mancini olympia c 1639 1708 princess of savoy carignan coun tess of soissons and mistress of louis xiv

C++ Basics - More Flow of Control

Ngày tải lên : 12/09/2012, 22:47

... inner block and cannot be accessed outside the inner block  The other variable exists only in the outer block and cannot be accessed in the inner block Copyright © 2007 Pearson Education, Inc Publishing ... the action of a branch is too simple to warrant a function call, use multiple statements between braces  A block is a section of code enclosed by braces  Variables declared within a block, are ... value of these Boolean expressions?     Assume count = and limit = 10 (count == 0) && (limit < 20) !(count == 12) (limit < 0) && ((limit /count) > 7) Copyright © 2007 Pearson Education, Inc Publishing...

118
440
0

Tài liệu TRUYỆN CỔ TÍCH ANH NGỮ ( KO CÓ BẢN DỊCH) The Princess of the Golden Island doc

Ngày tải lên : 20/01/2014, 23:20

... in our country," he said "Anyone who wants to rule must show patience, courage, and love Your princess must pass all three tests to become our ruler." The day of the tests arrived The princess ... and die." The uncle believed his servant The princess grew up The leaders of the kingdom called a meeting They said, "It is time for the princess to rule the country." Majka's uncle was angry "There ... the princess' s hands Then he gave her a small harmonica He told her, "A good fairy gave this to me long ago It has magic power, but only in the hands of a good person Take it, child In my hands...

4
687
2

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Ngày tải lên : 19/02/2014, 13:20

... abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during hemostatic reactions, ... Bottom right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the ... FXa cofactor activity of the reaction intermediate, FVaint This facilitated the determination of loss of FVa cofactor activity during the initial stage of inactivation and minimized the inﬂuence...

13
654
0

Tài liệu C++ Lab 6 Review of Variables, Formatting & Loops docx

Ngày tải lên : 20/02/2014, 08:20

... endl; switch (grade) { case 'A' : cout

7
393
0

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Ngày tải lên : 22/02/2014, 04:20

... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coﬀey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... (Ro31-8220 and GF109203X) on the enhancement by TS of LPS/IFNinduced NO production in VSMC (A), and Western blot analysis of PKCa in control VSMC, VSMC treated with LPS/IFN and VSMC treated with TS and...

6
494
0

A Princess of Mars ppt

Ngày tải lên : 06/03/2014, 14:20

... which fact had also contributed to the noiselessness of their approach, and, in 18 common with a multiplicity of legs, is a characteristic feature of the fauna of Mars The highest type of man and ... lay facing the opening of the cave and where I could see the short stretch of trail which lay between the cave and the turn of the cliff around which the trail led The noise of the approaching ... approach of a score of full-grown Martians from behind me Coming, as they did, over the soft and soundless moss, which covers practically the entire surface of Mars with the exception of the...

168
481
0

C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

Ngày tải lên : 08/03/2014, 00:20

... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...

7
416
1

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Ngày tải lên : 14/03/2014, 10:20

... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... established cell suspension culture of ginseng cell and some attempts have been made to increase biomass and ginsenoside yield of ginseng cell culture Materials and methods Stock cell culture and culture...

6
492
0

Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf

Ngày tải lên : 16/03/2014, 00:20

... 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer 5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG TAGGGATTCG-3¢ were used Brieﬂy, the mutagenesis was achieved by PCR with the use of ... 5¢-ACCCCAAGATCGACTGGGCGG TAAG CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used as forward and reverse primers, respectively For construction of the Tr(delDSGL559) ... cells Primers (Sigma-Aldrich) for construction of the Sc(L559A) mutant for PCR reactions were as follows: forward, 5¢-CCAAGATCGACTCG GGCGCTTAGCGTCGC-3¢; and reverse, 5¢-GCGACGCT AAGCGCCCGAGTCGATCTTGG-3¢...

16
452
0

Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-speciﬁc glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Ngày tải lên : 16/03/2014, 12:20

... ATGGCTGCAGAAAAAACCG ⁄ GGATCCTTTAAGCG GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5 (CATATGGGTGCTTCATCATCAT ⁄ GGATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGCAGC AGAGAAGTCTG ⁄ ... AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) without transit peptides or Trx h2 (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCC AAATCAAGCAGCAGC) proteins were ... Journal compilation ª 2006 FEBS A Iqbal et al several other plants, such as tomato, sunﬂower and Chinese cabbage, and microorganisms such as Synechocystis PCC 6803, Saccharomyces cerevisiae and Plasmodium...

9
414
0

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a speciﬁc ternary complex with tRNASer potx

Ngày tải lên : 23/03/2014, 09:20

... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... representation and western blot analysis of full-length and deletion constructs of yeast (S cerevisiae, Sc) and maize cytosolic (Z mays, Zmc) SerRS (A) The names of the constructs used as baits ... speciﬁcity of the SerRS–Pex21p interaction, the full-length maize (Zea mays cytosolic, Zmc) SerRS (LexA–ZmcSerRS) and its truncated variant (LexA–ZmcSerRSDC26), lacking 26 C- terminal amino acids,...

12
406
0

Báo cáo khoa học: Identiﬁcation of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Ngày tải lên : 23/03/2014, 11:20

... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... described for CCPs and MauGs In conclusion, we have described a novel C- type heme protein located to the cellular surface of the methanotrophic bacterium M capsulatus This protein shares characteristics ... Detection of C- type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary sequence, it was of interest...

12
392
0

Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx

Ngày tải lên : 23/03/2014, 12:20

... dimerization and reduced the level of secreted tetramers, as discussed above Fig Eﬀects of the C- terminal cysteine (C3 7), of C- terminal segments and of a KDEL motif on acetylcholinesterase (AChE) molecular ... there was no interaction with QN in the case of W17L and W17P, a very small production of T4–QN in the case of W17A, and a signiﬁcant production of this complex in the case of W17F and W17H For these ... W17P Transfection of COS cells COS cells were transfected by the DEAE-dextran method, as described previously [24], using lg of DNA encoding the AChE catalytic subunit and lg of DNA encoding QN...

12
309
0

**Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt**

Ngày tải lên : 23/03/2014, 20:22

... +53 regions of c- jun in p123jun-eGFP and p148jun-eGFP, respectively Recombinant clones were conﬁrmed for insertion of the promoter regions of c- jun by sequencing Cells and cell culture Chinese hamster ... & McMillin, J.B (1998) Activation of the cytochrome c gene by electrical stimulation in neonatal rat cardiac myocytes Role of NRF-1 and c- jun J Biol Chem 273, 12593–12598 Steinmuller, L., Cibelli, ... diploid cells Sequence-speci c binding of RLjunRP Speciﬁcity of the complex formation between the factors and the )148 to )124 region of c- jun was examined (Fig 3B) by preincubating 100 lg of the...

9
449
0

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Ngày tải lên : 30/03/2014, 13:20

... interactions occurring in the concentration range of the critical micellar concentration (cmc) [17] For lysolecithin, the cmc is 20 lM, corresponding to Ri values of 5–6 and 30–40, for peptide concentrations ... Prediction of secondary structure elements The secondary structure of the C- terminal region of the catalytic domain and of the t peptide was predicted according to Rost [27] using PREDICTPROTEIN ... Switzerland) spectrometer at 25 C, using ¨ cuvettes of 0.1–1 cm path-length according to the concentration of peptide The blank was subtracted in all cases For evaluation of the molar ellipticity...

15
333
0

Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Ngày tải lên : 30/03/2014, 13:20

... 5¢-primers, CMV IE ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢; ... follows: CpG-ODN 1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a negative control ... TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT CAatcGatTTTCCAAGTC-3¢; mNF-jB4, 5¢-CCAAAAT CAAatcGatTTTCCAAAATG-3¢; mAP-1, 5¢-TAGCGG TTTatCgatCGGGGATTTCC-3¢ Mutated sites are indicated with lower case letters...

12
330
0

Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx

Ngày tải lên : 18/06/2014, 18:20

... T-lymphocytes Primary T-lymphocytes from peripheral blood express CD4 and both chemokine receptors, CXCR4 and CCR5 Since PBL express both CCR5 and CXCR4, they are capable of supporting the replication ... Fig and Table 1) using U373-MAGI indicator cell lines These cell lines express the CD4 receptor in conjunction with either CCR5 or CXCR4 as a coreceptor and can be infected with either macrophage ... http://www.virologyj.com/content/4/1/126 Table 3: Coreceptor usage by HIV-1 subtype C chimeras in U373-MAGI-CCR5 and U373-MAGI-CXCR4 cell lines MAGI-CCR5 Infection counts → 5000 CHIMERA_ 171 173...

12
408
0

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part1 docx

Ngày tải lên : 19/06/2014, 13:20

... Abbreviations DACS FDIC FFB FSLIC FIRRELA GCR RTC SAIF Page Division of Accountingand CorporateServices FederalDepositInsuranceCorporation FederalFinancingBank FederalSavingsand Loan InsuranceCorporation ... Treasury; the Chairman of the Board of Governors of the Federal Reserve System; the Acting Comptroller of the Currency; and the Chairmen and Ranking Minority Members of the Senate Committee on ... manner We conducted our audits in accordance with generally accepted government auditing standards Our reports on the Fund’ internal control s structure and its compliance with laws and regulations...

11
272
0

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part2 pot

Ngày tải lên : 19/06/2014, 13:20

... corrected FDIC Is Not Adheringto Its Time and Attendance Accounting and Reporting Procedures b FDIC is not consistently adhering to its procedures over the time and attendance accounting and reporting ... permit the preparation of financial statements in accordance with generally accepted accounting principles Because of the inherent limitations of any internal control structure, errors or irregularities ... reporting process Because FDIC allocates payroll expenses among the several funds it administers, lack of adherence to procedures over the time and attendance accounting and reporting process could...

11
276
0

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part3 potx

Ngày tải lên : 19/06/2014, 13:20

... reRectfinancial position and cash flows Accordingly, the following changes have affected both the Statement of Financial Posklon and the Statement of Cash Flows: 1) Cash and Cash Equivalents and ... Citicorp of the Delaware Brfdge Sank (the credft card subsidlary of Flrst RepublIcBankof Texas) Those funds were released In July of 1991 Cash and cash equivalentsas of December31 consisted of ... the sale of these assets (excluding cash and miscellaneousreceivableof S6.9bllllon) are regularlyevaluated,but remain subject to uncertaintiesbecause of changing economic condltlons affecting real...

11
304
0