... to have agents deduce these rules by observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of great activity, ... supplying the information has become less important: demand for information is becoming the most important aspect ofthe information chain What's more, information is playing an increasingly ... guides and indexing agents is that their actions and suggestions are based on a relatively weak modelof what the user wants and what information is available at a suggested location An attempt...
... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... differences in trial design or an emphasis on angiographic rather than clinical end points, clinical trials comparing the safety and efficacy between these DES types and BMSs have yielded inconsistent...
... to have agents deduce these rules by observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of great activity, ... supplying the information has become less important: demand for information is becoming the most important aspect ofthe information chain What's more, information is playing an increasingly ... guides and indexing agents is that their actions and suggestions are based on a relatively weak modelof what the user wants and what information is available at a suggested location An attempt...
... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... RPE65c inthe retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c inthe retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
... show a clear handedness, and two ofthe rings face inthe opposite direction inthe membrane to the other two, forming the same pattern as inthe AFM surface representation of Fig 2A By comparison ... Therefore, the c ring ofA woodii has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism ofthe ring The c ring of I tartaricus has ... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay inthe number of ion-translocating subunits inthe membrane-embedded...
... such large-scale conformational changes during catalysis, and these structural features explain the lack of substrate activation in ZmPDC In IPDC, the assembly ofthe subunits inthe tetramer ... the other hand involving the C-terminal part ofthe polypeptide chain (Fig 7) Inthe latter, differences inthe conformation ofthe loop between Fig Stereo picture ofthemodelofthe a- carbanion/enamine ... b11 and b12 (shown in blue) prevents the C-terminal helix a2 3 from approaching the active site, and thus leads to a more open substrate binding pocket in ScPDC Amodelofthe a- carbanion/enamine...
... whether a small amount of a- L-1,3-arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis ofthe hydrolysis of arabinogalactans by GALA Three different arabinogalactans ... Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain anA niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was ... 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L-arabinose Methylation analysis demonstrated that a substantial amount ofthe L-arabinose residues...
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... limitation, as shown by the RT-PCR analysis, and there is overlapping ofthe desB translation termination triplet with the ATG of desC and also of desC and desD (so-called translational coupling); ... DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin resistance...
... Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG ... H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding inthe activation ... ofthe gp130 peptide into buffer was determined in control experiments and subtracted from the raw data ofthe binding experiment The data were analysed using the evaluation software, Microcal...
... investigated thein uence ofthe ARE and the CRID on the poly (A) status ofthe human IFN-b mRNA in natural conditions of IFN-b synthesis Materials and methods Reagents All the reagents and enzymes used in ... RNAs are other ARE-containing mRNAs bearing instability determinants in their coding region [24–27] Moreover, inthe case of c-fos, it was shown that ARE mediates mRNA deadenylation by a translationindependent ... presence of 32P-labelled UTP (see Materials and Fig Deadenylation of IFN-b mRNA is independent of translation (A) Deadenylation analysis ofthe PIFNHA and PIFNHA hp transcripts Hec-1B cells were transfected...
... Schematic drawing ofthe human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always links to a b-chain ... Using an a- chain mAb as a probe and denaturing ⁄ renaturing experiments, we further demonstrated that steric hindrance ofthe Hp a- chain plays a major role in determining the polymeric formation ... cross-links with a b-chain to forma basic a- b unit, and that at the N-terminus links with another (a- b)1, resulting inan Hp dimer (a1 -b)2, i.e a Hp 1-1 molecule In contrast, the a2 -chain, containing...
... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... for at 120 °C prior to SDS ⁄ PAGE to disrupt the c oligomer and blotted against c1 antibodies Lane 4: ATP synthase was incubated for 10 at 80 °C, and blotted against c1 antibodies Lane 5: the sample ... F0, the rotor of V1V0ATPases has only half the number of ion-binding sites This is seen as the reason for the apparent inability of V1V0-ATPases to catalyze ATP synthesis in vivo Indeed, V1V0-ATPases...
... group): intraperitoneal (i.p.), intradermal (i.d.), intracerebral (i.c.), and intranasal (i.n.) At Days and of infection, three animals per group were euthanasied; brain and spinal cord were rapidly ... secondary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated with Texas Red, red staining) ... the blood-brain barrier However, the fact that infected neural cells are detected inthe olfactory bulb after intra-nasal inoculation suggests that an intraneural transport of WNV cannot be ruled...
... measured inthe lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that inthe (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and ... cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized sections were incubated at...
... ethic ofthe organization and ignorance of it can adversely affect the consultancys relationships with the client Mixing and matching There are occasions when it may be more appropriate and ... and can often become the guardians ofthe client organizations reputation In addition they can cover many topics with advice, both internally and externally, through trained, qualified and ... communication ofan organization A consultancy usually works to one person inthe organization the liaison officer This can sometimes lead to a sense of remoteness and a lack of any effective...
... as a garden, an interior, the front ofa building, or a building site Weather watching On the day, a weather watch may be needed if there is any question about the weather holding Delays mean ... of any available still material, plus a bit of location work and a reasonable voice over, the cost can be kept to a reasonable level What, then, can be described as reasonable? A rule of ... consultancies, there are a growing number of small design consultancies that are very competitive Because they are comparatively new inthe industry they often have fresh ideas and an innovative approach...
... setting and have a formal agenda, at least for part ofthe meeting The adoption ofthe previous minutes, chairmans address, presentation and adoption ofthe annual accounts and the appointment of ... material, a standard facia board over the front with your organizations name and stand number, some sort of flooring, a ceiling and basic lighting Make sure the correct details are on the facia The ... event, but also inthe staffing and inthe implementation After all, you are presenting, or even selling, a professional service on the stand, so why so inan amateurish way? Bad planning and slipshod...
... copyright and the control of access are just a few ofthe issues being raised In addition, because many businesses now carry pages with a large amount of information instantly available to anyone ... must be aware of and understand these technicalities and characteristics The down side Be aware also of some ofthe pitfalls Television is often used to amuse and entertain, rather than to inform ... Electronic mail The advent ofthe Internet has led to many organizations, businesses and individuals having electronic mailing links Electronic mail (or e-mail) is a way of communicating that can be...
... l minutes and notes of meetings; conversations the least accurate but sometimes indicative Analysis The analyst (that is the PRO) then has to examine all the material collected, analysing and ... act as an early warning system for any overruns that may occur, and can also be used as a benchmark for any future work They also help in calculating fees A secretariat can collect and then ... however insignificant it may appear Analysts should take everything into account when assessing information and in their subsequent analysis again, the detective work analogy Feedback will...