Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene ´ ´ Sedef Tunca1, Carlos Barreiro1, Alberto Sola-Landa1, Juan Jose R Coque1,2 and Juan F Martın1,2 ´ ´ Instituto de Biotecnologıa, INBIOTEC, Leon, Spain ´ ´ ´ ´ Area de Microbiologıa, Facultad de CC Biologicas y Ambientales, Universidad de Leon, Spain Keywords desferrioxamine biosynthesis; gene expression; iron regulation; lysine decarboxylase gene; siderophores Correspondence ´ ´ J F Martın, Instituto de Biotecnologıa, ´ ´ INBIOTEC, Parque Cientıfico de Leon, Avenue del Real no 1, 24006 Leon, Spain Fax: + 34 987 210 388 Tel: + 34 987 210 308 E-mail: jf.martin@unileon.es (Received 11 October 2006, revised 19 December 2006, accepted 21 December 2006) doi:10.1111/j.1742-4658.2007.05662.x Streptomyces coelicolor and Streptomyces pilosus produce desferrioxamine siderophores which are encoded by the desABCD gene cluster S pilosus is used for the production of desferrioxamine B which is utilized in human medicine We report the deletion of the desA gene encoding a lysine decarboxylase in Streptomyces coelicolor A3(2) The DdesA mutant was able to grow on lysine as the only carbon and nitrogen source but its desferrioxamine production was blocked, confirming that the l-lysine decarboxylase encoded by desA is a dedicated enzyme committing l-lysine to desferrioxamine biosynthesis Production of desferrioxamine was restored by complementation with the whole wild-type desABCD cluster, but not by desA alone, because of a polar effect of the desA gene replacement on expression of the downstream des genes The transcription pattern of the desABCD cluster in S coelicolor showed that all four genes were coordinately induced under conditions of iron deprivation The transcription start point of the desA gene was identified by primer extension analysis at a thymine located 62 nucleotides upstream of the translation start codon The )10 region of the desA promoter overlaps the 19-nucleotide palindromic iron box sequence known to be involved in iron regulation in Streptomyces Binding of DmdR1 divalent metal-dependent regulatory protein to the desA promoter region of both S coelicolor and S pilosus was shown using electrophoretic mobility-shift assays, validating the conclusion that iron regulation of the desABCD cluster is mediated by the regulatory protein DmdR1 We conclude that the genes involved in desferrioxamine production are under transcriptional control exerted by the DmdR1 regulator in the presence of iron and are expressed under conditions of iron limitation Iron is an essential element required for many key metabolic processes (including cytochrome and Fe-S electron transporters) in almost all micro-organisms The bioavailability of iron is very low because salts of the oxidized ferric ion formed under normal oxic conditions are largely insoluble [1] To solve the problem of iron availability, many micro-organisms synthesize different high-affinity iron chelators (siderophores), forming very stable complexes with ferric iron [2] Streptomyces species are soil-dwelling Grampositive saprophytic bacteria that produce different types of siderophores [3,4] Desferrioxamines are nonpeptide hydroxamate siderophores composed of alternating dicarboxylic acid and diamine units Abbreviations DmdR, divalent metal-dependent regulatory protein; ILMM, iron-limited minimal medium; YEME, yeast extract and malt extract culture medium 1110 FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al linked by amide bonds They are produced by many Streptomyces species, including Streptomyces coelicolor [5], Streptomyces griseus [6] and Streptomyces pilosus; the latter is used for industrial production of desferrioxamine B for medical uses [7,8] In Streptomyces species, as in other Gram-positive bacteria, the expression of genes involved in iron metabolism is under the control of a divalent metal-dependent regulatory protein (DmdR) analogous to the diphtheria toxin repressor of Corynebacterium diphtheriae [9,10] S coelicolor has two similar genes, dmdR1 and dmdR2, encoding regulatory proteins of this family [11] In a previous study, Flores et al [12] reported that S coelicolor DmdR1 binds specific sequences (iron boxes) in the upstream region of the diphtheria toxin (tox) gene of C diphtheriae and the desA gene of S pilosus Several putative iron boxes were found by bioinformatics analysis upstream of 10 different ORFs in the genome of S coelicolor [12] One of the putative iron boxes is located in the promoter of the desABCD gene cluster, which was assumed to be responsible for des´ ferrioxamine biosynthesis [13] Barona-Gomez et al [14] proposed a possible pathway for desferrioxamine biosynthesis from l-lysine and reported that desD is essential for desferrioxamine formation (Fig 1) [15] The first step in the desferrioxamine pathway is the conversion of l-lysine into cadaverine catalyzed by the enzyme lysine decarboxylase [7,8] which, in S coelicolor, appears to be encoded by desA, although no conclusive genetic evidence was available until now, as other putative lysine decarboxylase-encoding genes occur in the S coelicolor genome (e.g SCO2017) As one of the iron boxes was located in the upstream region of the desABCD cluster, it was of interest to perform a transcriptional analysis of this cluster and also to characterize the promoter region (transcription start point and regulatory sequences) in order to analyze the role of iron and the DmdR1 regulator in the transcriptional control of the desferrioxamine cluster In this study, we report the deletion of the first gene of the desABCD gene cluster (desA) in S coelicolor A3(2), which caused cessation of desferrioxamine E and B biosynthesis Transcriptional analysis of this region showed that the genes involved in desferrioxamine production are under iron control The transcription start point of the desA gene was shown to overlap with the palindromic iron box Binding of purified DmdR1 protein to the desA promoter region of both S coelicolor and S pilosus, as shown by electrophoretic mobility-shift assay, proved that iron control of the Regulation of the desferrioxamine gene cluster expression of the des cluster is mediated by the DmdR1 regulator Results Deletion of the desA gene of S coelicolor blocks desferrioxamine biosynthesis The organization of the putative desferrioxamine gene cluster, as deduced from the S coelicolor genome, is shown in Fig 1B To clarify the role of the l-lysine decarboxylase encoded by desA and its possible involvement in desferrioxamine biosynthesis, two apramycin-resistant and kanamycin-sensitive transformants were isolated among S coelicolor transformants with the desA gene replacement construction (see Experimental procedures), and the DdesA mutation was verified in one of the mutants by PCR and Southern blot analysis A 1462-bp PCR band corresponding to the extended resistance cassette was found only in the mutant strain, and a 1372-bp PCR band corresponding to the desA gene was present only in the wild-type strain but not in the DdesA mutant These results were confirmed by Southern blot hybridization of ScaIdigested DNA A hybridization band of  4200 bp was obtained for the wild-type with a desA fragment (1372 bp) as probe, and a band of about 4220 bp was found for the mutant with aac(3)IV fragment (935 bp) as probe, as expected Hybridization and PCR analysis results indicate that the desA gene has been deleted and replaced by the apramycin resistance gene HPLC analysis showed that no desferrioxamines could be detected in the culture supernatants of the DdesA mutant, whereas desferrioxamines B and E were produced in the parental strain (Fig 2) The DdesA mutant was able to grow on Streptomyces minimal medium containing l-lysine as the only carbon and nitrogen source, indicating that the desA gene is not involved in the catabolism of lysine Complementation of the S coelicolor desA mutation with cosmid Stc105 restored desferrioxamine biosynthesis Complementation of the DdesA mutant was tested by conjugation with Escherichia coli containing either (a) a plasmid construct pRAdesAKn (see Experimental procedures) carrying a 4204-bp fragment containing the desA coding region or (b) cosmid Stc105 In the plasmid-mediated complementation, one of the KnR conjugants was selected for further analysis A 1372-bp PCR fragment corresponding to the desA gene was present in the complemented and in the wild-type strains but FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1111 Regulation of the desferrioxamine gene cluster S Tunca et al A B Fig Proposed pathway for desferrioxamine biosynthesis indicating the conversions catalyzed by the enzymes encoded by desA, desB, desC and desD (A) and organization of the S coelicolor des cluster and the upstream SCO2780 and SCO2781 genes (B) The iron box located upstream of desA is indicated by an open box RBS, Ribosome-binding site The hairpin structure corresponds to a stem and loop structure (putative transcriptional terminator) found downstream of desD Solid bars indicate the DNA fragments amplified by RT-PCR in the gene expression studies (see Fig 4) 1112 FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al Regulation of the desferrioxamine gene cluster Fig Lack of desferrioxamine production in the S coelicolor DdesA mutant and restoration by complementation with the des cluster HPLC analysis of siderophore production in S coelicolor A3(2) parental and the DdesA mutant strain before and after complementation with the Stc105 cosmid Desferrioxamine E (retention time 15.3 min) is the major desferrioxamine produced by S coelicolor Desferrioxamine B showed a retention time of 13.6 not in the DdesA mutant, as expected (Fig 3A) In this conjugant, the Southern blot hybridization pattern agreed with the integration of the intact wild-type desA A gene (Fig 3B,C) When the desA fragment (1372 bp) was used as probe, a band of 3700 bp was found only in the wild-type and complemented mutant (Fig 3B) A 1520-bp positive band was obtained only in the complemented strain when a kan (kanamycin resistance) fragment (1519 bp) was used as probe, as expected (Fig 3C) Complementation of the desA deletion in the mutant strain with the wild-type gene failed to restore desferrioxamine production under iron-deficient conditions (data not shown) However, functional complementation of the DdesA mutant was achieved with cosmid Stc105, which includes the entire siderophore biosynthetic gene cluster (Fig 2C) The failure of the 4204-bp fragment containing a wild-type copy of the desA gene to complement the mutation in trans suggests that the DdesA mutation affects expression of the downstream genes desBCD in the des cluster and that the presence of wild-type desA gene product was not sufficient to restore the ability to produce these siderophores The complementation with cosmid Stc105 indicates that the four genes in the des cluster are probably transcribed as one polycistronic mRNA (see below), allowing complementation of the desA mutant, even if expression of the endogenous desBCD genes is disturbed in the DdesA mutant B C Fig Verification of the complementation of desA deletion by PCR using primers for the desA gene (A) and by Southern blot hybridization (B, C) (A) 1-kb Plus DNA ladder (Invitrogen) (lane 1); S coelicolor A3(2) wild-type strain (lane 2); DdesA mutant (lane 3); complemented strain (lane 4) (B, C) Southern blot analysis of PvuII-digested genomic DNA probed with a 1372-bp desA fragment (B) and of BamHI + SacI-digested genomic DNA probed with a kan (kanamycin resistance) fragment (1519 bp) (C) Size markers (kDNA-HindIII-digested) (lane 1); S coelicolor A3(2) wild-type strain (lane 2); desA-deleted strain (lane 3); complemented strain (lane 4) FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1113 Regulation of the desferrioxamine gene cluster S Tunca et al Production of desferrioxamines B and E is regulated by iron The desferrioxamines Tris–hydroxamate–Fe3+ complexes were determined in the supernatants of cultures grown in (a) iron-limited minimal medium (ILMM), (b) ILMM with 2,2¢-dipyridyl, and (c) ILMM supplemented with 35 lm iron S coelicolor A3(2) grown in iron-deficient medium produces desferrioxamine B and E Addition of iron to the culture medium completely suppressed desferrioxamine production, indicating that the biosynthesis of these siderophores is strictly regulated by iron (not shown) Expression of the desABCD cluster is coordinately derepressed after iron deprivation Four different genes (desA to desD) have been reported to be involved in the biosynthesis of desferrioxamine [14] Upstream of the desA gene, two other genes encoding siderophore-related proteins are located (Fig 1B) The first is a siderophore-interacting protein (viuB gene), whereas the second encodes a putative secreted protein (SCO2780) annotated as a hypothetical siderophore-binding lipoprotein [13] To elucidate if these two genes are expressed and to study their possible involvement in desferrioxamine biosynthesis, the transcriptional pattern of the entire region was analyzed by RT-PCR under iron-deprivation conditions Because of the lack of growth after iron deprivation, the cultures were initially grown in complex medium [yeast extract and malt extract culture medium (YEME)] for 36 h and then starved of iron (see Experimental procedures) After iron deprivation, five samples (taken at 2, 6, 8, 24 and 48 h) were analyzed, and the RNA from one nonstarved culture was used as control A small increase in dry weight until h was observed, but no further growth occurred thereafter The RT-PCR analysis revealed induction of the tested desA and desD genes (located at the beginning and end of the cluster) under iron-limiting conditions, indicating a coordinated transcription (Fig 4) This result supports the existence of the desABCD operon suggested by Barona-Gomez and coworkers [14] that is transcribed as a polycistronic mRNA and confirms the need of the entire des cluster (as in cosmid Stc105) to complement the DdesA mutant described above Maximum induction of desA and desD was found 6–8 h after iron limitation, and a significant decrease in expression was observed after 48 h of iron deprivation, indicating that the culture was unable to maintain expression of the cluster for prolonged periods, 1114 Fig Expression of the desA–D genes and the upstream genes at 2, 6, 8, 24 and 48 h after iron starvation (t ¼ 0) Controls without RNA (lane –) and with DNA instead of RNA (lane +) were performed simultaneously The hrdB gene was used as control of RNA amounts probably because of the lack of iron-dependent respiratory metabolism after extended iron deprivation An upstream gene encoding a putative siderophore-binding protein is also derepressed after iron deprivation The transcription pattern of the genes located upstream of the desA gene was also analyzed The viuB gene did not show RT-PCR amplification, suggesting that it is not expressed, or very poorly so, under the experimental conditions used On the other hand, a transcription pattern similar to that of the desABCD operon was found for the SCO2780 gene located upstream of viuB (Fig 4) encoding a putative siderophore-binding lipoprotein (see Discussion) Our results confirm the regulation by iron of the expression of this gene In contrast with the desABCD operon, the gene encoding this putative siderophore-binding lipoprotein (SCO2780) does not show an obvious consensus iron box in its promoter region, suggesting that SCO2780 is controlled by indirect iron regulation, probably mediated by a cascade mechanism The desA promoter of S pilosus showed higher expression ability than the same promoter from S coelicolor Streptomyces pilosus is used industrially for desferrioxamine production and it produces higher levels of those siderophores than S coelicolor [16,17] To compare the efficiency of expression of the des cluster from FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al Regulation of the desferrioxamine gene cluster primer (O6, Table 2) allowed clear identification of the desA transcription start point at a thymine located 62 nucleotides upstream of the ATG translation initiation codon of desA This transcription start point is located immediately downstream of the iron box (boxed in Fig 6) and allowed us to identify the )10 Pribnow box as TAGGCT in agreement with the proposed consensus sequence for Streptomyces promoters TAgPuPuT [19] It is interesting that the )10 sequence is located inside the iron box of desA (nucleotides 7–12 of the iron box), explaining the regulation of desA expression by binding of DmdR1 to the iron box The same overlapping was found in S pilosus DmdR1 binds to the promoter region of desABCD in both S coelicolor and S pilosus Fig S coelicolor A3(2) and S pilosus desA promoter activity in S lividans and in S coelicolor A3(2) in ILMM cultures as measured by determining the catechol oxygenase of the coupled reporter gene these two Streptomyces species, the desA promoter region (511-bp PCR product) of both S coelicolor and S pilosus were cloned in BamHI–EcoRI-digested pIJ4083 (7.6 kb) carrying the promoterless xylE reporter gene encoding catechol dioxygenase (constructions named pCoedesAP and pPildesAP, respectively) The 511-bp fragment of either S coelicolor or S pilosus showed iron-regulated promoter activity when introduced in both S coelicolor and Streptomyces lividans (Fig 5) Catechol oxygenase activity was observed only under iron-limited conditions in both strains The S pilosus desA promoter clearly showed higher expression ability than the equivalent S coelicolor promoter region when introduced in either S lividans or S coelicolor, suggesting that the S pilosus promoter is recognized more efficiently by the transcribing RNA polymerase complex Transcription start point: the )10 region overlaps the iron box Primer extension experiments with increasing S coelicolor RNA concentrations (50–150 lg RNA) using a fluorescein-labelled 17-bp oligonucleotide [18] as Binding of purified DmdR1 to the desA promoter region of S coelicolor was studied using a 511-bp PCR fragment of this region in the DNA-protein binding reaction DmdR1 showed a high affinity for the desA promoter region of both S coelicolor and S pilosus, resulting in retardation of the digoxigenin-labelled fragment which was prevented by competition with excess unlabelled probe (Fig 7) The mobility shift was clearly higher at increasing protein concentrations, giving two DNA–protein complexes of different size This is in agreement with our previous finding on the binding of two (or four) DmdR1 molecules to the iron boxes of either Corynebacterium glutamicum or S pilosus [12] Discussion Several desferrioxamines are produced by different Streptomyces species [5,6] Desferrioxamine B is used clinically for the treatment of iron overload during metabolic alterations in humans Initial work on the biosynthesis of desferrioxamine B in S pilosus indicated that the first step in the desferrioxamine biosynthesis is the decarboxylation of lysine by a lysine decarboxylase encoded by the desA gene [8,9] Lysine decarboxylases occur in different Streptomyces species and are involved in the utilization of l-lysine as a nitrogen source [20], but the DesA decarboxylase might be specific for desferrioxamine biosynthesis Unfortunately, the complete desferrioxamine gene cluster in S pilosus is not known On the basis of the ´ sequence of the S coelicolor genome, Barona-Gomez et al [14] proposed a biosynthetic pathway in which cadaverine formed by lysine decarboxylation is subsequently hydroxylated to N-hydroxycadaverine by the protein encoded by desB (Fig 1) which is later FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1115 Regulation of the desferrioxamine gene cluster S Tunca et al Fig Primer extension analysis of the transcription start (TS) point of the S coelicolor desA promoter Comparison of the reaction sequences of the promoter region (T, G, C, A) with that of the primer extension reaction product (inclined arrow) using 50, 100 and 150 lg RNA The )10 region is shown, and the transcriptional start point is indicated as +1 (bent arrow) The19-bp palindromic region, which contains the repressor-binding site, is boxed, and the ribosome-binding site is underlined The ATG is shown in bold letters The reported transcription start site of the S pilosus desA promoter is indicated by three asterisks Note the strict conservation of the 19-nucleotide iron box and the )10 sequence in both Streptomyces species acylated with succinyl-CoA (or alternative acyl-CoA esters to form succinyl-N-hydroxycadaverine), which is finally oligomerized by the action of DesD [15] A separate putative lysine decarboxylase (SCO2017) showing 38% end to end identity (53% functionally conserved residues) with DesA occurs in the S coelicolor genome We have shown in this study that the desA gene is essential for desferrioxamine biosynthesis but not for growth on lysine as the only carbon and nitrogen source, indicating that the encoded lysine decarboxylase is a dedicated enzyme committing l-lysine to the desferrioxamine pathway, as occurs with p-aminobenzoic acid synthase in the biosynthesis of candicidin [21,22] and a few other examples of ‘committing’ enzymes for secondary metabolites that have evolved as variants of enzymes involved in primary metabolism [23] All the evidence from this work indicates that the desABCD cluster is expressed as a polycistronic 1116 transcript Expression of the four genes is coordinately regulated by iron limitation, as shown by the RT-PCR analysis, and there is overlapping of the desB translation termination triplet with the ATG of desC and also of desC and desD (so-called translational coupling); moreover, there are no intergenic regions between any of the four genes Downstream of desD, we have located a putative transcriptional terminator [calculated DG )30.7 kcalỈmol)1 (128.5 kJỈmol)1)] (Fig 1B) In the four genes, there is strong overexpression, which is maximal h after iron deprivation and decreases at 24 h The coordinated regulation by iron of the expression of the entire cluster ensures simple and efficient up-regulation of desferrioxamine biosynthesis after iron limitation The two upstream genes (ORFs SCO2780 and SCO2781) have been annotated to encode proteins related to siderophore uptake and metabolism [13] (SCO database, http://streptomyces.org.uk), but there FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al A Regulation of the desferrioxamine gene cluster B Fig Binding of the DmdR1 protein to the desA promoter region of either S pilosus (left) or S coelicolor (right) at increasing protein concentrations The electrophoretic mobility-shift assays were performed as indicated in Experimental procedures Lanes and 7, control probes without protein (dashed arrow) Lanes 2–5 and 8–11 contain 1, 2, or lM DmdR1 in the binding reactions, respectively Note the formation of two DNA–protein complexes (arrows) at high protein concentrations Lanes and 12 contain lM DmdR1 with an excess of cold probe as control The DmdR1 protein was purified as described by Flores et al [12] is very little evidence for or against this claim SCO2780 encoding a putative secreted siderophore-binding lipoprotein with a conserved Fhu (Fe2+ siderophore binding) domain showed an iron-limitation response similar to that of the desABCD cluster; it was clearly induced at h and reached maximal expression at 6–8 h after iron deprivation There is no consensus iron box in the upstream region of SCO2780, and its regulation is probably mediated by a cascade mechanism, rather than by direct interaction of DmdR1 On the other hand, the viuB gene (SCO2781) was not transcribed under the conditions tested (Fig 4), and its role in iron metabolism remains obscure This putative siderophore-interacting protein is similar to the Vibrio fischeri ViuB vibriobactin utilization protein [24] Primer extension analysis of the promoter region of the desABCD cluster identified the transcription start point, which allowed us to deduce the )10 Pribnow box as TAGGCT, in good agreement with the consensus (TAgPuPuT) )10 sequence of Streptomyces species [19] It is very interesting that this )10 region is located inside the 19-nucleotide iron box identified previously [12] Therefore, binding of the iron regulator DmdR1 will interfere with RNA polymerase interaction and expression of the desferrioxamine cluster Indeed, binding of the pure DmdR1 protein to the S coelicolor desA promoter region was shown for the first time in this work As described previously, binding of DmdR1 to the iron box requires a bivalent metal (Fe2+, Mn2+, or other bivalent metals) [12], and therefore when iron is depleted, DmdR1 is unable to bind to the cognate iron box, and transcription is enhanced leading to siderophore biosynthesis It is interesting that the promoter of S pilosus desA showed higher transcription ability than the S coelicolor homologous promoter (both of 511 nucleotides, amplified with the same primers) when coupled to the reporter xylE gene in either S coelicolor or S lividans Although the )10 region of desA in both S coelicolor and S pilosus [16,17] was almost identical and in both species it is located within the iron box palindrome (Fig 6), the )35 and upstream regions are different These regions were found to be relevant for optimal expression from the desA promoter, as short promoter regions gave very poor expression of the reporter xylE gene In summary, we provide evidence that the desA gene encoding a l-lysine decarboxylase is essential for desferrioxamine biosynthesis in S coelicolor and appears to be a desferrioxamine-dedicated enzyme, in contrast with another putative lysine decarboxylase (SCO2017) that might be involved in lysine utilization [20] Expression of the desABCD cluster is coordinately regulated by iron concentrations in the culture medium, and this regulation is mediated by binding of the regulatory protein DmdR1 to the iron box located in the promoter region of the desABCD cluster Electrophoretic mobility-shift assays of the desA promoters of both S coelicolor and S pilosus revealed that two different complexes of different size are formed in each case, supporting earlier suggestions that binding takes place in the form of dimers or tetramers [12] Experimental procedures Bacterial strains, plasmids and culture conditions Bacterial strains and plasmids used in this work are listed in Table Streptomyces species were routinely grown in YEME medium [25,26] at 30 °C For siderophore production and promoter activity experiments Minimal Medium [3] was used Escherichia coli strains were grown in Luria– Bertani broth or Luria–Bertani broth supplemented with 20 mm glucose at 30 °C or 37 °C E coli BW25113 [27] was used to propagate the recombination plasmid pIJ790 and S coelicolor cosmid Stc105 [28] E coli DH5a (Stratagene, La Jolla, CA, USA) was used as a host for plasmid constructions E coli ET12567 ⁄ pUZ8002 [29] was used as the nonmethylating plasmid donor for intergeneric conjugation with S coelicolor A3(2) Ampicillin (100 lgỈmL)1), apramycin (50 lgỈmL)1), chloramphenicol (25 lgỈmL)1), and kanamycin (50 lgỈmL)1) were added to growth media when FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1117 Regulation of the desferrioxamine gene cluster S Tunca et al Table Strains and plasmids used in this study Strain ⁄ plasmid Plasmids pIJ790 pUZ8002 Stc105 pBluescript SK pRA pSKdesA pSKdesAKn pRAdesAKn pIJ4083 pCoedesAP pPildesAP E coli strains DH5a BW25113 ET12567 Streptomyces strains S coelicolor A3(2) S lividans 1326 S pilosus ATCC19797 S coelicolor M145 Relevant genotype ⁄ comments Source ⁄ reference k-RED (gam, bet, exo), cat, araC, rep101ts tra, neo, RP4 Cosmid containing the des cluster E coli vector ApR lacZ arif1 Integrative and conjugative vector derived from pSET152 Contains desA gene cloned into pBluescript SK Contains kan gene cloned into pSKdesA Contains desA and neo genes cloned into pRA High copy number promoter-probe vector carrying the promoterless xylE gene as reporter S coelicolor desA promoter cloned into pIJ4083 S pilosus desA promoter cloned into pIJ4083 Gust et al [31] Paget et al [29] Redenbach et al [28] Stratagene This work This work F– recA1, endA1, gyrA96, thi-1, hsdR17 (rK–, mK+), sup44, relA1k-, (r80 dLacZAM15), D(lacZYA-argF)U169 K12 derivative: DaraBAD, DrhaBAD dam, dcm, hsdS, cat, tet Datsenko & Wanner [27] MacNeil et al [40] Prototrophic wild-type Prototrophic wild-type Prototrophic wild-type SCP1–, SCP2– Hopwood et al [32] Hopwood et al [32] Gunter et al [16] Bentley et al [13] necessary S lividans 1326 was used as a host for Streptomyces plasmid constructions DNA methods Isolation of plasmid and bacterial chromosomal DNA, restriction enzyme digestions, agarose gel electrophoresis and Southern blot analysis were performed according to standard molecular biology techniques [30] Plasmids were transformed into E coli strains by standard chemical methods or by electroporation Electroporation-competent cells (50 or 100 lL; 109 colony-forming unitsỈmL)1) were mixed with 1–5 lL DNA solution in an ice-cold microcentrifuge tube and electroporated at 2.5 kV with 25 lF and a resistance of 200 ohms or at 2.5 kV with 10 lF and resistance of 500 ohms DNA fragments used as probes were labelled with digoxigenin using a random priming kit (DIG DNA labelling Mix; Roche Diagnostics GmbH, Penzberg, Germany) Isolation of a S coelicolor DdesA mutant Deletion of the desA gene of S coelicolor A3(2) was performed by replacing the wild-type gene with a cassette containing the apramycin resistance gene as selectable marker using a PCR-based system [31] The plasmid pIJ773 which has a disruption cassette containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC 1118 This work This work This work Kieser et al [25] Hanahan [39] CGTCGACC-3¢ and 5¢-aggccgatgcccacgaagtcgtacggggcgctggctt caTGTAGGCTGGAGCTGCTTC-3¢ as the forward and reverse primers, respectively (the sequence identical with the upstream region of the desA gene is underlined and in lowercase; the sequence identical with the downstream region of the desA gene is shown in italics and in lowercase) These two long PCR primers (59 and 58 nucleotides) were designed to produce a deletion of desA just after its start codon, leaving only its stop codon behind The 3¢ sequence of each primer matches the right or left end of the disruption cassette (the sequence is shown uppercase in both primers) The extended apramycin resistance cassette was amplified by PCR, and E coli BW25113 ⁄ pIJ790 bearing cosmid Stc105 was electro-transformed with this cassette The isolated mutant cosmid was introduced into nonmethylating E coli ET12567 containing the RP4 derivative pUZ8002; then the mutant cosmid was transferred to S coelicolor by intergeneric conjugation [32,33] Double cross-over exconjugants were screened for their kanamycin sensitivity and apramycin resistance S coelicolor DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin resistance marker was cloned into an XbaI site of the new construct (pSKdesA) A 5723-bp XhoI + NotI fragment containing the desA gene and kanamycin gene (from FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al pSKdesAKn) was cloned into the EcoRV site of pRA (5769 bp) The new construct (pRAdesAKn) having a size of 11492 bp was used to transform E coli ET12567 ⁄ pUZ8002 After conjugation with the S coelicolor desA mutant, KnR colonies were selected As complementation of the DdesA mutant was not obtained with the above construct (see Results), the mutation was complemented using the cosmid Stc105 A nonessential gene (SCO2788) downstream of the desferrioxamine gene cluster was replaced by the cassette from pIJ773 to allow RP4 oriT-assisted conjugation by the method described above to obtain the desA mutant After intergeneric conjugation between E coli ET12567 ⁄ pUZ8002 bearing the cosmid with oriT and the S coelicolor DdesA mutant, single crossover exconjugants were screened for kanamycin resistance Kanamycin-resistant colonies were isolated and analysed by HPLC for their ability to produce desferrioxamines Siderophore plate bioassays Siderophore production assays by colonies were carried out on chrome azurol S blue plates prepared by the protocol of Schwyn & Neilands [34] Regulation of the desferrioxamine gene cluster CGTT-3¢) containing cleavage sites for EcoRI and BamHI at their ends (in bold) The PCR products were extracted from gels and digested with EcoRI and BamHI The promoter fragments were introduced upstream of the xylE gene (catechol dioxygenase reporter) in the pIJ4083 vector to generate pCoedesAP and pPildesAP The correct orientation was confirmed by sequence analysis S coelicolor and S lividans cells harbouring pCoedesAP and pPildesAP were grown in ILMM [3] containing 50 lgỈmL)1 thiostrepton Then mL of the cells was withdrawn at 24, 48, 60 and 72 h and, after being washed with physiological saline, they were frozen and kept at )20 °C Crude extracts of the cells were obtained by disruption using an ultrasonicator at °C Cells were sonicated (4 · 15 s with 20 s intervals) in sample buffer [100 mm phosphate buffer (pH 7.5), 20 mm EDTA (pH 8.0), 10% (v ⁄ v) acetone] Triton X-100 was added to a final concentration of 0.1%, and the mixture was incubated for 15 on ice After clearing of the mixture by centrifugation (10 000 g, Eppendorf 5415R centrifuge; Eppendorf, Hamburg, Germany) at °C, the clear supernatant was assayed for catechol 2,3-dioxygenase activity as described by Hopwood et al [32] Primer extension analysis HPLC analysis of desferrioxamines Bacteria were grown in ILMM [3] and distributed into 500mL flasks (washed with 10% nitric acid and autoclaved) CaCl2Ỉ2H2O (0.01% final concentration) and glucose (2.5 gỈL)1 final concentration), autoclaved separately, and filter-sterilized yeast extract (0.05 gỈL)1 final concentration) were then added to the culture flasks The same medium supplemented with FeSO4Ỉ7H2O (35 lm final concentration) was used as control Cultures were grown on a rotary shaker (250 r.p.m.) at 30 °C Biomass was removed by filtration, and 50 mL culture supernatant was freeze-dried The solid residue was redissolved in ml distilled water, and, after removal of the insoluble particles by centrifugation, 10 lL m FeCl3 was added to form Tris–hydroxamate–Fe3+ complexes Insoluble particles were removed by centrifugation, and the solution was filtered through a Vivaspin concentrator before HPLC analysis HPLC separation of desferrioxamines was performed on a reverse-phase column (Nucleosil C18, lm, 4.6 by 150 mm) with 150 lL injection volume and mLỈmin)1 flow rate for 25 A solution of 0.1% aqueous formic acid ⁄ methanol was used as the solvent system The Tris–hydroxamate–Fe3+ complexes were detected at a wavelength of 435 nm RNA was isolated from a 48-h culture of S coelicolor harbouring pCoedesAP plasmid under conditions of iron limitation by the procedure of Kieser et al [25] Primer extension analysis was performed as described by Patek et al [35] and Barreiro et al [36] The fluorescein-labelled primer was hybridized to RNA in a solution containing 0.4 m NaCl, 40 mm Pipes (pH 6.4), mm EDTA (pH 8.0), and 80% formamide at 45 °C for 12 h The precipitated RNA was dissolved in 20 lL reaction mixture: lL SuperScript buffer (Invitrogen, Carlsbad, CA, USA), lL dNTP (2 mm), lL dithiothreitol (0.1 m), lL actinomycin D (500 lgỈmL)1), lL RNase inhibitor (40 U) and lL H2O After the addition of SuperScript II RT (Invitrogen), the reaction was run at 42 °C for h and stopped by heat inactivation of the enzyme RNA was removed by RNase treatment and the protected RNA–DNA sample was precipitated with ethanol Then, the sample was dissolved in lL TE buffer (10 mm Tris/HCl, mm EDTA, pH 8.0) and lL stop buffer (Thermo Sequenase Primer Cycle Sequencing Kit, Amersham Biosciences, Piscataway, NJ, USA) After heat denaturation, the sample was run in the ALFexpress DNA sequencer to identify the end of the protected fragment Determination of desA promoter activity Transcriptional analysis The desA promoter fragments of S coelicolor A3(2) and S pilosus were amplified by PCR using primers Pf (5¢-GGAATTCCGCGCGCGGGTCTGGCTTCA-3¢) and Pr (5¢-CGGGATCCCGGTACTGCTCCGCGGTGGTGT Culture conditions under iron limitation were as follows S coelicolor inoculum cultures were grown for 36 h in YEME broth [25] The cell pellet was harvested by centrifugation and washed twice with distilled water Equal FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1119 Regulation of the desferrioxamine gene cluster S Tunca et al volumes of cells were inoculated in 100 mL minimal medium [3] supplemented with an iron chelator (2,2¢-dipyridyl, 250 lm final concentration) All the needed material was washed with 10% of nitric acid and distilled water to remove iron traces For RNA extraction, 300 lL culture was added to 600 lL RNA Protect Bacteria Reagent (Qiagen, Hilden, Germany), mixed by vortex (30 s) and maintained for at room temperature The cell pellet was harvested by centrifugation (5 min, 10 000 g, Eppendorf 5415R centrifuge) Samples were frozen directly in liquid nitrogen Total RNA was extracted as described previously [37] except that the cell pellets were resuspended in 900 lL lysis solution [400 lL acid phenol, 100 lL chlorophorm:isoamyl alcohol (24 : 1), 400 lL RLT buffer (RNeasy mini kit; Qiagen)] and disrupted with a Ribolyser instrument by using the lysing matrix B (BIO 101) Subsequently, total RNA was isolated using an RNeasy mini kit DNA was removed in solution by using deoxyribonuclease I (Sigma, Haverhill, UK) and in a column using RNase-Free DNase (Qiagen) RNA concentration was calculated spectrophotometrically by determining the absorbance at 260 nm using Nanodrop apparatus (Nanodrop Technologies, Wilmington, DE, USA) The transcription patterns were analyzed by the SuperScript one-step reverse transcriptase PCR (RT-PCR) system with Platinum Taq DNA polymerase (Invitrogen), using 100 ng total RNA as the template Conditions were as follows: first-strand cDNA synthesis, incubation at 50–55 °C for 40 followed by 94 °C for min; amplification, 30 to 40 cycles of 96 °C for 30 s, 55 °C to 67 °C (depending on the set of primers used) for 30 s, and 72 °C for 30 s to 1.5 Primers (19–24-mers) (Table 2) were designed to generate PCR products between 879 and 1225 bp Negative controls were carried out for every set of primers by using Taq DNA polymerase (Promega, Madison, WI, USA) to confirm the absence of contaminating DNA in the RNA preparations Besides, specific primers for hrdB were used as controls of RNA loading amount Primer specificity was tested by comparing each sequence against the complete genome of S coelicolor by using the web site http://insilico ehu.es [38] The identity of each amplified product was corroborated by direct sequencing with one of the primers used for each amplification DmdR1 protein purification The dmdRI gene was overexpressed in E coli using the pGEX-2T expression system (Amersham Biosciences) Purification of the GST hybrid protein in glutathione–Sepharose columns was performed according to the manufacturer’s instructions After elution of glutathione S-transferase (GST)–DmdR1 fusion protein, DmdR1 protein was separated from GST by thrombin digestion and filtration through the GSTrap column Electrophoretic mobility-shift assay The desA promoter fragments were amplified by PCR using the specific primers Pf and Pr (Table 2) and purified with the PCR purification kit (GE Healthcare, Chalfont St Giles, UK) The promoter fragments were then 3¢ endlabelled with digoxigenin by using terminal transferase (Roche) according to the manufacturer’s instructions Binding reactions were carried out in a 20-lL reaction mixture containing 20 mm Tris ⁄ HCl (pH 7.5), mm MgCl2, 40 mm KCl, 100 mm MnCl2, mm dithiothreitol, 10% (v ⁄ v) glycerol, 6.25 lg BSA, lg poly(dI-dC) (GE Healthcare), purified DmdR1 protein (at concentrations ranging from to lm) and the labelled desA probe The DNA-binding reactions were initiated by the addition of DmdR1 and incubated at 30 °C for 30 Samples were immediately loaded and resolved on a prerun nondenaturing 5% polyacrylamide gel for h at 80 V in 0.5 · TBE buffer (45 mm Tris/HCl, mm EDTA, 45 mm boric acid, pH 8.0) [12] and then electroblotted on to a nylon mem- Table Oligonucleotides used in this study Oligonucleotide Sequence (5¢ ) 3¢) Use SecPr-5 SecPr-3 viuB-5 viuB-3 desA-5 desA-3 desD-5 desD-3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR PCR cloning of the desA promoter Pr O6 hrdB-5 hrdB-3 CGGGATCCCGGTACTGCTCCGCGGTGGTGTCGTT GCGATCGCTGCCACTGC GCCGCCGCGCCAAGAACCA CCAGCGGCGTGTGCAGCGAGAT 1120 Primer extension RT-PCR RT-PCR FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS S Tunca et al brane The digoxigenin-labelled probe was detected by using anti-(digoxigenin–alkaline phosphatase conjugate) and the luminogenic substrate CDPstar (Boehringer Mannheim, Mannheim, Germany) The signal was captured by exposure to X-ray film Regulation of the desferrioxamine gene cluster 11 Acknowledgements This work was supported by grants from the Funda´ ´ cion Ramon Areces (03 ⁄ 2000–02 ⁄ 2003), Madrid, Spain and the CICYT (BIO2003-01489) to JFM We thank F Flores for help with preparation of the materials, ´ F Barona-Gomez and G Challis for samples of pure desferrioxamine B and E, and B Martin and J Merino for excellent technical support 12 References 14 Crosa JH (1987) Signal transduction and transcriptional and post-transcriptional control or iron-regulated genes in bacteria Microbiol Mol Biol Rev 61, 319–336 Neilands JB (1995) Siderophores: structure and function of microbial iron-transport compounds J Biol Chem 270, 26723–26726 Muller G & Raymond KN (1984) Specificity and mechanism of ferrioxamine-mediated iron transport in Streptomyces pilosus J Bacteriol 160, 304–312 Bunet R, Brock A, Rexer UH & Takano A (2006) Identification of genes involved in siderophore transport in Streptomyces coelicolor A3 (2) FEMS Microbiol Lett 262, 57–64 ´ Imbert M, Bechet M & Blondeau R (1995) Comparison of the main siderophores produced by some species of Streptomyces Curr Microbiol 31, 129–133 Yamanaka K, Oikawa H, Ogawa HO, Hosono K, Shinmachi F, Takano H, Sakuda S, Beppu T & Ueda K (2005) Desferrioxamine E produced by Streptomyces griseus stimulates growth and development of Streptomyces tanashiensis Microbiology 151, 2899–2905 Schupp T, Waldmeier U & Divers M (1987) Biosynthesis of desferrioxamine B in Streptomyces pilosus: evidence for the involvement of lysine decarboxylase FEMS Microbiol Lett 42, 135–139 Schupp T, Toupet C & Divers M (1988) Cloning and expression of two genes of Streptomyces pilosus involved in the biosynthesis of siderophore desferroxamine B Gene 64, 179–188 Tao X & Murphy JR (1992) Binding of the metalloregulatory protein DtxR to the diphteria tox operator requires a divalent heavy metal ion and protects the palindromic sequence from DNase I digestion J Biol Chem 267, 21761–21764 10 Oguiza JA, Marcos AT, Malumbres M & Martı´ n JF (1996) The galE gene encoding the UDP-galactose 13 15 16 17 18 19 20 21 22 4-epimerase of Brevibacterium lactofermentum is coupled transcriptionally to the dmdR gene Gene 177, 103–107 Flores FJ, Barreiro C, Coque JJR & Martı´ n JF (2005) Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 Streptomyces coelicolor and proteome changes in deletion mutants FEBS J 272, 725–735 Flores FJ & Martı´ n JF (2004) Iron-regulatory proteins DmdR1 and DmdR2 of Streptomyces coelicolor form two different DNA–protein complexes with iron boxes Biochem J 379, 1–7 Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis GL, Thomson NR, James KD, Harris DE, Quail MA, Kieser H, Harper D et al (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3 (2) Nature 417, 141–147 ´ Barona-Gomez F, Wong U, Giannakopulos AE, Derrick PJ & Challis GL (2004) Identification of a cluster of genes that directs desferrioxamine biosynthesis in Streptomyces coelicolor M145 J Am Chem Soc 126, 16282–16283 Challis G (2005) A widely distributed bacterial pathway for siderophore biosynthesis independent of nonribosomal peptide synthetases Chembiochem 6, 601–611 Gunter K, Toupet C & Schupp T (1993) Characterizaă tion of an iron-regulated promoter involved in desferrioxamine B synthesis in Streptomyces pilosus: repressor-binding site and homology to the diphtheria toxin gene promoter J Bacteriol 175, 3295–3302 ´ Flores FJ, Rincon J & Martı´ n JF (2003) Characterization of the iron-regulated desA promoter of Streptomyces pilosus as a system for controlled gene expression in actinomycetes Microb Cell Fact 2, Sola-Landa A, Rodrı´ guez-Garcı´ a A, Franco-Domı´ nguez E & Martı´ n JF (2005) Binding of PhoP to promoters of phosphate regulated genes in Streptomyces coelicolor: identification of PHO boxes Mol Microbiol 56, 1373–1385 Strohl WR (1992) Compilation and analysis of DNA sequences associated with apparent streptomycete promoters Nucleic Acids Res 20, 961–974 Madduri K, Stuttard C & Vining LC (1989) Lysine catabolism in Streptomyces spp is primarily through cadaverine: beta-lactam producers also make alphaaminoadipate J Bacteriol 171, 299–302 Gil JA & Hopwood DA (1983) Cloning and expression of a p-aminobenzoic acid synthetase gene of the candicidin producer, Streptomyces griseus Gene 25, 119–132 Martı´ n JF & Gil JA (1984) Cloning and expression of antibiotic production genes Bio ⁄ Technology 2, 63–72 FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS 1121 Regulation of the desferrioxamine gene cluster S Tunca et al ´ 23 Martı´ n JF, Gutierrez S & Aparicio JF (2000) Secondary metabolites In Encyclopedia of Microbiology, Vol 4, 2nd edn (Lederberg, J, ed.), pp 213–236 Academic Press, San Diego, CA 24 Butterton JR & Calderwood SB (1994) Identification, cloning, and sequencing of a gene required for ferric vibriobactin utilization by Vibrio cholerae J Bacteriol 176, 5631–5638 25 Kieser T, Bibb MJ, Buttner MJ, Chater KF & Hopwood DA (2000) Practical Streptomyces Genetics John Innes Foundation, Norwich 26 Recio E, Aparicio JF, Rumbero A & Martı´ n JF (2006) Glycerol, ethylene glycol and propanediol elicit pimaricin biosynthesis in the PI-factor-defective strain Streptomyces natalensis npi287 and increase polyene production in several wild-type actinomycetes Microbiology 152, 3147–3156 27 Datsenko KA & Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products Proc Natl Acad Sci USA 97, 6640–6645 28 Redenbach M, Kieser HM, Denapaite D, Eichner A, Cullum J, Kinashi H & Hopwood DA (1996) A set of ordered cosmids and a detailed genetic and physical map for the Mb Streptomyces coelicolor A3 (2) chromosome Mol Microbiol 21, 77–96 29 Paget MS, Chamberlin L, Atrih A, Foster SJ & Buttner MJ (1999) Evidence that the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in Streptomyces coelicolor A3 (2) J Bacteriol 181, 204–211 30 Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 31 Gust B, Challis GL, Fowler K, Kieser T & Chater KF (2003) PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin Proc Natl Acad Sci USA 100, 1541–1546 1122 32 Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser HM, Lydiate DJ, Smith DP, Ward JM & Schrempf H (1985) Genetic Manipulation of Streptomyces: A Laboratory Manual John Innes Foundation, Norwich ´ 33 Enrı´ quez L, Mendes MV, Anton N, Tunca S, Guerra SM, Martı´ n JF & Aparicio JF (2006) An efficient gene transfer system for the pimaricin producer Streptomyces natalensis FEMS Microbiol Lett 257, 312–318 34 Schwyn B & Neilands JB (1987) Universal chemical assay for the detection and determination of siderophores Anal Biochem 160, 47–56 35 Patek M, Eikmanns BJ, Patek J & Sahm H (1996) Promoters from Corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif Microbiology 142, 1297–1309 ´ 36 Barreiro C, Gonzalez-Lavado E, Brand S, Tauch A & Martı´ n JF (2005) Heat shock proteome analysis of wild-type Corynebacterium glutamicum ATCC 13032 and a spontaneous mutant lacking GroEL1, a dispensable chaperone J Bacteriol 187, 884–889 37 Huser AT, Chassagnole C, Lindley ND, Merkamm M, ă Guyonvarch A, Elisakova V, Patek M, Kalinowski J, Brune I, Puhler A & Tauch A (2005) Rational design of a Corynebacterium glutamicum pantothenate production strain and its characterization by metabolic flux analysis and genome-wide transcriptional profiling Appl Environ Microbiol 71, 3255–3268 ´ 38 Bikandi J, San Millan R, Rementeria A & Garaizar J (2004) In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction Bioinformatics 20, 798–799 39 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids J Mol Biol 166, 557–580 40 MacNeil DJ, Gewain KM, Ruby CL, Dezeny G, Gibbons PH & MacNeil T (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector Gene 111, 61–68 FEBS Journal 274 (2007) 1110–1122 ª 2007 The Authors Journal compilation ª 2007 FEBS ... explaining the regulation of desA expression by binding of DmdR1 to the iron box The same overlapping was found in S pilosus DmdR1 binds to the promoter region of desABCD in both S coelicolor and... regulation is mediated by binding of the regulatory protein DmdR1 to the iron box located in the promoter region of the desABCD cluster Electrophoretic mobility-shift assays of the desA promoters of. .. that iron control of the Regulation of the desferrioxamine gene cluster expression of the des cluster is mediated by the DmdR1 regulator Results Deletion of the desA gene of S coelicolor blocks desferrioxamine