new and unexpected insights on the formation of protocells from a synthetic biology approach the case of entrapment of biomacromolecules and protein synthesis inside vesicles

Human Trafficking in Indonesia Rethinking the New Order's Impact on Exploitative Migration of Indonesian Women

Ngày tải lên : 14/05/2015, 14:23

... TAWAU MALAYSIA BRUNAI TARAKAN SINGAPURA NUNUKAN KUCHING BATAM BALIKPAPAN PONTIANAK PARE-PARE JAKARTA SURABAYA Source: Rachmat Sentika in Ministry of Health Human trafficking is recognized as a ... Indonesia and Malaysia (mostly from Indonesia to Malaysia) is fairly longstanding and ongoing The historical, geographical (sharing Kalimantan 10 ), racial, and religious linkages have greatly facilitated ... acceleration of deregulation after 1983, a large number of multinational corporations came into the Indonesian domestic market The transfer of the offices and plants of the multinational corporations...

59
278
0

Working PaPer SerieS no 1272 / DeCeMBer 2010: THe iMPaCT of PuBliC guaranTeeS on Bank riSk Taking eviDenCe froM a naTural exPeriMenT pptx

Ngày tải lên : 15/03/2014, 10:20

... σ(ROAA) is the standard deviation of the average return of assets, E stands for equity, and A for total assets.22 The latter two are used to calculate the capital assets ratio (E /A = CAR) ROAA and ... Panel A shows the average Banking Z-Score, the standard deviation of the average return of assets (ROAA), and the average total loan volume before (1995-2000) and after (2001-2006) the removal ... Table also shows the change in the standard deviation of return of average assets, σ(ROAA) Column shows a σ(ROAA) for the savings banks of 0.23% before and 0.16% after the removal In contrast, the...

53
1.4K
0

The New Community Rules: Marketing on the Social Web docx

Ngày tải lên : 29/03/2014, 10:20

... dissatisfaction and possibly use the personal web space as a grounds to tear apart the reputation of the company On the other hand, satisfied customers have also launched web pages and uploaded ... companies and brands as it relates to social media and social media marketing: giving up control of the message In traditional media, the conversation was one-way You spoke, and an audience listened ... back and wait for the wave of complaints to stop Today, with the ease of spreading information, that is not the ideal approach Instead, joining in the conversation may be the best route you can...

368
956
1

Báo cáo hóa học: " Structure-dependent growth control in nanowire synthesis via on-film formation of nanowires" pptx

Ngày tải lên : 21/06/2014, 05:20

... found that the density of Bi nanowires at the edge is higher in the factor of 1.3 than that at the center, and the total density increased as the Bi film area increased after annealing at 270°C ... difference in the thermal expansion coefficients of Si and SiO2) Therefore, the choice of a substrate structure that can maximize the thermal expansion mismatch with the film is a crucial parameter ... that the ratio of the Bi nanowire densities for the two cases reaches approximately 800 Based on a localized model [15], the surface oxide layer may strongly affect nanowire growth because a nanowire...

6
174
0

Báo cáo lâm nghiệp: "Effects of drainage treatment and stand growth on changes in runoff components from a forested watershed" pps

Ngày tải lên : 07/08/2014, 03:22

... components Their amount and ratios are calculated using many mathematical and graphical-mathematical methods We have chosen a simple analysis of the recession (falling) hydrograph limb (Drainage ... reflecting the development of regenerated forest stand Under such conditions, the fluctuation of runoff can be related to the loss and restoration of both interception and transpiration On the other hand, ... vegetation type situated on acidic, waterlogged and locally peaty soils The total thickness of Quaternary unconsolidated material (sandy and clayey soil with 20–50% amount of coarse fraction) ranges...

7
403
0

báo cáo khoa học: " Reconsidering the public health failings of the criminal justice system: a reflection on the case of Scott Ortiz" potx

Ngày tải lên : 11/08/2014, 20:20

... in the realm of drug policy and illustrates the extent to which dominant social narratives that portray drug users as reckless and lacking regard for the health of others have penetrated the ... discrimination within the judiciary being the main target for action Correction is a public safety rather than a public health activity, and therefore the justice system and prison life itself are not ... of enforcement and incarceration in drug policy, the case of Mr Ortiz suggests new work for public health practitioners, prisoner advocates, and legal reformers, with ignorance and discrimination...

2
256
0

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Ngày tải lên : 14/02/2014, 22:20

... synthesis was described by the mass action rate law: rA!B ðtÞ ¼ k Á cA ðtÞ In this reaction kinetic, the reaction rate rAﬁB(t) depends on the substrate concentration cA(t) and the rate constant k The ... assessment of the trajectory of interconversion rates as a function of time of cold exposure, (b) comparison of the magnitudes of the various interconversion rates, and (c) lineup of the accessions ... 6phosphate and 40 mm glucose 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and...

13
707
0

Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

Ngày tải lên : 22/03/2014, 23:20

... from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International investment positions and Michael Binder exchange rate dynamics: a dynamic panel analysis Christian ... research project during their stay at the Bundesbank Candidates must hold a Ph D and be engaged in the field of either macroeconomics and monetary economics, financial markets or international ... Volker Wieland Corporate marginal tax rate, tax loss carryforwards and investment functions – empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence...

40
468
0

Báo cáo hóa học: "Code-Aided Estimation and Detection on Time-Varying Correlated Mimo Channels: A Factor Graph Approach" pdf

Ngày tải lên : 22/06/2014, 23:20

... Gaussian pdf Since the product of Gaussian pdfs (as in (24) and (26)) and marginalization of a Gaussian pdf (as in (22), (23), and (27)), results in a Gaussian pdf again, all forward and backward ... conclusion was that the SP algorithm boils down to a straightforward Kalman smoother As we elaborated upon, all messages on the factor graph are Gaussian pdfs The recursive relations between these are ... bits are made Algorithm summarizes the operation of the detector 4.2.2 Estimation The estimation phase corresponds to the SP operation on the ¯ ¯ nodes p(H) and p(Y | A, H) At the beginning of the...

11
256
0

Báo cáo y học: " Application of different measures of skeletal maturity in initiating weaning from a brace for scoliosis: two case reports" docx

Ngày tải lên : 11/08/2014, 17:21

... matching’ of an X-ray of the left wrist to assess bone age and skeletal maturity [12] An alternative method of assessing skeletal maturity, using X-rays of the left wrist and hand, is that of Tanner and ... vertebrae (caudal and cranial end vertebrae) that are the most tilted on radiological examination [5] On X-ray, this is the most translated and rotated vertebra in the transverse plane Measurement ... apophyseal image variation according to the radiological view The appearance of the iliac apophysis on posterior-anterior X-rays cannot be used as a reliable indicator of skeletal maturity because the...

6
254
0

A systems biology approach to elucidating the frequency decoding mechanism governing differential mammalian gonadotropin subunit gene expression

Ngày tải lên : 11/09/2015, 09:11

... consequences of calcium release into the cytoplasm and the activation of PKCs is the ﬁring of the three major MAPK cascades, culminating in the activation of extracellular-signal regulated kinase (ERK) ... transcription factors and co-repressors Of these, the MEF2 family of DNA-binding transcription factors is one of the major targets of class IIa HDACs (Figure 1.5) [143] On the other hand, class IIa HDACs ... charges of DNA [140] 1.4.3 Histone deacetylases (HDACs) HDACs form a group of important transcriptional regulators that antagonize directly the actions of histone acetyltranferases (HATs), which acetylate...

233
258
0

Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx

Ngày tải lên : 18/02/2014, 08:20

... of the fungal extracellular RNase family Results Assignment The 1H assignments for the backbone and side chains are nearly complete The observed conformational chemical shifts for alpha and amide ... experimental constraints with small deviations from the idealized covalent geometry, and most of the backbone torsion angles for amino acid residues lie within the allowed regions in the Ramachandran ... Pozo A & Gavilanes JG (2001) RNase U2 and alphasarcin: a study of relationships Meth Enzymol 341, 335–351 ´ Lacadena J, Alvarez-Garcı´ a E, Carreras-Sangra N, ´ Herrero-Galan E, Alegre-Cebollada...

10
607
0

Tài liệu Báo cáo khoa học: Inﬂuence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Ngày tải lên : 19/02/2014, 05:20

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... that other phenomena, such as electrostatic stabilization of the transition state, formation of covalent intermediates, steric strain, near attack conformations, substrate desolvation, low barrier...

17
531
0

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Ngày tải lên : 19/02/2014, 12:20

... agarose gels, restriction endonuclease analysis, ligation of DNA fragments, Ó FEBS 2004 1212 V Zara et al (Eur J Biochem 271) transformation of Escherichia coli and isolation of plasmid DNA from ... mitochondrial membranes The pellet was washed with 20–30 mL of MTE and re-isolated by centrifugation as Mitochondrial membranes were analyzed by standard SDS/PAGE with 15% (w/v) acrylamide and an acrylamide/bis-acrylamide ... the absence of subunit also resulted in an increase in the ratio of intermediate to mature cytochrome c1 and a disappearance of the intermediate form of the Rieske protein At the same time, the...

10
517
0

Whatever Happened to Frank and Fearless- The Impact of the New Public Management on the Australian Public Service ppt

Ngày tải lên : 06/03/2014, 13:20

... the cases of the detention of Cornelia Rau and the deportation of Vivian Solon, involving the then Department of Immigration and Multicultural and Indigenous Affairs (DIMIA);2 the payments made ... in newspapers such as The Australian, Courier-Mail and The Canberra Times and has been a regular state political commentator on ABC radio and TV Table of Contents Author Profile ix Acknowledgements ... Canberra ACT 0200, Australia Email: anuepress@anu.edu.au This title is also available online at: http://epress.anu.edu.au/frank_fearless_citation.html National Library of Australia Cataloguing-in-Publication...

176
735
0

Báo cáo khoa học: New insights into the functions and N-glycan structures of factor X activator from Russell’s viper venom pot

Ngày tải lên : 07/03/2014, 06:20

... may lead to an increase in the risk of coagulation and disseminated intravascular coagulation (DIC) syndrome Cloning and sequence alignment of RVV-X subunits PCR ampliﬁcation and cloning of the ... analyses of the glycan epitopes Samples of lg of RVV-X and lg of BSA were analysed by 8% SDS-PAGE under reducing conditions Appropriate amounts of Lex /a- and SLex /a- conjugated BSAs and human ... Snake venom activators of factor X: an overview Haemostasis 31, 225–233 Takeya H, Nishida S, Miyata T, Kawada S, Saisaka Y, Morita T & Iwanaga S (1992) Coagulation factor X activating enzyme from...

15
562
0

Click Here: The State of Online Advertising - New insights into the beliefs of consumers and professional marketers ppt

Ngày tải lên : 15/03/2014, 22:20

... on behalf of their favorite brands, but also wish there was a dislike button for social media 68% of consumers find online ads “annoying” and “distracting” and 54% say online banner ads don’t ... professions among consumers – along with actors and dancers; not highly regarded by marketing professionals either Most marketing is a bunch of B.S., 53% agree Consumers and marketing professionals agree ... October 2012 Majority of respondents use social media; over half have liked on behalf of their favorite brands, but also wish there was a dislike button for social media Social Media – Likes and Dislikes...

16
505
0

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

Ngày tải lên : 16/03/2014, 01:20

... Plant VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO GMC GMC GMC Succinate dehydrogenase Succinate dehydrogenase DAAO DAAO DAAO DAAO ? ? VAO AMO AMO DAAO DAAO ... Plant Plant Bacteria Plant Plant Fungus Bacteria Bacteria Bacteria Plant Bacteria Animal Fungus Yeast Yeast Bacteria Bacteria Plant Bacteria Fungus Fungus All Bacteria Animal Animal Bacteria Bacteria ... Bacteria Bacteria Fungus Bacteria Animal Animal Fungus Bacteria Animal Bacteria Plant Bacteria Bacteria Plant allergens BG6 0a [55] and Phl P 4a [165] Tetrahydrofuran monooxygenase reductase component...

23
564
0

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identiﬁcation of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Ngày tải lên : 17/03/2014, 03:20

... CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT ... GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Speciﬁc primers used for ampliﬁcation ... to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like box (CATAAAA) 270...

10
451
0

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

Ngày tải lên : 22/03/2014, 16:20

... when the HIV-1 RT RDDP activity was measured in the presence of increasing concentrations of one of the two AQ derivatives and efavirenz, and analyzed using the YonetaniTheorell plot, the slope and ... (1992) Evaluation of antiviral activity of anthraquinones, anthrones and anthraquinone derivatives against human cyromegalovirus Antiviral Res 17, 6377 Bamard DL, Fairbaim DW, ONeill KL, Gage TL & ... initial screens enter the nal stage, which involves the evaluation and minimization of a grid approximation to the OPLS-AA non-bonded ligandreceptor interaction energy Final scoring is then carried...

14
425
0