model of an audiovisual publication in the form of a web portal

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... to have agents deduce these rules by observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of great activity, ... supplying the information has become less important: demand for information is becoming the most important aspect of the information chain What's more, information is playing an increasingly ... guides and indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt...
  • 100
  • 811
  • 3
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Ngày tải lên : 25/10/2012, 11:18
... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... differences in trial design or an emphasis on angiographic rather than clinical end points, clinical trials comparing the safety and efficacy between these DES types and BMSs have yielded inconsistent...
  • 6
  • 550
  • 0
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 26/10/2013, 17:15
... to have agents deduce these rules by observing a user's behaviour and trying to find patterns in it; Information Access and Management: Information access and management is an area of great activity, ... supplying the information has become less important: demand for information is becoming the most important aspect of the information chain What's more, information is playing an increasingly ... guides and indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt...
  • 100
  • 412
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Ngày tải lên : 14/02/2014, 14:20
... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Ngày tải lên : 18/02/2014, 17:20
... show a clear handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same pattern as in the AFM surface representation of Fig 2A By comparison ... Therefore, the c ring of A woodii has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring The c ring of I tartaricus has ... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay in the number of ion-translocating subunits in the membrane-embedded...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Ngày tải lên : 20/02/2014, 11:20
... such large-scale conformational changes during catalysis, and these structural features explain the lack of substrate activation in ZmPDC In IPDC, the assembly of the subunits in the tetramer ... the other hand involving the C-terminal part of the polypeptide chain (Fig 7) In the latter, differences in the conformation of the loop between Fig Stereo picture of the model of the a- carbanion/enamine ... b11 and b12 (shown in blue) prevents the C-terminal helix a2 3 from approaching the active site, and thus leads to a more open substrate binding pocket in ScPDC A model of the a- carbanion/enamine...
  • 10
  • 557
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21
... whether a small amount of a- L-1,3-arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis of the hydrolysis of arabinogalactans by GALA Three different arabinogalactans ... Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was ... 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L-arabinose Methylation analysis demonstrated that a substantial amount of the L-arabinose residues...
  • 9
  • 669
  • 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Ngày tải lên : 16/03/2014, 11:20
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... limitation, as shown by the RT-PCR analysis, and there is overlapping of the desB translation termination triplet with the ATG of desC and also of desC and desD (so-called translational coupling); ... DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin resistance...
  • 13
  • 456
  • 0
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Ngày tải lên : 16/03/2014, 14:20
... Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG ... H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation ... of the gp130 peptide into buffer was determined in control experiments and subtracted from the raw data of the binding experiment The data were analysed using the evaluation software, Microcal...
  • 11
  • 525
  • 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Ngày tải lên : 17/03/2014, 10:20
... investigated the in uence of the ARE and the CRID on the poly (A) status of the human IFN-b mRNA in natural conditions of IFN-b synthesis Materials and methods Reagents All the reagents and enzymes used in ... RNAs are other ARE-containing mRNAs bearing instability determinants in their coding region [24–27] Moreover, in the case of c-fos, it was shown that ARE mediates mRNA deadenylation by a translationindependent ... presence of 32P-labelled UTP (see Materials and Fig Deadenylation of IFN-b mRNA is independent of translation (A) Deadenylation analysis of the PIFNHA and PIFNHA hp transcripts Hec-1B cells were transfected...
  • 8
  • 361
  • 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Ngày tải lên : 23/03/2014, 07:20
... Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always links to a b-chain ... Using an a- chain mAb as a probe and denaturing ⁄ renaturing experiments, we further demonstrated that steric hindrance of the Hp a- chain plays a major role in determining the polymeric formation ... cross-links with a b-chain to form a basic a- b unit, and that at the N-terminus links with another (a- b)1, resulting in an Hp dimer (a1 -b)2, i.e a Hp 1-1 molecule In contrast, the a2 -chain, containing...
  • 13
  • 527
  • 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Ngày tải lên : 23/03/2014, 09:20
... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... for at 120 °C prior to SDS ⁄ PAGE to disrupt the c oligomer and blotted against c1 antibodies Lane 4: ATP synthase was incubated for 10 at 80 °C, and blotted against c1 antibodies Lane 5: the sample ... F0, the rotor of V1V0ATPases has only half the number of ion-binding sites This is seen as the reason for the apparent inability of V1V0-ATPases to catalyze ATP synthesis in vivo Indeed, V1V0-ATPases...
  • 8
  • 486
  • 0
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

Ngày tải lên : 18/06/2014, 22:20
... group): intraperitoneal (i.p.), intradermal (i.d.), intracerebral (i.c.), and intranasal (i.n.) At Days and of infection, three animals per group were euthanasied; brain and spinal cord were rapidly ... secondary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated with Texas Red, red staining) ... the blood-brain barrier However, the fact that infected neural cells are detected in the olfactory bulb after intra-nasal inoculation suggests that an intraneural transport of WNV cannot be ruled...
  • 5
  • 403
  • 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

Ngày tải lên : 20/06/2014, 04:20
... measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and ... cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized sections were incubated at...
  • 10
  • 478
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Ngày tải lên : 21/06/2014, 14:20
... ethic of the organization and ignorance of it can adversely affect the consultancy’s relationships with the client Mixing and matching There are occasions when it may be more appropriate – and ... and can often become the ‘guardians’ of the client organization’s reputation In addition they can cover many topics with advice, both internally and externally, through trained, qualified and ... communication of an organization A consultancy usually works to one person in the organization – the ‘liaison officer’ This can sometimes lead to a sense of remoteness and a lack of any effective...
  • 17
  • 502
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Ngày tải lên : 21/06/2014, 14:20
... as a garden, an interior, the front of a building, or a building site Weather watching On the day, a ‘weather watch’ may be needed if there is any question about the weather holding Delays mean ... of any available ‘still’ material, plus a bit of location work and a reasonable ‘voice over’, the cost can be kept to a reasonable level What, then, can be described as ‘reasonable’? A rule of ... consultancies, there are a growing number of small design consultancies that are very competitive Because they are comparatively new in the industry they often have fresh ideas and an innovative approach...
  • 17
  • 433
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

Ngày tải lên : 21/06/2014, 14:20
... setting and have a formal agenda, at least for part of the meeting The adoption of the previous minutes, chairman’s address, presentation and adoption of the annual accounts and the appointment of ... material, a standard facia board over the front with your organization’s name and stand number, some sort of flooring, a ceiling and basic lighting Make sure the correct details are on the facia The ... event, but also in the staffing and in the implementation After all, you are presenting, or even selling, a professional service on the stand, so why so in an amateurish way? Bad planning and slipshod...
  • 17
  • 410
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

Ngày tải lên : 21/06/2014, 14:20
... copyright and the control of access are just a few of the issues being raised In addition, because many businesses now carry pages with a large amount of information instantly available to anyone ... must be aware of and understand these technicalities and characteristics The down side Be aware also of some of the pitfalls Television is often used to amuse and entertain, rather than to inform ... Electronic mail The advent of the Internet has led to many organizations, businesses and individuals having electronic mailing links Electronic mail (or e-mail) is a way of communicating that can be...
  • 17
  • 453
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

Ngày tải lên : 21/06/2014, 14:20
... l minutes and notes of meetings; conversations – the least accurate but sometimes indicative Analysis The analyst (that is the PRO) then has to examine all the material collected, analysing and ... act as an early warning system for any ‘overruns’ that may occur, and can also be used as a ‘benchmark’ for any future work They also help in calculating fees A secretariat can collect and then ... however insignificant it may appear Analysts should take everything into account when assessing information and in their subsequent analysis – again, the detective work analogy Feedback will...
  • 17
  • 458
  • 0

Xem thêm