Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Eur J Biochem 271, 4409–4419 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04379.x Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation Interaction with BMAL1 Fuyuki Sato1, Takeshi Kawamoto1, Katsumi Fujimoto1, Mitsuhide Noshiro1, Kiyomasa K Honda1, Sato Honma2, Ken-ichi Honma2 and Yukio Kato1 Department of Dental and Medical Biochemistry, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima, Japan; Department of Physiology, Hokkaido University Graduate School of Medicine, Sapporo, Japan The basic helix-loop-helix transcription factor DEC1 is expressed in a circadian manner in the suprachiasmatic nucleus where it seems to play a role in regulating the mammalian circadian rhythm by suppressing the CLOCK/BMAL1-activated promoter The interaction of DEC1 with BMAL1 has been suggested as one of the molecular mechanisms of the suppression [Honma, S., Kawamoto, T., Takagi, Y., Fujimoto, K., Sato, F., Noshiro, M., Kato, Y & Honma, K (2002) Nature 419, 841–844] Deletion analysis of DEC1 demonstrated that its N-terminal region, which includes the basic helix-loophelix domain, was essential for both the suppressive activity and the interaction with BMAL1, as DEC1 lacking the basic region did not show any suppression or interaction Furthermore, we found that Arg65 in the basic region, which is conserved among group B basic helix-loop-helix proteins, was responsible for the suppression, for the interaction with BMAL1 and for its binding to CACGTG E-boxes However, substitution of His57 for Ala significantly reduced the E-box binding activity of DEC1, although it did not affect the interaction with BMAL1 or suppression of CLOCK/BMAL1induced transcription On the other hand, the basic region-deleted DEC1 acted in a dominant-negative manner for DEC1 activity, indicating that the basic region was not required for homodimer formation of DEC1 Moreover, mutant DEC1 also counteracted DEC2-mediated suppressive activity in a dominant-negative manner The heterodimer formation of DEC1 and DEC2 was confirmed by pull-down assay These findings suggest that the basic region of DEC1 participates in the transcriptional regulation through a protein–protein interaction with BMAL1 and DNA binding to the E-box Circadian rhythms are regulated by a molecular clock(s), which has an endogenous period of  24 h and synchronizes to the 24 h period after light entrainment In mammals, the clock genes Clock, Bmal1, Per and Cry, and their protein products, comprise a molecular feedback loop in which a CLOCK/BMAL1 heterodimer binds to a CACGTG E-box and activates transcription of Per and Cry [1,2]; protein products of Per and Cry in turn suppress the transactivation by CLOCK/BMAL1 [3,4] This core feedback loop apparently generates a 24 h period in the molecular oscillator Furthermore, another feedback loop has been reported to control the rhythmic expression of Bmal1: expression of Rev-Erba is inducible by the CLOCK/BMAL1 heterodimer, and its protein product suppresses the expression of Bmal1 [5,6] These two feedback loops may be interlocked to stabilize the circadian core loop system DEC1 (bhlhb2) and DEC2 (bhlhb3) are basic helix-loophelix (bHLH) transcription factors which bind to CACGTG E-boxes and suppress transcription from target genes [7–12] Expression of DEC1 and DEC2 showed circadian rhythms in most organs, including the suprachiasmatic nucleus (SCN) [7,13], and Dec1 expression in the SCN was enhanced by a light pulse in a phase-dependent manner similar to Per1 Moreover, DEC1 and DEC2 suppressed Per1 transactivation by CLOCK/BMAL1 through competition for binding to E-boxes and/or protein–protein interactions of DECs with BMAL1 [7] Furthermore, we recently demonstrated the existence of a novel autofeedback loop associated with Dec1 transcription, with CLOCK/ BMAL1 as positive elements and DECs as negative elements [11] Three CACGTG E-boxes in the Dec1 promoter were responsible for the rhythmic expression of Dec1, and the feedback loop of DEC1 (as well as that of BMAL1) might be interlocked with the core feedback loop to constitute a network of the circadian clock system [11,12,14] In fact, the circadian rhythms of Dec1 and Dec2 expression have been shown to be completely disrupted in the SCN and some other tissues of Clock/Clock mutant Correspondence to T Kawamoto, Department of Dental and Medical Biochemistry, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima 734–8553, Japan Fax: +81 82 257 5629, Tel.: +81 82 257 5629, E-mail: tkawamo@hiroshima-u.ac.jp Abbreviations: AD, activation domain; bHLH, basic helix-loop-helix; DNA-BD, DNA-binding domain; GST, glutathione S-transferase; HDAC, histone deacetylase; SCN, suprachiasmatic nucleus; TK, thymidine kinase; TSA, trichostatin A (Received 18 March 2004, revised 14 September 2004, accepted 24 September 2004) Keywords: DEC1; DEC2; BMAL1; circadian rhythm; clock 4410 F Sato et al (Eur J Biochem 271) Ó FEBS 2004 Fig Suppressive activity of DEC1 against the CLOCK/BMAL1-activated promoter (A) Deletion analysis of DEC1 Expression vectors (10 ng per well) encoding various deletion mutants of DEC1 were cotransfected with the luciferase reporter construct pDEC1-E-ABC-TK (2 ng per well), together with expression vectors for CLOCK and BMAL1 (each 50 ng per well), into NIH3T3 cells After incubation for 48 h, luciferase activities were measured The values represent relative luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 15) Structures of the DEC1 mutants are schematically shown in the left-hand panel, with the basic helix-loop-helix (bHLH) and Orange domains indicated The expression of DEC1 mutants was examined by Western blot analysis by using anti-DEC1 immunoglobulin (lower-right panel) Various DEC1 mutants are indicated by arrowheads (B) Dose-dependency of DEC1 suppressive activity Increasing amounts (0.1, and 10 ng) of FLAG-DEC1 expression vector were cotransfected with pDEC1-E-ABC-TK, together with expression vectors for CLOCK and BMAL1 The total amount of transfected DNA was adjusted to the same value, in each experiment, by the addition of an empty vector (pcDNA3.1/Zeo) Relative luciferase activities of pDEC1-EABC-TK (mean ± SEM, n ¼ 6) are shown in the left-hand panel Expression of FLAG-DEC1 was examined by Western blot analysis with antiFLAG immunoglobulin (right panel) (C) Expression levels of DEC1 and BMAL1 were compared by using FLAG-tagged proteins Expression vectors for FLAG-BMAL1 (50 ng per well) and CLOCK (50 ng per well) were cotransfected with a FLAG-DEC1 expression vector (lane 2) or with an empty vector (lane 1) (10 ng per well) Expression of FLAG-tagged protein was examined by Western blot analysis with anti-FLAG immunoglobulin (left-hand panel) The transcriptional activities of FLAG-BMAL1 and FLAG-DEC1 were confirmed by using the luciferase assay (right-hand panel) The values represent relative luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 10) (D) Effect of the histone deacetylase (HDAC) inhibitor on DEC1 or DEC2 suppressive activity agaist the CLOCK/BMAL1-activated promoter The reporter construct, pDEC1-E-ABC-TK, was co-transfected with expression vectors for CLOCK and BMAL1 together with increasing amounts of a DEC1 or a DEC2 expression vector, as indicated The suppressive activity of DEC2 was much higher than that of DEC1 The HDAC inhibitor, trichostatin A (TSA) (300 nM), was added 24 h after transfection, and incubation was continued for a further 24 h The luciferase activity (mean ± SEM, n ¼ 5) of pDEC1-E-ABC-TK, without the DEC1 or DEC2 expression vector, in the presence or absence of TSA, was given a value of 100 P-values were calculated by using the Student’s t-test (**P < 0.01, *P < 0.05) mice [11,12,15], whereas overexpression of Dec1 decreases mRNA levels of Clock-dependent genes such as Per2, Dbp, Dec1 and Dec2 [11,16] In a recent study of DEC1 in ´ knockout mice (Stra13–/–), Grechez-Cassiau et al [17] identified significant changes in the expression of liver genes, including several clock-controlled genes, although no change was observed in clock gene expression in the liver DEC1 is thus confirmed as one of the regulators of the circadian clock system, at least in some peripheral organs As Dec2 expression was found to increase in the mutant mice, the disruption of DEC1 might be compensated by DEC2 Further investigation is required to clarify the functions of DEC1 and DEC2 The suppressive activities of DEC1 and DEC2 against CLOCK/BMAL1-activated promoters are strong compared with the transcriptional suppression by DEC1 without CLOCK/BMAL1 activation (T Kawamoto, unpublished data) In this study, we examined, by using various DEC1 mutants, the relationship between the DEC1–BMAL1 interaction and transcriptional suppression by DEC1 We also evaluated the E-box-binding activity of these mutants Our results showed that the region of DEC1 required for transcriptional suppression by DEC1 coincided with that for interaction with BMAL1 and binding to the E-boxes, indicating the importance of this region in DEC1 for its suppressive activity against CLOCK/BMAL1induced transcription Materials and methods Plasmid constructions To obtain deleted fragments from the 3¢-terminus of human Dec1 (hDec1) cDNA [18], a 5¢-terminus primer (5¢-AAG CTTCACCATGGAGCGGATCCCCAGCGCGCAACC AC-3¢) and a 3¢-terminus primer (one of 5¢-TCTA GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA TGG-3¢, 5¢-TCTAGACTACCCACTCGAGTGAGCGA AAGTCCGCTGG-3¢ or 5¢-TCTAGACTATTGACCTG TTTCGACATTTCTCCCTGACAGCTC-3¢) were used for PCR amplification, with hDec1 cDNA as a template For the amplification of deleted fragments from the 5¢-terminus of hDec1 cDNA, a 3¢-terminus primer (5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTCTT TG-3¢) and a 5¢-terminus primer (one of 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢, 5¢-AAGCTTCACCATGCCGCACCGGCTC ATCGAGAAAAAGAG-3¢, 5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG TTTACAAGCTG-3¢) were used Amplified PCR products were cloned into pCR-Blunt II-TOPO (Invitrogen) The cDNAs thus obtained were confirmed by nucleotide sequencing and then subcloned into the expression vector pcDNA3.1/Zeo (Invitrogen) or the mammalian two-hybrid vector pACT (Promega) for expression of the VP16 activation domain (AD) fusion protein To construct expression vectors for FLAG-tagged DEC1:2–412 and BMAL1, two sets of primers (5¢-AAGC TTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and 5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAA AGTC-3¢ for FLAG-BMAL1) were used for amplification by PCR, with hDec1 cDNA and mouse Bmal1 (mBmal1) cDNA, respectively, as templates Amplified PCR products were cloned into pCR-Blunt II-TOPO After confirmation of the nucleotide sequences, the cDNAs thus obtained were subcloned into p3xFLAG-CMV-10 (Sigma) for expression of FLAG-tagged protein To construct expression vectors for the bHLH domain-, basic region- and Orange domain-deleted DEC1 mutants, three sets of primers (5¢-ATTGATCAGCAGCAGCA GAAAATCATTGCC-3¢ and 5¢-CTTGCTGTCCTCG CTCCGCTTTATTCCC-3¢ for DEC1DbHLH and DEC1:4–232DbHLH; 5¢-GACCGGATTAACGAGTGC ATCGCCCAG-3¢ and 5¢-CTTGCTGTCCTCGCTCCGC Ĩ FEBS 2004 Interaction of DEC1 with BMAL1 (Eur J Biochem 271) 4411 TTTATTCCC-3¢ for DEC1Dbasic and DEC1:4–232Dbasic; and 5¢-CTGCAGGGTGGTACCTCCAGGAAGC CATC-3¢ and 5¢-CTCTTGACCTGTTTCGACATTTCT CCCTGAC-3¢ for DEC1DOrange) were used for amplification by PCR, with a pCR-Blunt II-TOPO plasmid carrying hDec1:1–412 or hDec1:1–232 cDNA as a template To obtain expression vectors for single amino acidsubstituted DEC1 mutants, three sets of primers (5¢-CGGCAATTTGTAGGTCTCCTTGCTGTCCTCGC TC-3¢ and 5¢-GCCCGGCTCATCGAGAAAAAGAGA CGTGACCGG-3¢ for DEC1-H57A; 5¢-GATGAGCCG GTGCGGCAATTTGTAGGTCTCC-3¢ and 5¢-GAGAA AAAGAGAGCTGACCGGATTAACGAGTGC-3¢ for DEC1-R65A, FLAG-DEC1-R65A and DEC1:4–232R65A; and 5¢-GATGAGCCGGTGCGGCAATTTGTA GGTCTCC-3¢ and 5¢-GAGAAAAAGAGAAAGGACC Ó FEBS 2004 4412 F Sato et al (Eur J Biochem 271) GGATTAACGAGTGCATC-3¢ for FLAG-DEC1-R65K) were used (substituted nucleotides are underlined) The resulting PCR products were ligated to make a circular form of the plasmids and transformed into Escherichia coli DH5a The cDNAs obtained from the transformants were confirmed by nucleotide sequencing and subcloned into a pcDNA3.1/Zeo, a pACT or a p3xFLAG-CMV-10 vector To obtain deleted fragments from the 5¢-terminus of mBmal1 cDNA, a 3¢-terminus primer (5¢-TCTAGACTA CAGCGGCCATGGCAAGTCACTAAAGTC-3¢) and a 5¢-terminus primer (one of 5¢-GGATCCGTGCGGACCA GAGAATGGACATTTCCTC-3¢, 5¢-GGATCCTCACC GTGCTAAGGATGGCTGTTCAGCAC-3¢ or 5¢-GGAT CCCCTCCCGGCTATGCTCTGGAGCC-3¢) were used for amplification by PCR, with mBmal1 cDNA as a template The cDNAs thus obtained were subcloned into the mammalian two-hybrid vector pBIND (Promega) for expression of the GAL4 DNA-binding domain (DNA-BD) fusion protein Luciferase reporter assay Twenty-four hours before transfection, NIH3T3 cells were seeded at · 104 cells per 16 mm well The luciferase reporter plasmid pDEC1-E-ABC-TK, carrying three hDec1 CACGTG E-boxes connected to the thymidine kinase (TK) promoter (2 ng per well), or pDEC1-3620 carrying the hDec1 promoter [19], was co-transfected with expression vectors for mouse CLOCK and BMAL1 (each 50 ng per well), together with an expression vector for human DEC1 or DEC2 (10 ng or the indicated amount per well), by using Trans IT polyamine (Mirus, Madison, WI, USA), as described previously [11] As an internal standard, 0.2 ng of phRLTK (Promega) was co-transfected The total amount of transfected DNA was adjusted to the same value, in each experiment, by using an empty vector (pcDNA3.1/Zeo) The cells were incubated for 48 h and then subjected to the luciferase reporter assay by using the Dual-Luciferase Reporter Assay System (Promega) Luciferase activities were normalized relative to internal control activities The experiments were repeated at least twice and the data thus obtained were combined to represent the mean ± SEM For the trichostatin A (TSA) assay, DNA-transfected NIH3T3 cells were incubated with TSA (300 nM; Sigma) for 24 h Mammalian two-hybrid assay The mammalian two-hybrid vectors, pBIND, encoding GAL4 DNA-BD fusion protein (100 ng per well), and pACT, encoding VP16 AD fusion protein (100 ng per well), were co-transfected with the luciferase reporter plasmid pG5luc (Promega), carrying five GAL4-binding sites upstream of the TATA box (100 ng per well), and phRLTK (0.2 ng per well) into NIH3T3 cells The cells were incubated for 48 h and subjected to a luciferase reporter assay Asp-His-Gly-Arg-Arg The antibodies thus obtained (anti-DEC1:251–268) were purified by affinity column chromatography NIH3T3 cells were seeded at · 105 cells per 35 mm well, or at · 104 cells per 16 mm well, 24 h before transfection Expression plasmids (1.5 lg or the indicated amount per well) were transfected into the cells by using PolyFect Transfection Reagent (Qiagen) Forty-eight hours after transfection, the cells were harvested and dissolved in 200 or 30 lL of SDS sample buffer Equal volumes of the samples (15 lL) were subjected to SDS/ PAGE and transferred onto a nylon membrane (Immobilon P; Millipore) DEC1, FLAG-DEC1, FLAG-BMAL1 and VP16-DEC1 were detected with anti-DEC1:251–268, antiFLAG (Sigma) and anti-VP16 (Santa Cruz) immunoglobulins Electrophoretic mobility shift assay Various DEC1 mutant proteins (including VP16-fused protein) and luciferase protein, as a control product, were synthesized by using the TNT Quick Coupled Transcription/Translation System (Promega) The expression levels were confirmed by using Western blot analysis with anti-DEC1 or anti-VP16 immunoglobulin The double-stranded oligonucleotides of Dec1 E-box C (5¢-ctagGTCCAACACGTGAGACTCtcga-3¢; E-box is underlined) were end-labelled by using [32P]dCTP[aP] (Du Pont-New England Nuclear) and DNA polymerase I Klenow fragment (TAKARA) Synthesized protein was incubated with approximately 40 000 c.p.m of 32P-labelled E-box C probe for 15 at room temperature in 10 lL of 10 mM Tris/HCl (pH 8.0), 0.5 mM dithiothreitol, 10% (v/v) glycerol, lg of poly(dI-dC), 50 mM NaCl and mM MgCl2, after which the mixtures were subjected to PAGE (5% gel) in electrophoresis buffer (12 mM Tris/HCl, 125 mM glycine, mM EDTA) at °C, and visualized by using autoradiography Pull-down assay Glutathione S-transferase (GST)-mouse DEC2 [20] fusion protein (GST-DEC2) was expressed in E coli BL21 and purified as described previously [21] 35S-labelled mouse DEC1 was synthesized by using the TNT Quick Coupled Transcription/Translation System (Promega) and incubated with lg of GST or GST-DEC2 on glutathione-agarose beads in binding buffer (20 mM Tris/HCl, pH 8.0, 200 mM NaCl, mM EDTA, 0.5% (v/v) Nonidet P-40 and mgỈmL)1 of bovine serum albumin) for h at °C The beads were washed three times with binding buffer and the bound proteins were analyzed by SDS/PAGE and autoradiography Results Western blot analysis Deletion analysis of DEC1 on its suppressive activity in the presence of CLOCK and BMAL1 Rabbit antibodies to DEC1 were produced by immunizisation with the synthetic peptide fragment Cys-LysGly-Asp-Leu-Arg-Ser-Glu-Gln-Pro-Tyr-Phe-Lys-Ser- Using deletion analyses, two regions in the protein product of Dec1 have been identified as important domains for its suppressive activity of transcription from Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur J Biochem 271) 4413 some genes, including Dec2 and PPARc2, in the absence of other transcription factors, such as CLOCK and BMAL1 [9,10,22,23]: an N-terminal region between amino acids and 141, and another region between amino acids 147 and 354, were reported to be essential for the suppression of the target genes To determine which region in DEC1 is required for the suppression of CLOCK/BMAL1-induced transcription, truncated forms of DEC1 were expressed in NIH3T3 cells together with CLOCK and BMAL1, and their transcriptional activities were examined by using a luciferase assay with a reporter construct containing three CACGTG E-boxes of human Dec1 connected to the TK promoter (pDEC1-E-ABCTK) As shown in Fig 1A, the promoter activity of pDEC1-E-ABC-TK was enhanced by CLOCK/BMAL1, and the increased activity was reduced by full-length DEC1 (DEC1:1–412), as described previously [11] Deletion of 27 residues from the N-terminal region of DEC1 (DEC1:28–412) did not diminish the suppressive activity, whereas deletion of 55 residues (DEC1:56–412) decreased the DEC1 activity, and deletion of 93 residues (DEC1: 94–412) or more than 93 residues (DEC1:119–412) abolished the suppression (Fig 1A) On the other hand, deletion of up to 273 residues from the C-terminal region of DEC1 (DEC1:1–309, DEC1:1–232 and DEC1:1–139) had little effect on the suppressive activity of DEC1 Expression of these truncated DEC1 mutants was confirmed by Western blot analysis, although the expression levels of DEC1 mutants varied among clones To examine the dose-dependency of transcriptional suppression by DEC1, 0.1, or 10 ng of FLAG-tagged DEC1 expression vector was co-transfected with expression vectors for CLOCK and BMAL1 (50 ng of each) Transfection of 0.1 ng of the DEC1 expression vector did not significantly decrease the transcriptional activity of CLOCK/BMAL1 (Fig 1B) Transfection of ng of the expression vector resulted in a decreased expression of the DEC1 protein, Fig Effect of an internal deletion of DEC1 on its suppressive activity Expression vectors for DEC1 carrying various deletion mutations were co-transfected with pDEC1-3620 or pDEC1-E-ABC-TK, together with expression vectors for CLOCK and BMAL1, into NIH3T3 cells Relative luciferase activities of pDEC1-3620 (mean ± SEM, n ¼ 7) or pDEC1-E-ABC-TK (mean ± SEM, n ¼ 11) are presented **P < 0.01 (Student’s t-test) The structures of the DEC1 mutants expressed are shown in the upper-left panel Expression of DEC1 mutants was examined by Western blot analysis with anti-DEC1 immunoglobulin (lower-left panel) causing significant but much lower levels of suppressive activity than transfection with 10 ng of the expression vector To compare protein levels of DEC1 and BMAL1, FLAG-tagged proteins were expressed in NIH3T3 cells and subjected to Western blot analysis by using antiFLAG immunoglobulin As shown in Fig 1C, transfection of 10 ng of FLAG-DEC1 expression vector and 50 ng of FLAG-BMAL1 expression vector resulted in adequate levels of expression The transcriptional activity of FLAG-BMAL1, and the suppressive activity of FLAGDEC1, were similar to those of intact BMAL1 and DEC1, respectively (Fig 1A,C) These findings indicate that the region between amino acids 28 and 139 of DEC1 (including the bHLH domain) is sufficient for the suppressive activity of DEC1 The C-terminal region (amino acids 140–412), including the Orange domain [18], is not required for suppression in the presence of CLOCK/BMAL1 Involvement of histone deacetylase (HDAC) in DEC1 or DEC2 suppression of CLOCK/BMAL1-induced gene expression DEC1 and GAL4 DNA-BD-fused DEC2 bound to HDAC and suppressed transcription from, respectively, the Dec1 (Stra13) promoter and the GAL4 response promoter [24,25]; however, suppression of c-myc expression by DEC1 did not require HDAC [24] To examine whether CLOCK/BMAL1-induced gene expression is suppressed by DEC1 or DEC2 via an HDAC-dependent pathway, we added TSA (a specific inhibitor of HDAC) to the cell cultures 24 h after transfection of reporter plasmids The addition of TSA reversed the suppression by DEC1 or DEC2, as shown in Fig 1D, indicating that an HDACco-repressor complex(es) may be involved, at least partly, in the suppression of CLOCK/BMAL1-induced transcription by DEC1 or DEC2 4414 F Sato et al (Eur J Biochem 271) The basic region of DEC1 is essential for its suppressive activity To further narrow down the region required for the suppressive activity of DEC1, we generated several constructs with deletions in internal regions Deletion of the basic region (DEC1Dbasic) or bHLH domain (DEC1DbHLH) disrupted DEC1 suppressive activity against CLOCK/ BMAL1-induced transcription from the DEC1 promoter or the TK promoter connected to the DEC1 E-boxes (Fig 2), while deletion of the Orange domain (DEC1DOrange) had no effect on the suppressive activity, indicating the importance of the bHLH region of DEC1 The HXXXXXXXR sequence in the basic region has been reported to be conserved among group B bHLH proteins [26,27] We therefore examined whether these amino acid residues are required for DEC1 activity Substitution of Arg65 for Ala(DEC1-R65A) severely reduced the suppressive activity of DEC1, whereas substitution of His57 for Ala(DEC1-H57A) did not alter the activity (Fig 3A) As Western blot analysis showed that the expression levels of the R65A mutant were lower than that of full-length DEC1, we next generated expression constructs for FLAG-fused R65A mutant and R65K Ó FEBS 2004 mutant DEC1 The expression levels of R65A and R65K mutants were comparable to those of FLAG-fused DEC1, but they did not have any significant suppressive activity against CLOCK/BMAL1-induced transcription From these findings, we conclude that the basic region, particularly the conserved Arg65, but not His57, is essential for the suppressive activity of DEC1 Determination of the binding domain of DEC1 to BMAL1 The interaction of DEC1 and BMAL1 was previously demonstrated by a yeast two-hybrid assay [7], and this interaction may be involved in the suppressive activity of DEC1 against CLOCK/BMAL1-induced transcription To confirm that the binding of DEC1 and BMAL1 actually occurs in mammalian cells, we performed a mammalian two-hybrid assay by using various DEC1 mutant constructs The N-terminal region of DEC1 (DEC1:4–232 or DEC1:4–139) interacted with BMAL1 (Fig 4) However, deletion of the basic region or of the bHLH domain completely abrogated the DEC1–BMAL1 interaction, and substitution of Arg65 for Ala(DEC1:4– 232-R65A) also abolished the interaction, indicating that the basic region is essential for the interaction However, Fig Effect of a single amino acid substitution in the basic region of DEC1 on its suppressive activity (A) Expression vectors for DEC1 carrying various point mutations were co-transfected with pDEC1-3620 or pDEC1E-ABC-TK, together with expression vectors for CLOCK and BMAL1 The substituted amino acids of DEC1 are shown in the upperleft panel Relative luciferase activities of pDEC1-3620 (mean ± SEM, n ¼ 7) or pDEC1-E-ABC-TK (mean ± SEM, n ¼ 11) are presented **P < 0.01 (Student’s t-test) Expression of DEC1 mutants was examined by Western blotting by using anti-DEC1 immunoglobulin (B) Expression vectors for FLAG-fused DEC1 were co-transfected with pDEC1-E-ABC-TK, together with expression vectors for CLOCK and BMAL1 Luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 6) were examined Expression of DEC1 mutants was analyzed by Western blotting with anti-FLAG immunoglobulin Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur J Biochem 271) 4415 substitution of His57 for Ala(DEC1:4–232-H57A) did not affect the interaction, which coincided with the strong suppressive activity of the H57A mutant against the CLOCK/BMAL1 heterodimer Similar levels of expression of VP16-fused DEC1 mutants were confirmed by Western blot analysis Taken together with the results shown in Figs 1–3, these findings indicate that the region required for the suppressive activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, an electrophoretic mobility shift assay was performed Shifted bands were observed by using full-length DEC1 (DEC1:1–412) (Fig 5, lanes and 5) or Orange domain-deleted DEC1 (DEC1DOrange) (lane 4), whereas no bands were detected by using basic region-deleted DEC1 (DEC1Dbasic and DEC1:4– 232Dbasic) (lanes and 14) or bHLH domain-deleted DEC1 (DEC1DbHLH and DEC1:4–232DbHLH) (lanes and 15) His57-substituted DEC1 (DEC1-H57A) showed a very low binding ability for the E-box (lane 7), and substitution of Arg65 for Ala(DEC1-R65A and DEC1:4– 2332-R65A) abolished DEC1 binding to the E-box (lanes and 16) On the other hand, deletion of up to 273 residues Fig Identification of the domain of DEC1 that interacts with BMAL1 Interactions of various DEC1 mutants with BMAL1 in NIH3T3 cells were examined The mammalian two-hybrid vector, pACT, encoding various deletion or point mutants of DEC1 for expression of the VP16 activation domain (AD) fusion protein, was used The pACT vector carrying mutant Dec1 cDNA (100 ng per well) was co-transfected with pBIND carrying Bmal1:2–626 cDNA (100 ng per well) for expression of the GAL4 DNAbinding domain (DNA-BD) fusion protein, together with the luciferase reporter plasmid pG5luc carrying five GAL4-binding sites upstream of the TATA box (100 ng per well) An empty pACT or pBIND vector was used as a control The cells were incubated for 48 h and subjected to the luciferase reporter assay Relative luciferase activities of pG5luc (mean ± SEM, n ¼ 11) were normalized relative to internal control activities **P < 0.01 (Student’s t-test) Interactions between the VP16 AD-DEC1 fusion protein and the GAL4 DNA-BD-BMAL1 fusion protein resulted in an increase in expression of the luciferase gene Expression of the VP16-DEC1 fusion protein was examined by Western blot analysis with an anti-VP16 immunoglobulin from the C-terminal region of DEC1 (VP16-DEC1:4–232 and VP16-DEC1:4–139) did not diminish the binding activity (lanes 9, 10 and 13), whereas deletion of 296 residues (VP16-DEC1:4–116) decreased the binding (lane 11), and deletion of 312 residues (VP16-DEC1:4–100) abolished it (lane 12) Expression levels of DEC1 mutants and VP16-tagged DEC1 mutants synthesized by in vitro transcription/translation were confirmed by Western blot analysis (Fig 5) These results indicate that the bHLH region, including His57 and Arg65, is responsible for the E-box binding Determination of the region in BMAL1 for binding to DEC1 To identify the region in BMAL1 required for the binding to DEC1, we constructed expression plasmids for truncated BMAL1 (Fig 6) Deletion of 111 amino acids from the N-terminal region (BMAL1:112–626) did not affect the binding of BMAL1 to DEC1; deletion of 235 amino acids (BMAL1:236–626) slightly diminished the binding, although a strong binding ability of BMAL1:236–626 with DEC1 still existed As similar results were obtained in the yeast two-hybrid assay (F Sato, unpublished data), it is likely that the C-terminal region, including the PAS-B domain of BMAL1, is required for the binding to DEC1, Ó FEBS 2004 4416 F Sato et al (Eur J Biochem 271) Fig Analysis of DEC1 mutants for binding to the CACGTG E-box in the Dec1 promoter Various DEC1 mutants and VP16-tagged DEC1 mutants were synthesized by using an in vitro transcription/translation system The 32 P-labelled Dec1 E-box C probe was incubated with DEC1 mutants (lanes 1–7), VP16tagged DEC1 mutants (lanes 9–16) or luciferase protein synthesized as a control product (cont.) (lanes and 17) Shifted bands of radiolabelled E-box C and mutant DEC1 complexes are indicated by asterisks Expression levels of DEC1 mutants and VP16-DEC1 mutants were confirmed by Western blot analysis with anti-DEC1 and anti-VP16 immunoglobulin (lower panels) Faint, nonspecific bands were also observed, even when the probe was incubated with a control protein CLOCK/BMAL1 [9], we examined whether DEC1Dbasic is a dominant-negative competitor in the presence of CLOCK and BMAL1 Co-transfection with an expression plasmid for DEC1Dbasic diminished the suppressive activity of full-length DEC1 in a dose-dependent manner (Fig 7A) In addition, DEC1 carrying the substitution Arg65 for Ala (DEC1-R65A) showed a similar ability (Fig 7B) However, neither DEC1Dbasic nor DEC1-R65A alone had any significant suppressive activities (Figs and 3) These findings suggest that DEC1 forms homodimers through the helix-loop-helix region, but not through the basic region, when it suppresses the CLOCK/BMAL1induced transcription Accordingly, DEC1 lacking the bHLH domain (DEC1DbHLH) did not decrease the activity of co-expressed full-length DEC1 (Fig 7C) Fig Identification of the domain of BMAL1 that interacts with DEC1 Interactions of various truncated BMAL1 mutants with DEC1 in NIH3T3 cells were examined pBIND, carrying various lengths of Bmal1 cDNA, was co-transfected with pACT carrying Dec1 cDNA together with pG5luc Luciferase activities of pG5luc (mean ± SEM, n ¼ 11) were normalized by internal control activities **P < 0.01 (Student’s t-test) The regions of BMAL1 expressed as a GAL4 fusion protein are schematically shown in the upper panel The basic helixloop-helix (bHLH), PAS-A and PAS-B domains [32] are indicated Interactions between GAL4 DNA-BD-BMAL1 fusion protein and VP16 AD-DEC1 fusion protein resulted in an increase in luciferase gene expression whereas the N-terminal region, containing the bHLH domain, is not essential for the interaction Dominant-negative DEC1 counteracts the suppression of CLOCK/BMAL1-induced transcription in the presence of full-length DEC1 As DEC1 lacking the basic region interfered with full-length DEC1 for the transcriptional suppression in the absence of Heterodimer formation of DEC1 and DEC2 Although DEC1 functioned as a homodimer, interactions between DEC1 and DEC2 had not previously been demonstrated To investigate whether DEC1 and DEC2 could form heterodimers, an expression plasmid encoding DEC1Dbasic was co-transfected with a DEC2 expression vector, together with expression vectors for CLOCK and BMAL1: DEC1Dbasic counteracted DEC2 activity in a dose-dependent manner (Fig 8A) The heterodimer formation of DEC1 and DEC2 was confirmed by a pulldown assay: in this assay, 35S-labelled DEC1 bound to GST-DEC2 fusion protein, but not to GST protein (Fig 8B) Discussion In the present study, we found that the N-terminal region (1–139) of DEC1 was essential for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with the C-terminal region of BMAL1 in a mammalian two-hybrid assay Accordingly, a Ó FEBS 2004 Interaction of DEC1 with BMAL1 (Eur J Biochem 271) 4417 Fig Heterodimer formation of DEC1 and DEC2 (A) Increasing amounts of an expression vector for DEC1Dbasic were co-transfected with pDEC1-E-ABC-TK, together with expression vectors for CLOCK, BMAL1 and DEC2 into NIH3T3 cells The amounts of transfected plasmid DNA (ng per well) are indicated The values represent relative luciferase activities of pDEC1-E-ABC-TK (mean ± SEM, n ¼ 6) (B) The binding of DEC1 and DEC2 was examined by using a pull-down assay 35S-labelled DEC1 was incubated with glutathione S-transferase (GST) or GST-DEC2 on glutathione-agarose beads for h at °C The beads were washed three times, subjected to SDS/PAGE with 10% of input 35S-labelled DEC1, and visualized by autoradiography Fig DEC1 mutants that act in a dominant-negative manner Increasing amounts of an expression vector for DEC1Dbasic (A), DEC1-R65A (B) or DEC1DbHLH (C) were co-transfected with pDEC1-E-ABC-TK, together with expression vectors for CLOCK, BMAL1 and full-length DEC1 into NIH3T3 cells The amounts of transfected plasmid DNA (ng per well) are indicated The total amount of transfected DNA was adjusted to the same value, in each experiment, by using an empty vector After incubation of the cells for 48 h, the luciferase activities of pDEC1-E-ABC-TK were determined (mean ± SEM, n ¼ 5) recent work [28] demonstrated the binding of human DEC1 to BMAL1 by using a co-immunoprecipitation assay Our mutation analysis showed that the region comprising amino acids 1–139 in DEC1, essential for its suppressive activity, was identical to the region required for the interaction with BMAL1 In addition, the N-terminal region of DEC1 (DEC1:4–139 or DEC1:4–116) bound to the Dec1-CACGTG E-box, which was recognized by the CLOCK/ BMAL1 heterodimer The basic region (amino acids 51–65) of DEC1 was essential for both the interaction of 4418 F Sato et al (Eur J Biochem 271) DEC1 with BMAL1 and the binding to the E-box Substitution of Arg65 for Ala abolished the interaction of DEC1 with BMAL1 and the binding of DEC1 to the E-box However, substitution of His57 for Ala did not affect the interaction of DEC1 with BMAL1, nor its suppressive activity, although it strongly decreased the DEC1 binding activity to the CACGTG E-box DEC1 therefore appears to suppress the CLOCK/BMAL1-induced transcription, at least in part, by interacting with BMAL1 The amino acid residue Arg65 in the basic region of DEC1 is conserved among the group B bHLH proteins (such as USF, c-Myc, MAX and MAD) that can bind to the CACGTG E-box [26], along with some other transcription factors [29,30] This amino acid residue was also important for the interaction between DEC1 and BMAL1, as shown in this study, and, moreover, the Arg residue might be crucial for the activities of the other group B bHLH proteins In addition to BMAL1, DEC1 can bind to various transcription factors such as USF2 [29], MASH1 [23] and E47 [31], or to co-repressors such as HDAC1, mSin3A and NcoR [24] USF2-DEC1 heterodimer formation inhibited USF2 from binding to a CACGTG E-box in the M4-Luc promoter [29], even though USF2 or DEC1 alone could bind to the element These findings suggest that the group B bHLH proteins, including DEC1, work through two mechanisms: interaction with some other transcription factor(s); and binding to an E-box DEC1 has been reported to act as a homodimer to suppress transcription from the reporter gene carrying three CACGTG elements [9] Here we showed that dimer formation would also be required for the suppression of CLOCK/BMAL1-induced transcription The basic region of DEC1 is not required for homodimer formation, as the basic region-deleted or Arg65-substituted DEC1 acted as a dominant-negative competitor We also found that DEC1 could form heterodimers with DEC2, which had a strong similarity (90%) to DEC1 in the region between amino acids 48–124 of DEC1 This region, including the bHLH domain, coincided with the region required for both the suppressive activity of DEC1 and the interaction with BMAL1 DEC2 can also interact with BMAL1, bind to CACGTG E-boxes and has a suppressive activity similar to that of DEC1 [7,11] Hence, DEC1 and DEC2 may be interchangeable, playing roles in transcriptional regulation in a situation-dependent manner Acknowledgements This work was supported by grants-in-aid for science from the Ministry of Education, Culture, Sport, Science and Technology of Japan References Darlington, T.K., Wager-Smith, K., Ceriani, M.F., Staknis, D., Gekakis, N., Steeves, T.D., Weitz, C.J., Takahashi, J.S & Kay, S.A (1998) Closing the circadian loop: CLOCK-induced transcription of its own inhibitors per and tim Science 280, 1599–1603 Gekakis, N., Staknis, D., Nguyen, H.B., Davis, F.C., Wilsbacher, L.D., King, D.P., Takahashi, J.S & Weitz, C.J (1998) Role of the CLOCK protein in the mammalian circadian mechanism Science 280, 1564–1569 Ó FEBS 2004 Kume, K., Zylka, M.J., Sriram, S., Shearman, L.P., Weaver, D.R., Jin, X., Maywood, E.S., Hastings, M.H & Reppert, S.M (1999) mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop Cell 98, 193–205 Yagita, K., Yamaguchi, S., Tamanini, F., van der Horst, G.T., Hoeijmakers, J.H., Yasui, A., Loros, J.J., Dunlap, J.C & Okamura, H (2000) Dimerization and nuclear entry of mPER proteins in mammalian cells Genes Dev 14, 1353–1363 Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U & Schibler, U (2002) The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator Cell 110, 251–260 Ueda, H.R., Chen, W., Adachi, A., Wakamatsu, H., Hayashi, S., Takasugi, T., Nagano, M., Nakahama, K., Suzuki, Y., Sugano, S., Iino, M., Shigeyoshi, Y & Hashimoto, S (2002) A transcription factor response element for gene expression during circadian night Nature 418, 534–539 Honma, S., Kawamoto, T., Takagi, Y., Fujimoto, K., Sato, F., Noshiro, M., Kato, Y & Honma, K (2002) Dec1 and Dec2 are regulators of the mammalian molecular clock Nature 419, 841– 844 Zawel, L., Yu, J., Torrance, C.J., Markowitz, S., Kinzler, K.W., Vogelstein, B & Zhou, S (2002) DEC1 is a downstream target of TGF-beta with sequence-specific transcriptional repressor activities Proc Natl Acad Sci USA 99, 2848–2853 St-Pierre, B., Flock, G., Zacksenhaus, E & Egan, S.E (2002) Stra13 homodimers repress transcription through class B E-box elements J Biol Chem 277, 46544–46551 10 Li, Y., Xie, M., Song, X., Gragen, S., Sachdeva, K., Wan, Y & Yan, B (2003) DEC1 negatively regulates the expression of DEC2 through binding to the E-box in the proximal promoter J Biol Chem 278, 16899–16907 11 Kawamoto, T., Noshiro, M., Sato, F., Maemura, K., Takeda, N., Nagai, R., Iwata, T., Fujimoto, K., Furukawa, M., Miyazaki, K., Honma, S., Honma, K & Kato, Y (2004) A novel autofeedback loop of Dec1 transcription involved in circadian rhythm regulation Biochem Biophys Res Commun 313, 117–124 12 Hamaguchi, H., Fujimoto, K., Kawamoto, T., Noshiro, M., Maemura, K., Takeda, N., Nagai, R., Furukawa, M., Honma, S., Honma, K., Kurihara, H & Kato, Y (2004) Expression of the gene for Dec2, a basic helix-loop-helix transcription factor, is regulated by a molecular clock system Biochem J 382, 43–50 13 Noshiro, M., Kawamoto, T., Furukawa, M., Fujimoto, K., Yoshida, Y., Sasabe, E., Tsutsumi, S., Hamada, T., Honma, S., Honma, K & Kato, Y (2004) Rhythmic expression of DEC1 and DEC2 in peripheral tissues: DEC2 is a potent suppressor for hepatic cytochrome P450s opposing DBP Genes Cells 9, 317–329 14 Roenneberg, T & Merrow, M (2003) The network of time: understanding the molecular circadian system Curr Biol 13, R198–R207 15 Butler, M.P., Honma, S., Fukumoto, T., Kawamoto, T., Fujimoto, K., Noshiro, M., Kato, Y & Honma, K (2004) Dec1 and Dec2 expression is disrupted in the suprachiasmatic nuclei of Clock mutant mice J Biol Rhythms 19, 126–134 16 Shen, M., Yoshida, E., Yan, W., Kawamoto, T., Suardita, K., Koyano, Y., Fujimoto, K., Noshiro, M & Kato, Y (2002) Basic helix-loop-helix protein DEC1 promotes chondrocyte differentiation at the early and terminal stages J Biol Chem 277, 50112– 50120 17 Grechez-Cassiau, A., Panda, S., Lacoche, S., Teboul, M., Azmi, S., Laudet, V., Hogenesch, J.B., Taneja, R & Delaunay, F (2004) The transcriptional repressor STRA13 regulates a subset of peripheral circadian outputs J Biol Chem 279, 1141–1150 18 Shen, M., Kawamoto, T., Yan, W., Nakamasu, K., Tamagami, M., Koyano, Y., Noshiro, M & Kato, Y (1997) Molecular Ó FEBS 2004 19 20 21 22 23 24 Interaction of DEC1 with BMAL1 (Eur J Biochem 271) 4419 characterization of the novel basic helix-loop-helix protein DEC1 expressed in differentiated human embryo chondrocytes Biochem Biophys Res Commun 236, 294–298 Miyazaki, K., Kawamoto, T., Tanimoto, K., Nishiyama, M., Honda, H & Kato, Y (2002) Identification of functional hypoxia response elements in the promoter region of the DEC1 and DEC2 genes J Biol Chem 277, 47014–47021 Fujimoto, K., Shen, M., Noshiro, M., Matsubara, K., Shingu, S., Honda, K., Yoshida, E., Suardita, K., Matsuda, Y & Kato, Y (2001) Molecular cloning and characterization of DEC2, a new member of basic helix-loop-helix proteins Biochem Biophys Res Commun 280, 164–171 Guan, K.L & Dixon, J.E (1991) Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase Anal Biochem 192, 262–267 Yun, Z., Maecker, H.L., Johnson, R.S & Giaccia, A.J (2002) Inhibition of PPAR gamma gene expression by the HIF-1regulated gene DEC1/Stra13: a mechanism for regulation of adipogenesis by hypoxia Dev Cell 2, 331–341 Boudjelal, M., Taneja, R., Matsubara, S., Bouillet, P., Dolle, P & Chambon, P (1997) Overexpression of Stra13, a novel retinoic acid-inducible gene of the basic helix-loop-helix family, inhibits mesodermal and promotes neuronal differentiation of P19 cells Genes Dev 11, 2052–2065 Sun, H & Taneja, R (2000) Stra13 expression is associated with growth arrest and represses transcription through histone deacetylase (HDAC) -dependent and HDAC-independent mechanisms Proc Natl Acad Sci USA 97, 4058–4063 25 Garriga-Canut, M., Roopra, A & Buckley, N.J (2001) The basic helix-loop-helix protein, sharp-1, represses transcription by a histone deacetylase-dependent and histone deacetylase-independent mechanism J Biol Chem 276, 14821–14828 26 Atchley, W.R & Fitch, W.M (1997) A natural classification of the basic helix-loop-helix class of transcription factors Proc Natl Acad Sci USA 94, 5172–5176 27 Robinson, K.A & Lopes, J.M (2000) SURVEY and SUMMARY: Saccharomyces cerevisiae basic helix-loop-helix proteins regulate diverse biological processes Nucleic Acids Res 28, 1499–1505 28 Li, Y., Song, X., Ma, Y., Liu, J., Yang, D & Yan, B (2004) DNA binding but not interaction with Bmal1 is responsible for DEC1mediated transcription regulation of the circadian gene mPer1 Biochem J 382, 895–904 29 Dhar, M & Taneja, R (2001) Cross-regulatory interaction between Stra13 and USF results in functional antagonism Oncogene 20, 4750–4756 30 Grandori, C., Cowley, S.M., James, L.P & Eisenman, R.N (2000) The Myc/Max/Mad network and the transcriptional control of cell behavior Annu Rev Cell Dev Biol 16, 653–699 31 Dear, T.N., Hainzl, T., Follo, M., Nehls, M., Wilmore, H., Matena, K & Boehm, T (1997) Identification of interaction partners for the basic-helix-loop-helix protein E47 Oncogene 14, 891–898 32 Yu, W., Ikeda, M., Abe, H., Honma, S., Ebisawa, T., Yamauchi, T., Honma, K & Nomura, M (1999) Characterization of three splice variants and genomic organization of the mouse BMAL1 gene Biochem Biophys Res Commun 260, 760–767  ... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter,... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with the C-terminal region of BMAL1 in. .. 5) These results indicate that the bHLH region, including His57 and Arg65, is responsible for the E-box binding Determination of the region in BMAL1 for binding to DEC1 To identify the region in