Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS dat...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , Harry Boer 2 , Anu Koivula 2 , Kristiina Kruus 2 , Juha ... observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data...

Ngày tải lên: 14/02/2014, 18:20

13 888 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACA...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

... estimated by comparing the observed rate constant of a catalyzed reaction with that of an equivalent uncatalyzed reaction. Under simulated physiological conditions, the uncatalyzed rate constant of ... individual steps of RNA-catalyzed reactions through the establishment of kinetic frameworks [6–19]. This approach has been mechanistically informative and has greatly advanced o...

Ngày tải lên: 18/02/2014, 18:20

13 761 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... Q81N- fwd:5¢-TGGGCCATGCCCTTT AACAGTTATGTCACG CTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACT GTTAAA GGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. ... R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢...

Ngày tải lên: 19/02/2014, 02:20

10 504 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu O...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... DASA polar are the changes in ASA of the apolar and polar residues, respectively [39]. The structure-based calculations provide a DC p of )407 calÆmol )1 ÆK )1 and DASA apolar and DASA polar of )1354 and ... experiment- ally determined structures are a snapshot of one of many conformations that a protein can adopt, and that proteins undergo a variety of fast and slow...

Ngày tải lên: 19/02/2014, 05:20

11 549 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... their absorbance at 260 nm. Peak 3 produced small amounts of HMG-CoA and large amounts of free CoA. Peak 4 produced HMG-CoA and also large amounts of free CoA. Peak 5 produced large amounts of HMG-CoA, ... revealed a 32 kDa AUH protein and it was thus assumed that the mature form of human AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For the kinetic charact...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosome was amplified by PCR using chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTG GGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTT GTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction ... human pathogens. Enterococci and Staphylococci have a dramatic history of resistance development against virtually all currently avail- able antibiotics. Most notably,...

Ngày tải lên: 19/02/2014, 13:20

12 693 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG TTTACAAGCTG-3¢) were used. Amplified ... and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and 5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAA AGTC-3¢ for FLAG-BMA...

Ngày tải lên: 19/02/2014, 16:20

11 630 0
w