Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana Julia P. Vainonen 1 , Yumiko Sakuragi 2 , Simon Stael 1 , Mikko Tikkanen 1 , Yagut Allahverdiyeva 1 , Virpi Paakkarinen 1 , Eveliina Aro 1 , Marjaana Suorsa 1 , Henrik V. Scheller 2 , Alexander V. Vener 3 and Eva-Mari Aro 1 1 Department of Biology, Plant Physiology and Molecular Biology, University of Turku, Finland 2 Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, Denmark 3 Department of Clinical and Experimental Medicine, Faculty of Health Sciences, Linko ¨ ping University, Sweden Protein phosphorylation is one of the key mechanisms used by all domains of life for regulation of cellular processes, from gene expression to metabolic control. In plants, protein phosphorylation plays crucial roles during acclimation of the photosynthetic apparatus to changing environmental cues [1]. Light- and redox- dependent protein phosphorylation is particularly important for regulation of photosynthetic protein complexes located in the thylakoid membranes of chlo- roplasts. Four major protein complexes are involved in photosynthetic light reactions: photosystem I (PSI), photosystem II (PSII), cytochrome b 6 f complex, and ATP synthase. The major phosphoproteins in the thy- lakoid membrane belong to PSII and its light-harvest- ing antenna II. The application of MS combined with affinity chromatography for phosphopeptide enrich- ment has allowed identification of the major phospho- proteins of PSII (D1, D2, CP43 and PsbH proteins) and light-harvesting antenna II [Lhcb1, Lhcb2 and the minor CP29 (Lhcb4) proteins] [2–4]. Phosphorylation of PSII core proteins is believed to play an important role in the repair cycle of the reaction center pro- tein D1 and the assembly of PSII [5,6]. Reversible phosphorylation of light-harvesting antenna II proteins regulates state transitions, i.e. the mechanism that ensures a balanced excitation of PSI and PSII in changing environmental and metabolic conditions [7– 11]. Two phosphorylated proteins have also been iden- tified in PSI, but the biological significance of their phosphorylation still remains to be elucidated [4,12]. Keywords high light; protein phosphorylation; STN8 kinase; stress response; thylakoid membrane Correspondence E M. Aro, Department of Biology, Plant Physiology and Molecular Biology, University of Turku, FI-20014 Turku, Finland Fax: +358 2 333 5549 Tel: +358 2 333 5931 E-mail: evaaro@utu.fi (Received 18 December 2007, revised 7 February 2008, accepted 13 February 2008) doi:10.1111/j.1742-4658.2008.06335.x Exposure of Arabidopsis thaliana plants to high levels of light revealed specific phosphorylation of a 40 kDa protein in photosynthetic thylakoid membranes. The protein was identified by MS as extracellular calcium- sensing receptor (CaS), previously reported to be located in the plasma membrane. By confocal laser scanning microscopy and subcellular fraction- ation, it was demonstrated that CaS localizes to the chloroplasts and is enriched in stroma thylakoids. The phosphorylation level of CaS responded strongly to light intensity. The light-dependent thylakoid protein kinase STN8 is required for CaS phosphorylation. The phosphorylation site was mapped to the stroma-exposed Thr380, located in a motif for interaction with 14-3-3 proteins and proteins with forkhead-associated domains, which suggests the involvement of CaS in stress responses and signaling path- ways. The knockout Arabidopsis lines revealed a significant role for CaS in plant growth and development. Abbreviations ACN, acetonitrile; CaS, calcium-sensing receptor; FHA, forkhead-associated; F m , maximal fluorescence; FOX1, plasma membrane-specific ferroxidase; F v , variable fluorescence; GFP, green fluorescent protein; IMAC, immobilized metal affinity chromatography; LC, liquid chromatography; P-CaS, phosphorylated form of calcium-sensing receptor; PSI, photosystem I; PSII, photosystem II; YFP, yellow fluorescent protein. FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1767 Likewise, two cytochrome b 6 f complex subunits undergo reversible phosphorylation: subunit IV, revealed by radioactive labeling [13], and Rieske Fe–S protein, which undergoes N-terminal phosphorylation, identified by MS [14]. Furthermore, a recent study has shown that a thylakoid membrane-associated protein, TSP9, is phosphorylated at multiple sites in response to increasing light intensity, and it is thought to play a role in plant stress acclimation and signal transduction [15]. A specific feature of environmentally induced thyla- koid protein phosphorylation is an almost exclusive phosphorylation of Thr residues in the proteins of both plant and green algal photosynthetic membranes [1,16]. The use of reverse genetics has allowed identifi- cation of two light-dependent protein kinases involved in phosphorylation of thylakoid proteins. STN7 pro- tein kinase is essential for phosphorylation of Lhcb1, Lhcb2 and Lhcb4 proteins [11,17] and, thus, for state transitions. The homologous STN8 protein kinase is involved in the phosphorylation of PSII core proteins and is absolutely essential for phosphorylation of PsbH protein of PSII at Thr4 [18,19]. Here we report the identification of a novel phos- phoprotein, calcium-sensing receptor (CaS), from thy- lakoid membranes of Arabidopsis. The protein was previously named CaS and characterized as an extra- cellular calcium-sensing receptor localized in plasma membrane [20,21]. Both biochemical and immunolocal- ization studies, however, provide strong evidence that CaS is a chloroplast protein localized in the thylakoid membrane and not detectable in the plasma mem- brane. It is shown that the CaS protein level as well as its phosphorylation level increase in response to increasing light intensities. The phosphorylation site is mapped to Thr380, and is shown to be dependent on the STN8 protein kinase. Insertional mutagenesis of CaS resulted in reduced growth, indicating a significant role for CaS protein in plant growth and development. Results Identification of CaS as a thylakoid 40 kDa phosphoprotein In order to investigate the molecular mechanisms involved in acclimation of plant photosynthetic machinery to high light intensities, we isolated thyla- koid membranes from the leaves of Arabidopsis and analyzed the light-induced changes in protein phos- phorylation by immunoblotting with phosphothreo- nine-specific antibody (Fig. 1A). This analysis revealed the phosphorylation of a novel polypeptide with a molecular mass of about 40 kDa whose level of phos- phorylation strongly increased with rising irradiance. To identify this 40 kDa phosphoprotein, thylakoids isolated from leaves exposed to high-light treatment were subjected to trypsin shaving [3,4]. The surface- exposed domains of membrane proteins were released and separated from the membranes by centrifugation. The resulting complex mixture of hydrophilic peptides was subjected to immobilized metal affinity chroma- A C B Fig. 1. Identification of CaS as a 40 kDa thylakoid phosphoprotein and its regulation by light in thylakoids. (A) Thylakoids were isolated from dark-adapted (D) leaves or leaves exposed for 3 h to low (30 lmol photonÆm )2 Æs )1 ) (LL), growth (100 lmol photonÆm )2 Æs )1 ) (GL) or high (600 lmol photonÆm )2 Æs )1 ) (HL) light, and proteins were separated by SDS ⁄ PAGE and immunoblotted with phosphothreonine-specific anti- body. Chlorophyll (0.75 lg) was loaded in each well. Well-known thylakoid phosphoproteins are marked, and the position of the 40 kDa phos- phoprotein is indicated by an arrow. (B) The product ion spectrum of the doubly charged peptide ion with m ⁄ z 573.8 obtained by ESI and collision-induced fragmentation. The parent ion is labeled in the spectrum along with the fragment ion at m ⁄ z 524.8 produced after the char- acteristic neutral loss of phosphoric acid. The detected b-ions (N-terminal) and y-ions (C-terminal) are indicated in the spectrum as well as in the corresponding amino acid sequence. The ions marked with an asterisk indicate that the fragments underwent neutral loss of 98 Da (H 3 PO 4 ). The lower-case ‘t’ indicates a phosphorylated Thr residue. (C) Immunoblot with CaS-specific antibody [for experimental settings, see (A)]. CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al. 1768 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS tography (IMAC) [19] for phosphopeptide enrichment. The enriched phosphopeptides were analyzed by liquid chromatography (LC)-MS ⁄ MS. Besides several known phosphopeptides of the thyla- koid membranes (supplementary Table S1), the analysis of data allowed the identification of a novel, previously uncharacterized phosphopeptide. The product ion spec- trum of the corresponding doubly charged molecular ion with m ⁄ z 573.8 is presented in Fig. 1B. The series of b- and y-ions revealed the peptide sequence SGtKFLPSSD, with lowercase ‘t’ indicating phoshory- lated Thr. A search in the Arabidopsis protein sequence database revealed that the amino acid sequence belongs to the C-terminus of the expressed protein At5g23060 with deduced molecular mass 41.3 kDa, previously described as an extracellular CaS [20]. In a parallel approach, the gel region corresponding to the 40 kDa phosphoprotein band in the gel (Fig. 1A) was cut out and subjected to in-gel digestion for protein identification by LC-MS ⁄ MS. CaS, together with 14 other proteins, was identified from this gel band (supplementary Table S2). CaS-specific antibody was then used to determine whether the increased occurrence of phosphorylated CaS under high-light conditions (Fig. 1A) was related to an increase in the amount of CaS per se. As shown in Fig. 1C, the total amount of CaS protein was not drasti- cally changed by increasing irradiance, but the phos- phorylated form of CaS (P-CaS) clearly accumulated under high-light conditions as compared to darkness. Chloroplast localization of CaS Localization of the CaS phosphoprotein to the thyla- koid membrane, as discussed above, is in good agree- ment with proteomics studies [22–24], but strongly contrasts with a previous report of the plasma mem- brane localization of CaS, using heterologous expres- sion in onion epidermis cells, which unfortunately lack chloroplasts [20]. To address this apparent discrepancy, the subcellular localization of the endogenous CaS in Arabidopsis was investigated by exploiting purified membrane fractions and immunoblotting with purified CaS-specific antibody. CaS was not found in purified plasma membrane, whereas it was present in intact chloroplasts and in the thylakoid fraction but not in the stroma fraction (Fig. 2A). The purity of the mem- brane fractions was demonstrated by using plasma membrane-specific ferroxidase (FOX1) and thylakoid membrane-specific D1 antibodies as specific markers (Fig. 2A). To further dissect the distribution of CaS in the thy- lakoid membrane, the thylakoids isolated from leaves exposed to high light were fractionated by digitonin [6]. Immunoblot analysis of thylakoid fractions revealed the presence of CaS both in grana and in stroma thylakoids, and its clear enrichment in the stroma-exposed membranes (Fig. 2B). To further investigate the contradiction between our data and published reports showing the targeting of fluorescent-labeled CaS to the plasma membrane [20,21], we fused the yellow fluorescent protein (YFP) recombinantly to the C-terminus of CaS and tran- siently expressed this construct in Nicotiana benthami- ana leaves. Observations by confocal laser scanning microscopy clearly demonstrated that the CaS–YFP fusion protein localized in chloroplasts (Fig. 3A–C). In stark contrast, the cytosolic YFP control accumulated YFP fluorescence signal in the cell periphery and nuclei (supplementary Fig. S1). These data clearly demonstrate that CaS predominantly resides in chlo- roplasts. Coexpression of CaS–YFP and GWD1tp– green fluorescent protein (GFP), a chloroplast-targeted protein used as a marker, showed perfect overlap of the YFP and GFP signals (Fig. 3D–F), and no signal was detected in the cell periphery. Coexpression of CAS–YFP and the cytosolic GFP further illustrated the exclusive localization of CAS–YFP in chloroplasts (supplementary Fig. S2). Requirement of STN8 kinase for CaS phosphorylation To address the question of whether one of the two light-regulated protein kinases, STN7 or STN8, is required for the light-dependent phosphorylation of A PM CaS CaS FOX1 D1 Chl Th Th ST GT S B Fig. 2. Localization of CaS to chloroplasts. (A) Plasma membrane (PM), intact chloroplasts (Chl), thylakoids (Th) and soluble stroma (S) were isolated from wild-type Arabidopsis, and proteins were sepa- rated by SDS ⁄ PAGE and immunoblotted with CaS-, D1- and FOX1- specific antibodies. Five micrograms (D1) or 10 lg (CaS and FOX1) of protein was loaded in each well. (B) The thylakoids (Th) isolated from leaves exposed to high light were fractionated to stroma- exposed (ST) and grana-exosed (GT) membranes. The fractions were separated by SDS ⁄ PAGE and immunoblotted with CaS-specific anti- body. One microgram of chlorophyll was loaded in each well. J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1769 CaS, we isolated thylakoids from the high-light-treated leaves of wild-type plants and two mutant lines lacking STN7 or STN8 (stn7 and stn8, respectively). Immuno- blot analysis of isolated thylakoids with phosphothreo- nine-specific antibody revealed the absence of the 40 kDa CaS phosphorylation in the stn8 mutant (Fig. 4A). Analysis of the same fractions with CaS- specific antibody revealed similar levels of CaS in all samples. The migration of CaS in SDS ⁄ PAGE of thylakoid proteins isolated from the stn8 mutant was slightly faster than those of the wild-type and the stn7 mutant (Fig. 4B), which is typically observed when protein phosphorylation is altered (see also Fig. 1A). These data suggest that CaS is almost fully phosphory- lated under high-light conditions, as the upper band corresponding to the phosphorylated form dominated under high-light conditions in the wild-type (Figs 1A and 4B) and the stn7 mutant (Fig. 4B). The involvement of STN8 in the phosphorylation of CaS was further investigated by isolation of phospho- peptides from the wild-type and the stn7 and stn8 thylakoids, and analyzing them by LC-MS ⁄ MS. The mapping of phosphopeptides isolated from stn8 thylak- oids in comparison to the wild-type and stn7 showed the specific absence of the CaS-originated phosphopeptide SGtKFLPSSD with m ⁄ z 573.8 2+ from the thylakoids of only the stn8 mutant. These results revealed that CaS in stn8 is not phosphorylated at Thr380, and suggest either that CaS is a direct target of the STN8 protein kinase or STN8 is a crucial component of the protein phosphory- lation cascade involved in CaS phosphorylation. Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-DNA insertion in the intron region of the CaS gene were obtained from GABI-Kat and SALK collections. Knockout plants were identified by immunoblot analysis of isolated thy- lakoids with CaS-specific antibody, and the D1-specific antibody was used as a control for equal protein loading (Fig. 5A). The specific absence of the 40 kDa phosphoprotein band in thylakoids isolated from knockout plants (Fig. 5B) provides definite evidence ABC DEF Fig. 3. Chloroplast localization of CaS–YFP in N. benthamiana. (A–C) A leaf section expressing CaS–YFP. (A) YFP fluorescence (excitation 514 nm; emission 545–600 nm). (B) Chloroplast autofluorescence (emission 650–707 nm). (C) Overlay image of (A) and (B). (D–F) A leaf section coexpressing CaS–YFP and GWD1tp–GFP. (D) YFP fluorescence (excitation 514 nm; emission 545–600 nm). (E) GFP fluorescence (excitation 488 nm; emission 495–510 nm). (F) Overlay image of (D) and (E). A B Fig. 4. CaS is a substrate for STN8 protein kinase. Thylakoids were isolated from leaves exposed to high light of wild-type (WT) and mutant plants lacking either STN7 (stn7) or STN8 (stn8). The pro- teins were separated by SDS ⁄ PAGE and immunoblotted with (A) phosphothreonine or (B) CaS-specific antibody. The positions of thylakoid phosphoproteins are indicated. (A) 0.75 lg Chlorophyll was loaded in each well. (B) one microgram of chlorophyll was loaded in each well. CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al. 1770 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS that this band represents CaS. To verify the lack of CaS transcripts in the mutant plants, RT-PCR analysis of mRNA from the mutant and wild-type plants was performed (Fig. 5C). The CaS knockout plants showed retarded growth even under normal unstressed condi- tions (Fig. 5D), indicating its important role in plant growth. To obtain further insights into the mechanisms responsible for the observed phenotype, we analyzed the photochemical efficiency of PSII by fluorescence measurements and the susceptibility of the CaS mutant to photoinhibition of PSII. However, no difference in the decrease of the variable fluorescence ⁄ maximal fluo- rescence (F v ⁄ F m ) ratio during high light illumination (1500 lmol photonÆm )2 Æs )1 for 3 h) or during subse- quent recovery at low light (30 lmol photonÆm )2 Æs )1 for another 3 h) was observed between the wild-type and the CaS mutant at any time point (supplementary Fig. S3). The whole chain electron transfer activities were also unaffected in the CaS mutant as compared to the wild-type (supplementary Table S3). As CaS is an intrinsic thylakoid protein, we then tested whether the absence of CaS exerts any effects on the composition of the thylakoid protein complexes. To this end, an immu- noblot analysis was performed on the contents of repre- sentative proteins in different thylakoid protein complexes, including the PSI and PSII core complexes, ATP synthase, and the lumenal oxygen-evolving complex. This analysis revealed no significant changes in PSII, PSI and ATP synthase in the CaS mutant as compared to the wild-type (supplementary Fig. S4). Sequence analysis and domain structure The network-based tools targetp and chlorop (http://www.cbs.dtu.dk) strongly predict the CaS pro- tein to be targeted to chloroplasts, with the transit pep- tide corresponding to residues 1–33 (Fig. 6A), which gives a molecular mass of 37.8 kDa for the mature pro- tein. This calculated mass is in accordance with the MS identification of CaS in a gel region around 40 kDa, together with CYP38, FNR and several other known proteins (supplementary Table S2). The C-terminus contains two motifs: a noncatalytic rhodanese homol- ogy domain (amino acids 231–352), with the putative active residue Cys309 substituted by Asp, and a motif that is involved in interaction with 14-3-3 proteins and proteins with the ‘forkhead-associated’ (FHA) domain. These domains are found in a variety of signaling pro- teins, and can bind directly to the phosphothreonine residue [25]. The identified phosphorylation site, Thr380, of CaS lies within this motif (Fig. 6A). CaS appears to be a plant-specific protein. It has homologs in Oryza sativa (gi:41352315) and Medica- go truncatula (gi:92878521), as well as in the green algae Chlamydomonas reinhardtii (gi:46093489) and A B C D Fig. 5. Phenotype revealed by the CaS knockout plants. Immunoblot analyses of thylakoids isolated from wild-type and CaS knockout plants using CaS-specific, D1-specific (A) or phosphothreonine-specific (B) antibody. (C) Ethidium bromide-stained gel with RT-PCR products show- ing no cas transcript in CaS knockout mutant lines and the presence of 18S rRNA in both mutant lines and the wild-type. (D) Retarded growth revealed by CaS knockout plants 3 weeks (upper panel) and 5 weeks (lower panel) after sowing the seeds. J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1771 Ostreococcus tauri (gi:116059237) (Fig. 6B). No pro- teins with significant sequence similarity to CaS were found in cyanobacteria. According to hydropathy analysis (tmhmm at http://www.cbs.dtu.dk and sosui at http://www.bp.nuap.nagoya-u.ac.jp), CaS in higher plants has one transmembrane helix (amino acids 188– 210 in Arabidopsis), whereas the green algae proteins do not contain any transmembrane region. Alignment of protein sequences with clustalw (Fig. 6B) showed that phosphorylated Thr380 is conserved in homolo- gous proteins of green algae. Discussion CaS – a novel thylakoid phosphoprotein and a potential substrate of the STN8 protein kinase The CaS protein (At5g23060) described here is a newly identified phosphoprotein in the thylakoid membrane of Arabidopsis, with its expression and phosphoryla- tion level being strongly dependent on light intensity. Studies of CaS (At5g23060) localization performed in onion epidermis using transient expression of a CaS–GFP fusion protein indicated the plasma mem- brane as the site of CaS localization [20]. However, the onion epidermis cells lack chloroplasts, and there- fore the plasma membrane localization is inconclu- sive. Similarly, the use of human embryonic kidney cells for localization of CaS to the plasma membrane is questionable [21], as CaS is a plant-specific protein. To resolve the differences between those results and the present CaS localization to thylakoids, we per- formed immunoblot analysis of purified Arabidopsis plasma membrane with CaS-specific antibody, which clearly showed the absence of CaS in the plasma membrane (Fig. 2A). Neither was CaS found in the proteome study of Arabidopsis plasma membrane [26], whereas the respective studies with Arabidopsis thy- lakoids and mitochondria revealed the presence of CaS [22–24,27]. Moreover, we constructed the C-ter- minal YFP fusion of CaS and tested its subcellular localization in N. benthamiana. The overlap of CaS– YFP signal with chloroplast autofluorescence and the chloroplast-targeted control GWD1tp–GFP confirm chloroplast as the primary destination of CaS (Fig. 3). A B Fig. 6. Domain structure and homologous proteins of CaS. (A) Schematic representation of the domain structure of CaS. Polypeptide mod- ules are indicated as follows: TP, chloroplast transit peptide; TM, transmembrane region; rhodanese-like, rhodanese homology domain; 14-3- 3, motif for interaction with 14-3-3 proteins; FHA1, motif for interaction with forkhead-associated domain 1. The phosphorylated Thr380 is indicated by pThr. (B) Alignment of Arabidopsis CaS with the amino acid sequences of putative homologous proteins from higher plants and green algae. The lowercase ‘t’ above the sequence indicates phosphorylated Thr380. The predicted transmembrane domain is marked by a dashed line above the sequence. CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al. 1772 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS Further subfractionation of thylakoids isolated from leaves exposed to high light and probing of these frac- tions with CaS-specific antibody showed that the majority of CaS protein is localized to the stromal thy- lakoids (Fig. 2B). Evidence for CaS phosphorylation is provided by the mapping of the exact phoshorylation site, which corre- sponds to Thr380 in the C-terminus of the protein. Making use of two chloroplast protein kinase mutants of STN7 and STN8, it was possible to assign CaS as a likely substrate of the chloroplast-targeted STN8 pro- tein kinase (Fig. 4A). As STN8 protein kinase phospho- rylates stroma-exposed Thr residues of PSII core proteins [18,19], the C-terminus of CaS is most likely oriented to the stroma, where it can be involved in signal propagation from chloroplasts to other cellular com- partments. STN8 kinase is selective for phosphorylation of easily accessible residues, such as N-terminal threo- nines of D1, D2, and CP43; this might be explained by long loops limiting access to the active site in the cata- lytic domain of STN8 [19]. The phosphorylation of CaS at the easily accessible C-terminus is in accordance with this selectivity of the STN8. CaS is regulated at multiple levels according to environmental cues The transcript level of CaS is significantly upregulated under normal growth irradiance as compared to dark- ness and low-light conditions [28]. Our results demon- strate that the high-light treatment increases the phosphorylation level of CaS, whereas the amount of the protein remains at the growth light level. Thus, CaS expression, and possibly its function, is tightly regulated by light at two levels: transcription, and post-translational modification by phosphorylation. Physiological functions of CaS CaS knockout mutants show clearly reduced growth as compared to the wild-type. As CaS is a thylakoid pro- tein, it was first assumed that it possibly regulates the accumulation or stability of some thylakoid protein complexes. This, however, was not the case, as the contents of representative proteins in the four thyla- koid protein complexes were not modified in CaS knockout mutants. Also, the light sensitivity of PSII, which is regulated by a number of thylakoid proteins [29], was unaffected in CaS knockout mutants. There- fore, the functional roles for CaS and its phosphoryla- tion under stress conditions are more likely to be found in signaling cascades that coordinate the growth and responses of plants to environmental cues. The main location of CaS in stroma-exposed thylakoid regions is in line with its possible signaling function. The stroma-exposed C-terminal part of CaS has a rhodanese-like protein domain (Fig. 6A). This domain, lacking the catalytic residues in some cases, is found in a wide variety of functionally distinct proteins in fre- quent association with other domain structures known to be involved in signal transduction [30], suggesting that CaS might play a role in sensing and signaling of environmental cues. It has been demonstrated that rhodanese domain proteins are associated with specific stress conditions, including the process of leaf senes- cence in Arabidopsis [31]. The C-terminus of CaS contains also a motif for interaction with 14-3-3 proteins and FHA domains, according to eukaryotic linear motif prediction at http://www.expasy.org. 14-3-3 proteins are known to function as adaptors that mediate protein–protein inter- actions and to be involved in signal transduction and stress responses and also in protein import into chloroplasts [32]. FHA domain proteins are directly involved in signal transduction, and the interaction between the FHA domain and target proteins is strictly dependent on phosphorylation of Thr residues of the target proteins [25,33]. The identified phosphorylation site of CaS at Thr380 is located within these predicted motifs, and its phosphorylation is intricately regulated by environmental cues. Although direct experimental evidence for such protein–protein interactions is still lacking, these structural features suggest a potential role of CaS protein in a signal transduction cascade sensing light or redox changes in chloroplasts and propagating the signal via direct protein–protein interactions. Experimental procedures Plant material and growth conditions Arabidopsis ecotype Columbia (Col-0) was used for all other experiments except for the transient expression, which was carried out in tobacco. Plants were grown in a phyto- tron under the following conditions: 100 lmol pho- tonsÆm )2 Æs )1 light intensity, 8 h photoperiod, 23 °C, and relative humidity 70%. The T-DNA insertion lines of the stn7 gene (At1g68830) (SALK 073254) and the stn8 gene (At5g01920) (SALK 060869 and SALK 064913) in the Columbia back- ground were obtained from the Salk Institute [34]. Plants homozygous for the T-DNA insertion were identified on the basis of PCR analysis [11,19]. The T-DNA insertion lines of the cas gene (At5g23060) (665G12 and SALK 070416) in the Columbia background were obtained from GABI-Kat [35] and Salk Institute J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1773 collections [34]. CaS knockout plants were identified using purified CaS-specific antibody (see below). Extraction of RNA and RT-PCR analysis Total RNA of frozen leaf tissues was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA). After RNase-free DNase treatment, 1 lg of total RNA was used to synthesize cDNA using SuperScript III reverse transcriptase (Invitrogen) in a 40 lL reaction volume. Four microliters (1 ⁄ 10) of RT prod- uct was used for PCR amplification with CaS-specific and 18S RNA control primers. The forward and reverse primers, respectively, for the 18S RNA were 5¢-CTGCCAGTAGT CATATGCTTGTC-3¢ and 5¢-GTGTAGCGCGCGTGCG GCCC-3¢. The forward and reverse primers, respectively, for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢. Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as previously described [36]. Intact chloroplasts were iso- lated from mature Arabidopsis leaves using a two-step Per- coll gradient [37]. The stroma fraction was obtained after chloroplast lysis in buffer and centrifugation at 15 000 g. Thylakoid membranes were isolated as described previously [38], including protease inhibitor cocktail (Complete; Roche, Mannheim, Germany). Thylakoids were subfrac- tionated into grana, margin and stroma lamellae by using the digitonin method as previously described [6]. SDS ⁄ PAGE and immunoblotting The proteins were separated by SDS ⁄ PAGE with 6 m urea and transferred to an Immobilon poly(vinylidene difluoride) membrane (Millipore, Bedford, MA, USA). The membranes were blocked with 5% (w ⁄ v) milk or BSA, and incubated with protein or phosphothreonine-specific antibody (poly- clonal; New England Biolabs, Beverly, MA, USA). The amount of chloroplasts loaded in gels was tested for each antibody to give a linear response, and was varied between 0.5 and 5 lg of chloroplasts, depending on the antibody. The MicroLink Protein Coupling kit (Pierce, Rockford, IL, USA) was used for purification of CaS-specific antibody, raised against the full-length protein, kindly provided by Z. M. Pei (Duke University, Durham, NC, USA). Phosphopeptide isolation Isolated thylakoids were resuspended in 25 mm NH 4 HCO 3 and 10 mm NaF to a final concentration of 3 mg of chloroplastsÆmL )1 and incubated with MS-grade trypsin (Promega, Madison, WI, USA) (5 lg enzyme ⁄ mg chloro- plasts) for 3 h at 22 °C. The digestion products were frozen, thawed, and centrifuged at 15 000 g. The supernatant was collected, and the membranes were resuspended in water and centrifuged again. The supernatants, both containing released thylakoid peptides, were pooled and centrifuged at 100 000 g for 20 min. The peptides were then lyophilized and methyl-esterified with 2 m methanolic HCl [39]. Phos- phopeptides were enriched by IMAC as previously described [19], with modifications. The sample was first loaded on the IMAC column in 0.3% acetic acid in water; unbound peptides were lyophilized again, and loaded on the IMAC column in H 2 O ⁄ acetonitrile (ACN) ⁄ MeOH (1 : 1 : 1). Phos- phopeptides were eluted with 4 · 10 lLof20mm Na 2 HPO 4 with 20% ACN, and desalted using POROS R3 (PerSeptive Biosystems, Framingham, MA, USA). LC-MS/MS In-gel trypsin digestion was performed as previously described [40]. Tandem MS was performed on an API QSTAR (Applied Biosystems, Foster City, CA, USA) equipped with a nanoelectrospray source (MDS Protana, Odense, Denmark) and connected in-line with the nano- HPLC system (LC Packings, Amsterdam, the Netherlands). Eluted and dried peptide samples were dissolved in 9 lLof 2% formic acid, centrifuged for 10 min at 12 000 g, and transferred to an autosampler vial. Aliquots (8 lL) of sam- ples were loaded onto a C18 PepMap, 5 lm, 1 mm · 300 lm internal diameter nano-precolumn (LC Packing), desalted for 1.5 min, and subjected to reverse-phase chromatography on a C18 PepMap, 3 lm, 15 cm · 75 lm internal diameter nanoscale LC column (LC Packing). A gradient of 5–50% ACN in 0.1% formic acid was applied for 50 min with the flow rate of 0.2 lLÆmin )1 . The acquisition of MS ⁄ MS data was performed on-line using the fully automated IDA fea- ture of the analyst qs software (Applied Biosystems). The acquisition parameters were 1 s for TOF MS survey scans and 2–3 s for the product ion scans of two most intensive doubly or triply charged peptides. The major trypsin pep- tides were excluded from MS ⁄ MS acquisition. Analyses of MS ⁄ MS data were performed with the analyst qs software, and this was followed by protein identification by mascot with search parameters allowing for carbamidomethylation of Cys, one miscleavage of trypsin, oxidation of Met, and 200 p.p.m. mass accuracy. mascot search parameters in the case of phosphopeptide analysis allowed one miscleavage of trypsin, methylation of the C-terminus, Asp and Glut, and phosphorylation of Ser and Thr. Fluorescence measurements at room temperature PSII photochemical efficiency was determined as a ratio of F v to F m , measured from intact leaves with a Hansatech CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al. 1774 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS Plant Efficiency Analyser (Hansatech Instruments, King’s Lynn, UK) after a dark incubation for 30 min. Construction of fluorescent protein fusions The C-terminal YFP fusion of CaS was constructed by using a two-step USER cloning technique [41]. The CaS coding sequence (AY341888) was amplified by PCR using PfuTurbo C X Hotstart DNA polymerase (Strategene, La Jolla, CA, USA) and the uracil-containing primers nt114 (forward: GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAU TAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette. The PCR product was mixed with the PacI ⁄ Nt.BbvCI-digested plasmid pCAMBIA330035Su and treated with USER enzyme mix (New England Biolabs) for 35 min at 37 °C and 25 min at 25 °C. The reaction mix was directly used to transform Esc- herichia coli DH10B chemically competent cells, the positive clone, pCAS, was obtained, and the correct insertion was verified by sequencing. A YFP fragment was amplified by PCR using the uracil-containing primers nt59 (forward pri- mer: GGCTTAAUCTGGGTAGCGGTGGAATGGTGAG CAAGGGCGAGGAG) and nt34 (reverse primer: GGTT TAAUTTACTTGTACAGCTCGTCCAT). The product was mixed with the PacI ⁄ Nt.BbvCI-digested pCAS, treated with USER enzyme mix, and used to transform E. coli DH10B. The fusion construct, pCASYFP, was verified by sequencing and was subsequently introduced to Agrobacte- rium tumefaciens strain C58 pGV3850 for heterologous expression in tobacco. GWD1tp–GFP consisted of chloro- plast transit peptide for glucan water dikinase 1 fused to GFP, and was used as a chloroplast marker. Transient expression and subcellular localization in N. benthamiana Overnight cultures of A. tumefaciens bearing appropriate plasmid constructs were harvested, resuspended in a buffer (100 lm acetosyringon, 10 mm MgCl 2 ,10mm Mes, pH 5.6), and were incubated at room temperature for 2 h. The attenuance of each Agrobacterium strain was adjusted to 0.05 at 600 nm before infiltration. N. benthamiana was grown in a greenhouse for 4 weeks at 28 °C under 16 h of daylight and at 22 °C under 8 h of darkness. The Agrobacterium cell suspensions were infil- trated into leaves, and the plants were placed in a green- house. Observations of sections of the infiltrated leaves were carried out by 48 h after infiltration using a confocal scanning laser microscope (TCS SP2; Leica Microsystems, Wetzlar, Germany). Sequential scanning of GFP and YFP were carried out, with excitation at 488 nm and 514 nm, respectively, and emission at 495–510 nm and 545–600 nm, respectively. Chloroplast autofluorescence was detected at 650–707 nm. The scan speed was 800 Hz, and a line aver- age of 8 was used. Acknowledgements The work was supported by the Academy of Finland, the Finnish Ministry of Agriculture and Forestry (the NKJ project), the Swedish Research Council for Envi- ronment, Agriculture and Space Planning (Formas), the Kone Foundation, and European Union FP6 contract 021313-Glytrans. We wish to thank Professor M. Sommarin for purified plasma membranes of Ara- bidopsis, Dr Z. M. Pei for CaS antibody, and Dr M. Glaring for the GDW1tp–GFP construct. We are grateful to the proteomics unit in the Turku Center of Biotechnology for maintenance of the MS unit. References 1 Vener AV (2007) Environmentally modulated phosphor- ylation and dynamics of proteins in photosynthetic membranes. Biochim Biophys Acta 6, 449–457. 2 Michel H, Griffin PR, Shabanowitz J, Hunt DF & Ben- nett J (1991) Tandem mass spectrometry identifies sites of three post-translational modifications of spinach light-harvesting chlorophyll protein II. Proteolytic cleavage, acetylation, and phosphorylation. J Biol Chem 266, 17584–17591. 3 Vener AV, Harms A, Sussman MR & Vierstra RD (2001) Mass spectrometric resolution of reversible pro- tein phosphorylation in photosynthetic membranes of Arabidopsis thaliana. J Biol Chem 276, 6959–6966. 4 Hansson M & Vener AV (2003) Identification of three previously unknown in vivo protein phosphorylation sites in thylakoid membranes of Arabidopsis thaliana. Mol Cell Proteomics 2, 550–559. 5 Rintamaki E, Kettunen R & Aro EM (1996) Differen- tial D1 dephosphorylation in functional and photodam- aged photosystem II centers. Dephosphorylation is a prerequisite for degradation of damaged D1. J Biol Chem 271, 14870–14875. 6 Baena-Gonzalez E, Barbato R & Aro EM (1999) Role of phosphorylation in the repair cycle and oligomeric structure of photosystem II. Planta 208, 196–204. 7 Allen JF (1992) Protein phosphorylation in regulation of photosynthesis. Biochim Biophys Acta 1098, 275–335. 8 Rintamaki E, Martinsuo P, Pursiheimo S & Aro EM (2000) Cooperative regulation of light-harvesting com- plex II phosphorylation via the plastoquinol and ferre- doxin–thioredoxin system in chloroplasts. Proc Natl Acad Sci USA 97, 11644–11649. 9 Wollman FA (2001) State transitions reveal the dynam- ics and flexibility of the photosynthetic apparatus. EMBO J 20, 3623–3630. J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1775 10 Aro EM & Ohad I (2003) Redox regulation of thyla- koid protein phosphorylation. Antiox Redox Signal 1, 55–67. 11 Tikkanen M, Piippo M, Suorsa M, Sirpio S, Mulo P, Vainonen J, Vener AV, Allahverdiyeva Y & Aro EM (2006) State transitions revisited – a buffering system for dynamic low light acclimation of Arabidopsis. Plant Mol Biol 62, 779–793. 12 Khrouchtchova A, Hansson M, Paakkarinen V, Vai- nonen JP, Zhang S, Jensen PE, Scheller HV, Vener AV, Aro EM & Haldrup A (2005) A previously found thyla- koid membrane protein of 14 kDa (TMP14) is a novel subunit of plant photosystem I and is designated PSI-P. FEBS Lett 579, 4808–4812. 13 Hamel P, Olive J, Pierre Y, Wollman FA & de Vitry C (2000) A new subunit of cytochrome b6f complex undergoes reversible phosphorylation upon state transi- tion. J Biol Chem 275, 17072–17079. 14 Rinalducci S, Larsen MR, Mohammed S & Zolla L (2006) Novel protein phosphorylation site identification in spinach stroma membranes by titanium dioxide mi- crocolumns and tandem mass spectrometry. J Proteome Res 5, 973–982. 15 Carlberg I, Hansson M, Kieselbach T, Schroder WP, Andersson B & Vener AV (2003) A novel plant protein undergoing light-induced phosphorylation and release from the photosynthetic thylakoid membranes. Proc Natl Acad Sci USA 100, 757–762. 16 Turkina MV, Kargul J, Blanco-Rivero A, Villarejo A, Barber J & Vener AV (2006) Environmentally modu- lated phosphoproteome of photosynthetic membranes in the green alga Chlamydomonas reinhardtii. Mol Cell Proteomics 5, 1412–1425. 17 Bellafiore S, Barneche F, Peltier G & Rochaix JD (2005) State transitions and light adaptation require chloroplast thylakoid protein kinase STN7. Nature 433, 892–895. 18 Bonardi V, Pesaresi P, Becker T, Schleiff T, Wagner R, Pfannschmidt T, Jahns P & Leister D (2005) Photosys- tem II core phosphorylation and photosynthetic accli- mation require two different protein kinases. Nature 437, 1179–1182. 19 Vainonen JP, Hansson M & Vener AV (2005) STN8 protein kinase in Arabidopsis thaliana is specific in phos- phorylation of photosystem II core proteins. J Biol Chem 280, 33679–33686. 20 Han S, Tang R, Anderson LK, Woerner TE & Pei ZM (2003) A cell surface receptor mediates extracellular Ca(2+) sensing in guard cells. Nature 425, 196–200. 21 Tang RH, Han S, Zheng H, Cook CW, Choi CS, Woerner TE, Jackson RB & Pei ZM (2007) Coupling diurnal cytosolic Ca2+ oscillations to the CAS–IP3 pathway in Arabidopsis. Science 315, 1423–1426. 22 Friso G, Giacomelli L, Ytterberg AJ, Peltier JB, Rudel- la A, Sun Q & Wijk KJ (2004) In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. Plant Cell 16, 478–499. 23 Kleffmann T, Russenberger D, von Zychlinski A, Chris- topher W, Sjo ¨ lander K, Gruissem W & Baginsky S (2004) The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. Curr Biol 14, 354–362. 24 Peltier JB, Ytterberg AJ, Sun Q & van Wijk KJ (2004) New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and ver- satile fractionation strategy. J Biol Chem 279, 49367– 49383. 25 Hammet A, Pike BL, McNees CJ, Conlan LA, Tenis N & Heierhorst J (2003) FHA domains as phospho-threo- nine binding modules in cell signaling. IUBMB Life 55, 23–27. 26 Alexandersson E, Saalbach G, Larsson C & Kjellbom P (2004) Arabidopsis plasma membrane proteomics identi- fies components of transport, signal transduction and membrane trafficking. Plant Cell Physiol 45, 1543–1556. 27 Millar AH, Sweetlove LJ, Giege P & Leaver CJ (2001) Analysis of the Arabidopsis mitochondrial proteome. Plant Physiol 127, 1711–1727. 28 Piippo M, Allahverdiyeva Y, Paakkarinen V, Suoranta UM, Battchikova N & Aro EM (2006) Chloroplast- mediated regulation of nuclear genes in Arabidopsis tha- liana in the absence of light stress. Physiol Genomics 25, 142–152. 29 Kanervo E, Suorsa M & Aro EM (2007) Assembly of protein complexes in plastids. In Cell and Molecular Biology of Plastids (Bock R, ed), pp. 283–313. Springer- Verlag, Berlin. 30 Bordo D & Bork P (2002) The rhodanese ⁄ Cdc25 phos- phatase superfamily. Sequence–structure–function rela- tions. EMBO Rep 3, 741–746. 31 Azumi Y & Watanabe A (1991) Evidence for a senes- cence-associated gene induced by darkness. Plant Phys- iol 95, 577–583. 32 Fulgosi H, Soll J, de Faria Maraschin S, Korthout HA, Wang M & Testerink C (2002) 14-3-3 proteins and plant development. Plant Mol Biol 50, 1019–1029. 33 Li J, Lee G, Van Doren SR & Walker JC (2000) The FHA domain mediates phosphoprotein interactions. J Cell Sci 113, 4143–4149. 34 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653– 657. 35 Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K & Weisshaar B (2003) An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53, 247–259. CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al. 1776 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS [...]... cloning PCR fragments Nucleic Acids Res 34, doi: 10.1093/nar/ gkl635 CaS – novel thylakoid phosphoprotein of Arabidopsis Supplementary material The following supplementary material is available online: Fig S1 Expression of cytosolic YFP in N benthamiana Fig S2 Expression of CaS–YFP and cytosolic GFP in N benthamiana Fig S3 Analysis of thylakoid membrane proteins of the wild-type and CaS knockout plants Fig... Photoinhibition and repair of PSII in CaS mutant and wild-type plants Table S1 Phosphopeptides isolated from wild-type thylakoids and identified by MS Table S2 Proteins identified by LC-MS ⁄ MS analysis in the gel region corresponding to 40 kDa phosphoproteins Table S3 Photosynthetic activity of wild-type and CaS knockout plants This material is available as part of the online article from http://www.blackwell-synergy.com...J P Vainonen et al 36 Palmgren MG, Askerlund P, Fredrikson K, Widell S, Sommarin M & Larsson C (1990) Sealed inside-out and right-side-out plasma membrane vesicles: optimal conditions for formation and separation Plant Physiol 92, 871–880 37 Cline K (1986) Import of proteins into chloroplasts J Biol Chem 261, 14804–14810 38 Suorsa M, Regel RE, Paakkarinen V, Battchikova N, Herrmann RG & Aro EM (2004)... Podtelejnikov AV, Sagliocco F, Wilm M, Vorm O, Mortensen P, Shevchenko A, Boucherie H & Mann M (1996) Linking genome and proteome by mass spectrometry: large-scale identification of yeast proteins from two dimensional gels Proc Natl Acad Sci USA 93, 14440–14445 41 Nour-Eldin HH, Hansen BG, Norholm MHH, Jensen JK & Halkier BA (2006) Advancing uracil-excision based cloning towards an ideal technique for cloning... (2004) Protein assembly of photosystem II and accumulation of subcomplexes in the absence of low molecular mass subunits PsbL and PsbJ Eur J Biochem 271, 96–107 39 Ficarro S, McCleland ML, Stukenberg PT, Burke DJ, Ross MM, Shabanowitz J, Hunt DF & White FM (2002) Phosphoproteome analysis by mass spectrometry and its application to Saccharomyces cerevisiae Nat Biotechol 20, 301–305 40 Shevchenko A, Jensen... article from http://www.blackwell-synergy.com Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1777 . Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana Julia P. Vainonen 1 , Yumiko Sakuragi 2 , Simon Stael 1 , Mikko Tikkanen 1 , Yagut Allahverdiyeva 1 , Virpi. GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAU TAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢. Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as previously described [36]. Intact chloroplasts