- formed spectrophotometrically at 280 nm, where a decrease in absorbance reflects depletion of b-diketone substrate. Turnover numbers were normalized using the k cat value for 2,4-pentanedione (0.8 s )1 ). Product analysis was performed by HPLC. The cleavage ratio is the ratio of the concentrations of methylglyoxal (c 2 ) and acetate (c 1 ) formed upon conversion of unsymmetrical derivatives of 2,4-pentanedione. When benzoylic substrates are used, the relevant ratio is that of phenylglyoxal (c 2 ) and benzoate (c 1 ). The preferred cleavage site in the respective b-diketone substrate is indicated. The full set of experimental data used in the calculation of the cleavage ratio is shown in Table S4. NM, not measured. Structure Substrate Relative k cat Cleavage ratio, c 2 ⁄ c 1 2,4-Pentanedione 1 1 1,1-Difluoro-2,4-pentanedione 2 · 10 )3 8.2 1,1,1-Trifluoro-2,4-pentanedione 3 · 10 )4 NM 1-Phenyl-1,3-butanedione 5 · 10 )2 0.3 4,4-Difluoro-1-phenyl-1,3-butanedione 4 · 10 )4 7.5 S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5987 b-Diketone-cleaving oxygenase activity in B. xenovorans We examined growth and the formation of oxygenase activity in B. xenovorans using the media listed in Table S2. The strain did not grow on 2,4-pentanedione as the sole carbon source. Growth was observed on a mixed carbon source of glucose and 2,4-pentanedione. However, it was much lower than in the ‘glucose-only’ medium, suggesting that 2,4-pentanedione inhibits the growth of the organism (Table S3). Crude cell extracts of B. xenovorans were analyzed by SDS ⁄ PAGE. The distribution of protein bands on the gel was not altered significantly in response to a change in incubation conditions. A protein of about 16 kDa was not abundant in the cell extracts (data not shown). However, the b-diketone-cleaving oxygenase activity displayed by isolated preparations of recombi- nant Bxe_A2876 was clearly present in B. xenovorans. Cell extracts obtained from bacteria incubated in the presence of glucose and 2,4-pentanedione con- tained a low level of specific activity (£ 5mU mg )1 protein). By contrast, no activity was measured in cells grown on glucose alone. Addition of 2.0 mm Fe 2+ to the assay strongly enhanced the enzyme activ- ity by a factor of 10–50. Interestingly, upon comple- mentation with Fe 2+ , differences in specific activity for cells grown in the presence and absence of 2,4-pentan- edione were essentially eliminated at a level of  100 mU mg )1 (Table S3). The specific activities measured in B. xenovorans can be compared to a value of  1600 mU mg )1 for the purified recombinant enzyme. Characterization of the nonheme Fe 2+ center by XAS Figure 3A displays the XANES spectrum of Bxe_A2876 around the Fe 2+ absorption edge. The pre-edge feature of the spectrum at energies near 7113 eV reveals a forbidden 1s fi 3d electronic tran- sition that, according to prior studies of nonheme Fe 2+ centers [29–31], is assigned to the mixing of the 4p orbital with the 3d orbital of the metal cofactor. Two important pieces of information can be gleaned from the pre-edge peak. First, occurrence of this tran- sition implies distortion of the metal center from per- fect octahedral geometry. Second, the area associated with the peak was previously shown to provide a use- ful measure of the coordination number of the Fe 2+ center [29–31]. The value of (12 ± 1) · 10 )2 eV there- fore indicates that the Fe 2+ bound to Bxe_A2876 is coordinated by a total of five ligand atoms. An initial estimation of the first coordination shell of Fe 2+ was made using abra [32]. The average of the six best models lacked sulfur as Fe 2+ ligand, and A B C Fig. 3. X-ray absorption spectroscopy data for Bxe_A2876. (A) Fe K-edge region in the XANES spectrum. (B) k 3 -weighted EXAFS spectrum of Bxe_A2876 (solid line, black) overlaid by the fit model of three histidines, one carboxylate, and one H 2 O (dotted line, gray). v(k) is the EXAFS amplitude. See Table 2 for further details of the fit. (C) Fourier transform (FT) of the EXAFS data. r is the metal–ligand distance corrected for the phase shift. b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al. 5988 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS contained two or three nitrogen donors and three oxygen donors at a distance of 2.00 A ˚ . Further refine- ment was performed with excurv98, using various models (Table S1) that incorporated histidine imidaz- ole nitrogen atoms and different oxygen donor groups. Separation of the single shell of scattering nitro- gen ⁄ oxygen atoms into two shells (see center types 1 and 3 in Table S1) did not improve the goodness of fit significantly, and gave differences in coordination distance between the two shells (D  0.13–0.16 A ˚ ) that were generally at the limit of the resolution of the data ( 0.14 A ˚ ). Nitrogen and oxygen donor groups could not be distinguished with the methods used. However, metal centers based on histidine imidazole nitrogen donor groups clearly improved the goodness of fit, and it was possible to identify a probable combination of nitrogen and oxygen donor groups as well as the corresponding metal–scatterer distances. Figure 3B shows the EXAFS data together with the best theoretical fit that we obtained. The suggestion for the nonheme Fe 2+ center consists of three imidaz- ole nitrogen atoms, one carboxylate oxygen atom from either glutamate or aspartate, and one or two oxygen atoms from water. The comparison of fits provided by metal center type 8 (three histidines, two H 2 O) and type 11 (three histidines, one carboxylate, one H 2 O) gives strong support to the idea of a carboxylate oxy- gen ligand for the Fe 2+ in Bxe_A2876. In particular, the 3.1 A ˚ scatterer peak in the EXAFS spectra was very well accounted for by center type 11, whereas it was only poorly represented using center type 8. The phase shift-corrected Fourier transform of the EXAFS data is displayed in Figure 3C. Note that reasonable Debye–Waller factors for all scattering atoms were obtained using center type 11. Discussion Bxe_A2876 is an Fe 2+ -dependent oxygenase from B. xenovorans that catalyzes the cleavage of carbon– carbon bonds in b-diketone substrates. The enzyme is not inducible by addition of b-diketone to the growth medium. Cell extracts of B. xenovorans appear to contain Bxe_A2876 largely in the inactive apo-form. It is therefore possible that the enzyme recruits its redox- active metal cofactor together with the substrate from the solution complex of Fe 2+ and b-diketone, which is known from the literature to be quite stable [33]. The molecular and mechanistic properties of Bxe_A2876 are very similar to those of Dke1 (EC 1.13.11.50) [28,34,35]. Evidence from XAS supports a five-coordi- nate or six-coordinate Fe 2+ cofactor. Imidazole nitro- gen atoms of His60, His62 and His102 and a carboxylate oxygen atom, presumably contributed by the side chain of Glu96, are suggested to function as protein-derived ligands of the bound metal. Mechanistic deductions from biochemical data for Bxe_A2876 The proposed catalytic mechanism utilized by Bxe_A2876 in the O 2 -dependent conversion of 2,4-pen- tanedione is shown in Scheme 2. The results are consistent with participation of Fe 2+ as a redox-active cofactor in enzymatic catalysis of oxidative carbon– carbon bond cleavage. However, a role of Fe 2+ as an essential structural component of the active enzyme cannot be definitely ruled out on the basis of the data presented. As in Dke1, an important prerequisite for b-dike- tones to be accepted as substrates of Bxe_A2876 appears to be the ability to rearrange into a cis-b- keto–enol structure. The required structure is not accessible, for chemical and steric reasons, respectively, in 3,3-dimethylpentanedione and 1,3-cyclohexanedione. Productive binding of 2,4-pentanedione and cognate b-diketones probably involves coordination to the Fe 2+ cofactor as cis-b-keto–enolates, as shown in Scheme 2. From the literature [28,34,35], the b-diketone bound at the active site of Bxe_A2876 would seem to undergo O 2 -dependent transformation into a C-3 peroxo inter- mediate. Fe 2+ is expected to provide essential catalytic assistance for this conversion. The low reactivity of substrates harboring electron-withdrawing substituents such as fluorine (Table 1) is explicable by a chemical Scheme 2 Proposed reaction mechanism of Bxe_A2876. S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5989 mechanism in which strong nucleophilic participation of the substrate is required during the initial reduction of O 2 [28,34–36]. Previous studies of Dke1 have also shown that elec- tronic substituent effects on the distribution of prod- ucts resulting from the cleavage of the b-diketone substrate provide useful insights into the enzymatic mechanism of carbon–carbon bond fission. Note, how- ever, that the substituent effects governing the bond cleavage steps are not the same as those controlling the reactivity towards O 2 ; hence the formation of the proposed peroxo intermediate, which is rate-limiting in the reaction catalyzed by Dke1 [35]. Upon intro- duction of the strongly electron-withdrawing difluoro- methyl group, a marked shift in bond cleavage specificity was observed as compared with the corresponding specificity for the unsubstituted parent substrate (Tables 1 and S4). The measured preference for bond cleavage at the more electron-deficient carbonyl carbon of the b-diketone moiety is consistent with a nucleophilic mechanism of carbon–carbon bond fission, where the C-3 peroxo intermediate undergoes decomposition via a dioxetane (see [34,35] for a detailed discussion). It is proposed in Scheme 2 that the distal oxygen of the peroxidate performs an intra- molecular attack on a neighboring carbonyl carbon, preferably the one that harbors the relatively more strongly electron-withdrawing substituent (e.g. –CHF 2 as compared with –CH 3 ), to yield the dioxetane, from which products are finally generated through concerted C–C and O–O bond cleavage. From the evidence reported herein, as well as the previous mech- anistic analysis for Dke1 [34], a Criegee rearrangement mechanism of bond cleavage by Bxe_A2876 seems unlikely. The three-histidine center of Fe 2+ in Bxe_A2876 Results of analysis of the X-ray absorption spectra arising from the Fe 2+ in Bxe_A2876 are consistent with five or six nitrogen ⁄ oxygen ligands of the bound metal. Although X-ray absorption near-edge structure (XANES) data favor a five-coordinate Fe 2+ , the pres- ence of six donor groups, as in the related Fe 2+ sites of CDO [27], human pirin [25,26], and gentisate 1,2- dioxygenase [22,23], cannot be definitely ruled out. The modeled structure of the nonheme metal site of Bxe_A2876 (Fig. 1B) predicts that three nitrogen donor ligands are contributed by the side chains of the cupin triad of histidines, His60, His62, and His102. This is in excellent agreement with the suggestion from EXAFS analysis that three nitrogen atoms from the histidine imidazole coordinate the Fe 2+ . EXAFS data further suggest that the Fe 2+ center of Bxe_A2876 does not involve a sulfur donor ligand, again consistent with the model of the active site (Fig. 1B), which has no candidate cysteine within a realistic coordination distance from the likely position of the Fe 2+ . There is, however, strong evidence from the EXAFS analysis that the Fe 2+ cofactor is coordi- nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or an aspartate. The apparent conflict of this finding with the absence of a coordinating carboxylate in the mod- eled metal center of Bxe_A2876 is reconciled by considering that the template structures used for homology modeling are for cupin proteins (Dke1, RgCarb) in their respective Zn 2+ -bound form. Accom- modation of Fe 2+ in the metallocenter may require a subtly different active site conformation from that employed for the binding of Zn 2+ . In a previous study of ARD, it was shown that similar, but not identical, metal-binding modes are exploited for the coordination of Fe 2+ and Ni 2+ cofactors. However, the enzyme is active with both metal ions, despite different catalytic pathways [37]. From the structure model of Bxe_A2876, the most plausible candidate amino acid coordinating Fe 2+ would be Glu96. In a Zn 2+ -bound enzyme that was completely inactive as a b-diketone-cleaving oxygenase (data not shown) and therefore was not investigated here, this glutamate could adopt an alternative, nonco- ordinating, conformation that orients its carboxylate side chain out of the metal center (Fig. 1B), as observed for homologous glutamate residues in the crystal structures of Zn 2+ -Dke1 and Zn 2+ -RgCarb. The proposed Fe 2+ center (three histidines, one gluta- mate, and one or two H 2 O) for Bxe_A2876 in the rest- ing state is therefore novel among b-diketone-cleaving oxygenases of the cupin protein superfamily, and significantly advances our knowledge of the structural– mechanistic basis for this group of enzymes. The opti- mized metal–ligand distances (Table 2) compare very favorably with data in the protein database, from which an average distance of 2.03 A ˚ for Fe–N(His) was inferred [38], and a target distance of between 1.93 and 2.13 A ˚ for Fe–O was obtained [39]. Considering the proposed mode of substrate coordination by the Fe 2+ of Bxe_A2876 (Scheme 2), it seems probable that metal ligation by protein side chains undergoes a change as result of binding of the b-diketone. Mecha- nistically, a five-coordinate Fe 2+ in the enzyme– substrate complex, as implied by Scheme 2, would leave one coordination site on the catalytic metal for reaction with O 2 . Work on QDO provides a relevant example, showing that the side chain of the glutamate b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al. 5990 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS participating in metal coordination in the free enzyme rotates away upon accommodation of the substrate in the active site [40]. The possibility of Glu96 also adopting a noncoordinating position in Bxe_A2876 has been mentioned. The model for the nonheme Fe 2+ center of Bxe_A2876, as derived by the combination of mole- cular modeling and XAS, is similar to related three- histidine metal sites which were characterized by X-ray crystallography [20,21,41,42], XAS [27,37], or a combi- nation of the two methods [27,41]. The three-histidine one-glutamate type of metal coordination was found in high-resolution structures of resting state forms of Cu 2+ -QDO [40], Ni 2+ -ARD [21], and Fe 2+ -pirin [25]. Metal coordination by a tetrad of three histidines and one glutamate was likewise seen in other members of the cupin protein superfamily, including oxalate oxidase (germin) [6]. Interestingly, the position of the glutamate ligand was not conserved in the amino acid sequence, relative to the cupin core motifs that contribute the three histidine ligands in each of these proteins. For QDO, XAS studies were performed with the Cu 2+ enzyme [43]. XAS data for rat CDO in the rest- ing state and in complex with l-cysteine were both consistent with six nitrogen or oxygen donor ligands being bound to the Fe 2+ at average distances of 2.04 A ˚ and 2.12 A ˚ , respectively [27]. In resting ARD, the Fe 2+ was also six-coordinate and had two nitro- gen(oxygen) donor ligands at an average distance of 1.90 A ˚ and four nitrogen(oxygen) ligands at an average distance of 2.06 A ˚ . Three of the four ligands were reported to be consistent with histidine imidazole side chains. Upon formation of the ARD–acireductone complex, the best fit of the EXAFS suggested three nitrogen(oxygen) donor ligands at an average distance of 1.92 A ˚ and three nitrogen(oxygen) donor ligands at an average distance of 2.15 A ˚ , one of which was an imidazole side chain of histidine [37]. Interestingly, the prominent second sphere feature at a distance of about 3.15 A ˚ in the Fourier transform of the EXAFS spec- trum of Bxe_A2876 (Fig. 3C) was not observed in the corresponding spectra of CDO and ARD, suggesting subtle differences in the coordination of Fe 2+ by Bxe_A2876 as compared with the other two enzymes. The active site of resting QDO was equally well described by four or five ligands of Cu 2+ (three nitro- gen donors from the histidine imidazole and one or two oxygen donors) at an average distance of 2.00 A ˚ . In the anaerobic complex of QDO and quercetin, the Cu 2+ was five-coordinate, with three histidine nitrogen donors and two oxygen donors in a single shell at 2.00 A ˚ [43]. Collectively, the XAS analysis for the Fe 2+ bound to Bxe_A2876 makes an important contribution to the characterization of the emerging three-histidine group of nonheme Fe 2+ centers. The results obtained are in useful agreement overall with suggestions from struc- ture modeling studies of Bxe_A2876. The XAS data indicate that binding of Fe 2+ may require a different active site conformation than binding of Zn 2+ . Flexi- bility of the conserved Glu96 could have a role in determining metal-binding selectivity. An immediate question that arises upon comparison of the XAS data for Bxe_A2876, CDO and ARD pertains to the rela- tionship between coordination of the catalytic metal and reactivity in different O 2 -dependent transforma- tions. Examination of the function of noncoordinating Table 2. Proposed ligand environment of the iron bound in the active site of Bxe_A2876 in the resting state, as derived from EXAFS data analysis (fit 2). The ‘best-fit’ model (fit 2) is compared with one of the initial models considered (fit 1). See Table S1 for further details of EXAFS data analysis. N is the number of ligands, r is the distance to the central iron atom, and r 2 is the Debye–Waller factor. The k-range is 2–13 A ˚ )1 . See Table S1 for further details of EXAFS data analysis. Fit Ligand Atom type Nr(A ˚ ) r 2 (A ˚ 2 ) E 0 (eV) R-factor (%) Fit index 1N⁄ O 5 2.02 0.013 )5.65 35.61 0.2207 2 His N 3 1.98 0.008 a C 3.04 0.012 b C 3.13 0.012 b N 4.06 0.016 c C 4.31 0.016 c )6.57 16.65 0.0134 Glu O 1 2.04 0.008 a C 3.31 0.012 b O 4.28 0.012 b C 3.83 0.012 b H 2 O O 1 2.08 0.008 a a,b,c The Debye-Waller factors were grouped and refined in batches (a, b and c). S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5991 residues in and around the active site may provide the answer. Systematic comparison of biochemical infor- mation with structural evidence for different three- histidine cupin enzymes will hopefully lead to the identification of fingerprint regions that determine metal-binding selectivity and catalytic activity (see the recent work on ARD [37]). Within the cupin super- family of proteins, structure-based distinction between Fe 2+ and Mn 2+ forms of SOD provides an interesting example [8]. Experimental procedures Materials B. xenovorans LB400 was obtained from the Belgian Co-ordinated Collections of Micro-organisms (BCCM, Gent, Belgium), deposited under accession number LMG 21463. It was grown using a protocol supplied by BCCM. All chemicals were purchased from Sigma-Aldrich (Gillingham, UK) in the highest available purity. B-Per and the bicinchoninic acid assay were from Thermo Scientific (Waltham, MA, USA). All materials for genetic work were obtained from New England Biolabs (Beverly, MA, USA) and Fermentas International Inc. (Burlington, Canada). Cultivation Table S2 summarizes the different conditions in which the B. xenovorans strain was incubated to examine growth and the formation of oxygenase activity. All experiments were performed in 80 mL shaken flasks at 30 °C, using an agita- tion rate of 110 r.p.m. Bacteria obtained after growth for 48 h in medium B2 were used for inoculation of 250 mL of medium to an initial attenuance at 600 nm of  0.4. Culti- vation was continued for 48 h, and cells were harvested by centrifugation (15 min, 4 °C, 4400 g). Crude cell extract was prepared by lysis with B-Per reagent, following the manufacturer’s protocol. The protein concentration was determined using the bicinchoninic acid assay, and oxygen- ase activity measurement was performed using the photo- metric and HPLC assay described below. The activity of the crude extract was expressed as mUÆmg )1 protein. One unit is defined as the amount of enzyme needed for the con- version of 1 lmol acetylacetone min )1 . Cloning The gene encoding Bxe_A2876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed to introduce restriction sites (under- lined) for NdeI and SapI, respectively. The amplified gene and a pTYB1 plasmid vector were digested with NdeI and SapI in a one-pot reaction at 37 °C for 1 h. After purification of the DNA by precipitation with ethanol, the gene was ligated with the pTYB1 vector using T4 DNA ligase in an overnight reaction at room temperature. Following degrada- tion of empty plasmid by XhoI (37 °C, 1 h), the ligation mixture was transformed into E. coli TOP10 cells by electro- poration. Cells were subsequently transferred to LB–ampicil- lin plates. Single colonies were picked, and plasmids were isolated with a QIAprep spin Miniprep Kit from Qiagen (Hilden, Germany). Positive clones were selected by restric- tion analysis with ClaI and sequenced (MWG Biotech, Ebersberg, Germany). The pTYB1 vector harboring the target gene was transferred into the expression strain E. coli BL21(DE3). It encodes a chimeric form of Bxe_A2876 that has the IMPACT tag fused to the authentic C-terminal Gly145. Expression and purification Recombinant protein was produced by cultivating the expression strain in shaking flasks containing LB medium supplemented with 100 lgÆ mL )1 ampicillin. The media were inoculated to an attenuance at 595 nm (D 595 nm ) of 0.1 with an overnight preculture of E. coli BL21(DE3). The strain was incubated at 37 °C and 120 r.p.m. to a D 595 nm of 0.6, the temperature was reduced to 15 °C, and expression of the target protein was initiated by addition of 250 lm isopropyl thio-b-d-galactoside. Cells were harvested after approxi- mately 20 h, resuspended in about the same volume of 20 mm Tris ⁄ HCl buffer (pH 7.5), and then disrupted by two passages through a French press (American Instruments Company, Silver Spring, MD, USA) operated at  8 MPa. The cell-free extract was subsequently passed over a chi- tin bead column (New England Biolabs, Beverly, MA, USA), with a column volume of 15 mL. The column had already been equilibrated with 10 column volumes of buf- fer A (20 mm Tris ⁄ HCl, pH 7.5, 500 mm NaCl, 0.1% Triton X). After the crude extract had been applied ( 650 mg of protein), the column was washed with 20 column volumes of buffer A, followed by three column volumes of buffer B (20 mm Tris ⁄ HCl, pH 7.5, 500 mm NaCl). Buffer B supplemented with 5 mm dithiothreitol was employed to induce intein cleavage for 16 h at 15 °C. The eluted protein was concentrated using Vivaspin concen- trator tubes (M r cut-off of 10 000; Sartorius Stedim Biotech S.A., Aubagne, France), and, finally, buffer was exchanged in three cycles with 20 mm Tris ⁄ HCl (pH 7.5), with NAP columns (GE Healthcare, Chalfont St Giles, UK). Purifica- tion was checked by SDS ⁄ PAGE. Protein solutions ( 5mgÆmL )1 ) were stored in 100 lL aliquots at )20 °C until further use. Repeated freeze–thaw cycles of the protein stock solution were avoided. b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al. 5992 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... XAS data were recorded at the EMBL EXAFS beamline D2 at DESY (Deutsches Elektronen Synchrotron) We thank G Wellenreuther and W Meyer-Klaucke for data collection and assistance in data evaluation The assistance of T Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data is gratefully acknowledged B Kuczewski and H Wiltsche (Institute of Analytical Chemistry and Radiochemistry,... Structural and biochemical characterization of gentisate 1,2-dioxygenase from Escherichia coli O157:H7 Mol Microbiol 61, 1469–1484 Stranzl GR (2002) X-ray crystal structure of acetylacetone-cleaving dioxygenase of Acinetobacter johnsonii and NMR evidence for a strong short hydrogen bond in the active site of HbHNL PhD thesis Karl Franzens University Graz, Graz, Austria Pang H, Bartlam M, Zeng Q, Miyatake... b-Diketone-cleaving oxygenase from B xenovorans 52 Binsted N, Strange RW & Hasnain SS (1992) Constrained and restrained refinement in Exafs dataanalysis with curved wave theory Biochemistry 31, 12117–12125 53 DeLano WL (2002) The PyMOL Molecular Graphics System DeLano Scientific, Palo Alto, CA Supporting information The following supplementary material is available: Fig S1 Structural comparison of nonheme metaldependent... Quality assessment of modeled protein structures was performed by calculating the Ramachandran plot with the program sirius (San Diego Supercomputer Center, San Diego, CA, USA) Metal analysis This was performed with an inductively coupled plasma optical emission spectrometer (Spectro Ciros Vision EOP, Kleve, Germany) calibrated with Fe, Zn, Cu, Ni and Mn standards in the range £ 500 lgÆL)1 The wavelengths... S (2004) Cupins: the most functionally diverse protein superfamily? Phytochemistry 65, 7–17 3 Cleasby A, Wonacott A, Skarzynski T, Hubbard RE, Davies GJ, Proudfoot AE, Bernard AR, Payton MA & 15 16 Wells TN (1996) The x-ray crystal structure of phos˚ phomannose isomerase from Candida albicans at 1.7 A resolution Nat Struct Biol 3, 470–479 Raymond S, Tocilj A, Ajamian E, Li Y, Hung MN, Matte A & Cygler... sequential scans No changes were detectable Methods used in XANES and EXAFS analyses winxas [51] was used to fit the pre-edge peak around 7113 eV in the XANES spectrum A combination of two pseudo-Voigt functions and a polynomial equation of first order were employed The difference between the fitted background and the spectrum was integrated The apparent edge energy of the sample was determined as the maximum... of each structural model, namely the atomic distances (R), the Debye–Waller factors (2r2), and a residual shift of the energy origin (EF) were refined, minimizing the fit index (REXAFS) [52] An amplitude reduction factor (AFAC) of 1.0 was used throughout data analysis b-Diketone-cleaving oxygenase from B xenovorans 4 5 6 7 8 9 10 Acknowledgements This work was financially supported by Graz University of. .. cultivation of Burkholderia xenovorans LB400 Table S3 Growth and formation of oxygenase activity by Burkholderia xenovorans LB400 Table S4 Product distribution for the cleavage of substituted diketone substrates This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors... Corporation, Santa Barbara, CA, USA), with the diode laser wavelength and the sampling time set to 824.2 nm and 10 s, respectively dynamics version 6 (Wyatt Technology Corporation) was used to obtain hydrodynamic radius distributions and the molecular mass distribution HPLC analysis of O2-dependent enzymatic conversion of b-diketones Reactions were carried out in a total volume of 0.5 mL containing between... H, Hisano T, Miki K, Wong LL, Gao GF & Rao Z (2004) Crystal structure of human pirin: an iron-binding nuclear protein and transcription cofactor J Biol Chem 279, 1491–1498 Adams M & Jia Z (2005) Structural and biochemical analysis reveal pirins to possess quercetinase activity J Biol Chem 280, 28675–28682 Chai SC, Bruyere JR & Maroney MJ (2006) Probes of the catalytic site of cysteine dioxygenase J . number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA. Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe 2+ -dependent oxygenase that cleaves