Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/promoter in response to lipopolysaccharide and bacterial CpG-oligodeoxynucleotides in macrophage cell line RAW 264.7 Younghee Lee 1 , Wern-Joo Sohn 3 , Doo-Sik Kim 2,3 and Hyung-Joo Kwon 3 1 Cell Biology Laboratory, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Yusong, Daejon, Korea; 2 Department of Biochemistry and 3 Institute of Life Science and Biotechnology, College of Science, Yonsei University, Seoul, Korea The cytomegalovirus immediate-early (CMV IE) gene enhancer/promoter regulates the expression of immediate- early gene products and initiation of CMV replication. TNF-a and lipopolysaccharide (LPS) strongly activate the promoter, possibly involving NF-jB. CpG-oligodeoxy- nucleotides (CpG-ODNs), which contain unmethylated CpG dinucleotides in the context of particular base sequences, have gained attention because of their stimulating effects, via NF-jB, which have a strong innate immune response. To study the effects of LPS and CpG-ODNs, as well as the mechanisms of their actions regarding CMV IE enhancer/promoter activation, we used a macrophage cell line, RAW 264.7. Stimulation of the cells with LPS or CpG- ODNs resulted in the activation of the CMV IE enhancer/ promoter. We examined the involvement of NF-jBand c-Jun transcription factors by promoter deletion/site-specific mutation analysis and ectopic expression, and found them to have additive effects. Involvement of myeloid differentiation protein, an upstream regulator of NF-jB and c-Jun, was also investigated. Experimental results indicate that both LPS-induced and CpG-ODN-induced activations of CMV IE enhancer/promoter are mediated by Toll-like receptor signaling molecules. Several lines of evidence sug- gest the potential contribution of bacterial infection in CMV reactivation along with the potential application of CpG- ODNs in gene therapy as a stimulator for the optimal expression of target genes under the control of the CMV IE enhancer/promoter. Keywords: CMV IE gene enhancer/promoter; CpG-ODN; lipopolysaccharide; macrophage; NF-jB. Human cytomegalovirus (CMV) is a ubiquitous b-herpes- virus that causes severe disease in immunocompromised patients who have had this virus reactivated from latency [1]. Previous studies suggest that macrophage-lineage cells may provide a long-lived site for CMV latency [2–4]. The CMV immediate-early (IE) enhancer/promoter regulates the expression of immediate-early gene products and the initiation of CMV replication [5,6]. The enhancer/promoter region of the CMV IE gene contains a complex array of potential regulatory elements: four types of repetitive sequence elements of 16, 18, 19 and 21 bp repeats, which occur three to five times within the enhancer region. These elements contain consensus binding sites for transcription factors such as NF-jB/Rel, ATF/CREB, YY1 and NF1 [7–13]. Furthermore, binding sites for multiple transcription factors, including Sp1 (a serum response element), ELK-1, CCAAT/enhancer binding protein, retinoic acid receptor RAR-RXR family members and AP-1 have been identified [7,12–16]. TNF-a has been identified as a powerful mediator of CMV stimulation and reactivation in human and murine monocyte/macrophage progenitors [3]. TNF-a and lipo- polysaccharide (LPS) strongly activate the CMV IE enhancer/promoter, which is mediated by nuclear factor jB(NF-jB) that binds to the jB sites in the IE enhancer/ promoter [17,18]. However, detailed studies are required to understand the mechanisms involved in this action. The immediate recognition of bacteria and their pro- ducts in the early line of host defense is mediated by an ancient immune response that uses conserved pattern recognition receptors to distinguish the pathogen-associ- ated molecular pattern signatures of bacterial components [19]. A wide variety of bacterial components including LPS, bacterial DNA, peptidoglycan and lipoteichoic acid are capable of stimulating the innate immune responses [20]. LPS is the major component of the outer surface of Gram-negative bacteria; it is a typical example of potent activators. LPS-induced activation of the innate immune system is mediated through Toll-like receptor (TLR) 4, which is a transmembrane receptor that shares a high degree of homology with TLR9 [21,22]. The innate Correspondence to H J.Kwon,InstituteofLifeScienceand Biotechnology, College of Science, Yonsei University, Seoul 120-749, Korea. Fax: + 82 2 312 6027, Tel.: + 82 2 2123 6521, E-mail: hjookwon@yonsei.ac.kr Abbreviations: CMV IE, cytomegalovirus immediate-early; CpG-ODNs, oligodeoxynucleotides; IjBaSR, IjBa super repressor; IL-1R, IL-1 receptor; MyD88, myeloid differentiation protein; TLR, Toll-like receptor. (Received 22 November 2003, revised 15 January 2004, accepted 26 January 2004) Eur. J. Biochem. 271, 1094–1105 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04011.x immune system recognizes synthetic oligodeoxynucleotides (CpG-ODNs) and bacterial DNA containing unmethyl- ated CpG dinucleotides in the context of particular base sequences (CpG motifs) [23–25]. Immune activation by CpG-ODNs depends on TLR9, which determines the specificity of CpG motifs [26–28]. Through TLR-dependent signaling pathways in macro- phages, LPS and CpG-ODNs induce the activation of several transcription factors including NF-jB [25,29,30]. NF-jB activation requires signal transduction molecules such as myeloid differentiation protein (MyD88), IL-1 receptor (IL-1R)-associated kinase, tumor necrosis factor receptor-associated kinase 6 and IjB kinase [30–34]. Sti- mulation of this pathway by LPS and CpG-ODNs results in the activation of IjB kinase [31,35]; subsequently, IjB kinase phosphorylates IjBa at serines 32 and 36, leading to its degradation and the subsequent release and translocation of NF-jB to the nucleus, where NF-jB facilitates the transcriptional upregulation of genes downstream from the jB motif. The exposure of macrophages to LPS and CpG- ODNs also results in the activation of the mitogen-activated protein kinase pathways, including the extracellular signal- related kinase, c-Jun NH 2 -terminal kinase and p38 cascades [36,37]. AP-1 activity is regulated in part by the activation of c-Jun NH 2 -terminal kinase which phosphorylates and subsequently increases the transcriptional activity of c-Jun in LPS- and CpG-ODN-treated macrophages [37,38]. These common features of the signaling of LPS and CpG-ODNs suggest that the two stimulators use similar intracellular pathways to display their shared actions. LPS and CpG- ODNs modulate the expression of many genes that encode cytokines, cell surface receptors, transcription factors and proteins related to the proliferation/differentiation of cells [39,40]. To examine the effects of LPS and CpG-ODNs in cells that harbor a CMV promoter and to understand the mechanisms of CMV IE enhancer/promoter activation, we used a line of RAW 264.7 cells that exhibit NF-jB- dependent activation of the CMV IE enhancer/promoter upon LPS or CpG-ODNs stimulation. We examined involvement of NF-jB, c-Jun transcription factors and MyD88. Our results indicate that LPS-induced and CpG- ODN-induced signals use TLR/IL-1R signaling molecules for CMV IE enhancer/promoter activation. Materials and methods Cell culture and reagents The RAW 264.7 cell line was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% (v/v) fetal bovine serum, 100 UÆmL )1 penicillin and 100 lgÆmL )1 streptomycin. Viab- ility, which was assayed using trypan blue dye exclusion, was typically greater than 95%. Cultures were maintained until passage 20 and then discarded. Escherischia coli LPS (Sigma, St. Louis, MO, USA) was suspended in sterile water and added to the cell culture to obtain the desired concentrations. The NF-jB p65 monoclonal antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The rabbit polyclonal antibodies to IjBa and c-Jun were purchased from Cell Signaling Technology (Beverly, MA, USA). Expression vectors encoding NF-jB p65 (pTL-1 vector), IjBaSR (LxSN vector) and c-Jun (pTL-1 vector) were kindly provided by H. Nakshatri (Indiana University, School of Medicine, Indianapolis, IN, USA). An expression vector encoding a dominant negative version of MyD88 (DMyD88) was kindly provided by J. Tschopp (University of Lausanne, Epalinges, Switzerland). Oligodeoxynucleotides Phosphorothioate backbone oligodeoxynucleotides were purchased from GenoTech (Daejeon, Korea). The CpG- ODN 1826 that we used consisted of 20 bases that con- tained two CpG motifs (underlined): TCCA TGCGTT CCT GACGTT. Derivatives of the CpG-ODN 1826 se- quence with one or two of the CG sequences reversed to GC (indicated by bold lettering) are as follows: CpG-ODN 1826(S-1, TCCAT GAGCTTCCTGACGTT); 1826(S-2, TCCAT GACGTTCCTGAGCTT) and 1826(S-3, TCC AT GAGCTTCCTGAGCTT). The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a neg- ative control. The LPS content of ODNs was <1 ng LPSÆmg )1 DNA as measured by a Limulus amebocyte assay (Whittaker Bioproducts, Walkersville, MD, USA). Construction of luciferase reporter plasmids The CMV IE enhancer/promoter fragments )740 to +65, )507 to +65, )300 to +65, )185 to +65 and )130 to +65 relative to the IE transcription start were amplified by polymerase chain reactions using the entire native CMV enhancer/promoter sequences as a template with the fol- lowing primer sets: 5¢-primers, CMV IE ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢;CMVIE()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢;CMVIE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢;CMVIE()130) 5¢-TGGTACCTTGTTT TGGCACCAAAATCA-3¢ and 3¢ primer, CMV IE (+65) 5¢-AAGATCTGACTGCGTTAGCAATTTAAC-3¢.The CMV IE enhancer/promoter fragments were ligated into KpnIandBglII sites of the luciferase reporter plasmid pGL3-basic vector (Promega, Madison, WI, USA) yielding the reporter constructs pCMV-Luc,pCMV()507)-Luc, pCMV()300)-Luc,pCMV()185)-Luc and pCMV()130)- Luc. To introduce site-specific mutations in NF-jBand AP-1 binding sites, the transcription factor recognition sites were abrogated and changed to ClaIsitesbyatwo step PCR mutagenesis method [41] using 5¢-primer CMV IE ()740) and 3¢-primer CMV IE (+65) along with the primers encoding the following sequences in sense or antisense orientation: mNF-jB1, 5¢-GTAACGCCAAT AtcGAtTTTCCATTG-3¢; mNF-jB2, 5¢-ACATGACCT TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT CAatcGatTTTCCAAGTC-3¢;mNF-jB4, 5¢-CCAAAAT CAAatcGatTTTCCAAAATG-3¢;mAP-1,5¢-TAGCGG TTTatCgatCGGGGATTTCC-3¢. Mutated sites are indi- cated with lower case letters. The full-length CMV IE enhancer/promoter sequences ()740 to +65) including the mutations were ligated into the KpnIandBglII sites of pGL3-basic vector yielding the reporter constructs Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1095 pCMVmNF-jB1-Luc,pCMVmNF-jB2-Luc,pCMVmN F-jB3-Luc, pCMVmNF-jB4-Luc,pCMVmAP-1-Luc. Transfection and luciferase assay One day before the transfection, RAW 264.7 cells were placed into six-well plates at a concentration of 5 · 10 5 cells per well. Cells were transfected using FuGene 6 Transfec- tion Reagent (Roche, Indianapolis, IN, USA) following the manufacturer’s instructions, in DMEM with 10% (v/v) FBS. For each comparison between constructs, we con- firmed equivalent transfection efficiency by cotransfecting the promoterless Renilla luciferase vector pRL-null (Pro- mega, Madison, WI, USA) as an internal control [42]. After the transfection, the cells were placed in a complete medium for 24 h prior to LPS (100 ngÆmL )1 or as indicated in the individual experiments) or CpG-ODNs (3 l M or as indica- ted in the individual experiments) treatment for 6 h or as indicated in the individual experiments. The cells were harvested, washed and lysed by freeze-thawing three times, and the luciferase activities were determined using the Dual- Luciferase Reporter Assay System (Promega, Madison, WI, USA) with a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA, USA) according to the manufacturer’s specifications. Individual assays were normalized for Renilla luciferase activity and the data are presented as the fold increase in activity relative to empty vector control. The data are from two or three independent experiments performed in duplicate or triplicate with similar results. Standard errors are indicated. Indirect immunofluorescence assays and confocal microscopy We detected NF-jB p65 nuclear localization by indirect immunofluorescence assays using confocal microscopy as described previously [43]. RAW 264.7 cells (5 · 10 4 )were cultured directly on glass coverslips in 24-well plates. After 24 h, the cells were transfected with the IjBa super repressor (IjBaSR) construct. After an additional 24 h, the cells were fixed with 4% (v/v) paraformaldehyde in NaCl/P i for 10 min at room temperature; they were then permeabilized with 0.2% (v/v) Triton X-100 in NaCl/P i for 10 min and blocked with a solution of NaCl/P i , 15% (v/v) normal donkey serum (Sigma, St. Louis, MO, USA) and 0.2% (v/v) Tween-20. Monoclonal antibodies to NF- jB p65 were applied for 1 h followed by 1 h incubation with Texas Red-conjugated donkey anti-mouse IgG (Jack- son ImmunoResearch Laboratories, Inc., West Grove, PA, USA). For double immunofluorescence staining of NF- jBp65and IjBa, a primary rabbit polyclonal antibody that recognizes IjBa was used and detected with a goat anti- rabbit IgG linked to fluorescein isothiocyanate (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). To identify cell nuclei, we used DNA staining (0.5 lgÆmL )1 of Hoechst no. 33258; Sigma, St. Louis, MO, USA). Coverslips were mounted in Fluoromount-G (South- ern Biotechnology Associates, Inc., Birmingham, AL, USA). Samples were scanned with a Zeiss LSM 510 laser scanning confocal device attached to an Axiovert 100 microscope using a Plan-Apochromat 100X/Oil DIC objective (Carl Zeiss, Germany). Western blotting Equal amounts of protein were resolved in 10% (v/v) SDS/ PAGE and electrotransferred to poly(vinylidene difluoride) membranes (Millipore, Bedford, MA, USA). Membranes were blocked in NaCl/Tris containing 0.05% (v/v) Tween- 20 and 2% (v/v) BSA for 1 h at room temperature and incubated with appropriate primary antibody for 2 h. Immunoreactive proteins were detected by horseradish peroxidase-conjugated secondary antibody (Jackson Immu- noResearch Laborities, Inc.) and an enhanced chemilu- minescence reagent (Amersham Pharmacia Biotech, Piscataway, NJ, USA). Results Activation of the CMV IE enhancer/promoter in LPS-treated RAW 264.7 cells To examine LPS-stimulated CMV promoter activation in RAW 264.7 cells, we used a 740 bp CMV IE enhancer/ promoter-luciferase reporter construct (pCMV-Luc). In the CMV IE enhancer/promoter gene located between the )425 to )80 bp 5¢-region of the transcription start site, Fig. 1. LPS stimulates CMV IE enhancer/promoter in RAW 264.7 cells. (A) Structure of the CMV IE enhancer/promoter. (B and C) RAW 264.7 cells were transiently transfected with pCMV-Luc for 24 h. The cells were then stimulated with increasing amounts of LPS for 6 h (B) or 100 ngÆmL )1 LPS for different time periods (C). Cells were harvested and cell lysates were obtained by freeze-thaw. The luciferase activity, which was normalized to Renilla activity, was measured as relative light units (RLU). The results are represented as fold activation compared with control vector alone. 1096 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004 there are four copies of the NF-jB and one copy of the AP-1 binding sites (Fig. 1A). LPS activates the Toll-like receptor-dependent signaling pathway in macrophages, including the transcription factors NF-jBandc-Jun [32,38]. As expected, LPS activated the promoter in a time- and dose-dependent manner (Fig. 1B,C). When the cells were stimulated with 100 ngÆmL )1 of LPS for 6 h, the activation of the promoter reached its maximum level (Fig. 1B,C). The following experiments were carried out under these conditions to estimate the CMV IE enhancer/ promoter activity. The NF-jB p65 and c-Jun activity required for LPS- induced CMV IE enhancer/promoter activation To examine the relative contribution of NF-jBandc-Junto CMV IE enhancer/promoter activation, we cotransfected expression plasmids encoding NF-jB p65, c-Jun or both into RAW 264.7 cells with a promoter-reporter construct, and the luciferase activity was estimated. First, when the ability of NF-jB p65 to transactivate the reporter was tested, the expressed NF-jB p65 significantly activated the CMV IE enhancer/promoter in a dose-dependent manner (Fig. 2A). Cotransfection of an NF-jB p65 expression vector at a concentration of 200 ngÆmL )1 conferred about a five-fold increase in the activation over the empty expression vector control. To determine the contribution of c-Jun to CMV IE enhancer/promoter activation, we introduced the ectopic expression of c-Jun, which also activated the promoter in a dose-dependent manner (Fig. 2B). The expression of both NF-jBp65 andc-Jun resulted in an approximately two-fold increase in the stimulation of the transcription compared with the expres- sion of NF-jB p65 or c-Jun alone (Fig. 2C). These Fig. 2. Ectopic expression of NF-jB p65 and c-Jun enhances LPS-induced CMV IE enhancer/promoter activation. (A and B) RAW cells were transfected with pCMV-Luc and indicated amounts of plasmids expressing NF-jB p65 (A) or c-Jun (B). (C) RAW 264.7 cells were cotransfected with pCMV-Luc, Renilla internal control plasmid and 50 ng of the expression vector encoding either NF-jB p65 or c-Jun or both. (D) RAW 264.7 cells were cotransfected with pCMV-Luc and 50 ng of the indicated plasmid constructs. Six hours before harvest, cultures were treated with LPS (100 ngÆmL )1 ). Luciferase assays were performed as described. Experiments represent one of three independent experiments with similar qualitative results. (E) Ectopic expression of NF-jB p65 and c-Jun RAW 264.7 cells were transfected with 0.2 lgofNF-jB p65 or c-Jun expression vector. After 24 h, cells were stimulated with 100 ngÆmL )1 of LPS for 6 h. Cell lysates were analyzed by Western blotting with a polyclonal antibody specific for c-Jun and monoclonal antibodies to NF-jB p65 and a-actin. Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1097 observations indicate that each of the transcription factors contributes to CMV IE enhancer/promoter activation in RAW 264.7 cells. Further investigation was performed to examine the contribution of NF-jB and c-Jun to LPS-dependent activa- tion of the CMV IE enhancer/promoter. Treatment of RAW 264.7 cells with LPSresulted in an approximately two- fold increase in the promoter activity. The expression of NF- jB p65 dramatically increased LPS-induced transactivation of the promoter (Fig. 2D). As expected, ectopic expression of c-Jun also greatly increased the promoter activity in RAW 264.7 cells treated with LPS (Fig. 2D). Taken together, these data demonstrate that NF-jBp65 and c-Jun are components of the LPS signaling pathway, provi- ding further evidence that NF-jB p65 and c-Jun are essent- ial components of CMV IE enhancer/promoter activation. To exclude the possibility of LPS stimulation affects on the ectopic expression of NF-jB p65 or c-Jun (pTL-1 vector), we analyzed the lysates from each set of expression vector-transfected cells following stimulation with LPS for 6 h (Fig. 2E). LPS did not change total NF-jBp65orc-Jun protein levels. We could not detect any dramatic increase in expression of NF-jB p65 or c-Jun in transfected cells using Western blotting, probably because of the transfection efficiency in RAW cells and high expression of endogenous proteins (Fig. 2E). However, we did detect higher expres- sion of NF-jB p65 or c-Jun in a subpopulation of cells transfected with NF-jB p65 or c-Jun expression vector using immunostaining and confocal microscopy images (data not shown). In order to further confirm that pTL-1 vectors do not respond to LPS, we constructed a pTL-1- luciferase reporter (pTL-1-Luc) and examined its regulation in RAW 264.7 cells after stimulation with LPS. LPS did not change the luciferase activity in pTL-1-Luc transfected cells (data not shown). Inhibition of NF-jB p65 nuclear localization suppresses LPS-induced CMV IE enhancer/promoter activation To verify whether the CMV IE enhancer/promoter is modulated by LPS dependent nuclear localization of NF-jB p65, it was attempted to analyze the location of NF-jB p65 by immunostaining and confocal microscopy. In RAW 264.7 cells transfected with an empty expression vector and in the absence of exogenous LPS, NF-jBp65is primarily cytoplasmic as associated with IjBa (Fig. 3, first row). The degradation of IjBa and nuclear accumulation of NF-jB p65 were strongly induced after stimulation with LPS in RAW 264.7 cells transfected with an empty expression vector (Fig. 3, second row). In contrast, the Fig. 3. Inhibition of NF-jB p65 nuclear loca- lization by IjBaSR in LPS stimulated RAW 264.7 cells. Inhibition of NF-jBp65 nuclear localization by IjBaSR. Cells were transfected with the IjBaSR expression vector (0.2 lgÆmL )1 )for24handtreatedwithLPS. Degradation of IjBa and localization of NF- jB p65 were visualized by confocal micros- copy after immunofluorescence staining with antibodies to NF-jBp65(red)andIjBa (green). Cells were stained with Hoechst no. 33258 to visualize the nuclei (blue). 1098 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004 expression of a mutant IjBa protein (IjBa super repressor, IjBaSR) that cannot be phosphorylated on serines 32 and 36 blocked the degradation of IjBa and nuclear accumu- lation of NF-jB p65 induced by LPS (Fig. 3, third row). To examine the contribution of NF-jB p65 nuclear localization to LPS-induced CMV promoter activation, an IjBaSR expressing vector was employed in a dose-depend- ent manner. As expected, the expression of IjBaSR inhibited activation of the promoter in an IjBaSR dose-dependent manner (Fig. 4A). To confirm the effect of ectopically expressed IjBaSR on LPS-induced IjBa degradation, the protein level of IjBa was estimated after the stimulation. Empty expression vector or IjBaSR expression vector- transfected cell was exposed to LPS for 30 min and then IjBa was analyzed by Western blot using an antibody against IjBa.AsshowninFig.4B,IjBa degradation after LPS treatment was not detected in IjBaSR transfected cells. These experimental results indicate that LPS-dependent NF- jB p65 nuclear localization is critical for activation of the CMV IE enhancer/promoter in RAW 264.7 cells. To deter- mine whether LPS stimulation alters ectopic expression of the IjBaSR, Western blottingwas performed with the lysates from IjBaSR expression vector-transfected cells after sti- mulation withLPS for 6 h. There wasno significant variation in the expression of IjBa in LPS-stimulated cells (Fig. 4C). Deletion analysis of the CMV IE enhancer/promoter To analyze the 5¢-region of the CMV IE enhancer/promo- ter, RAW 264.7 cells were transiently transfected with a series of plasmids containing progressive truncations of the 5¢-promoter sequence between )740 and )130 bp, and luciferase activities were analyzed 6 h later (Fig. 5A). The full-length promoter pCMV-Luc had strong luciferase activity, but deletion of 232 bp [)740 to )508 bp, pCMV()507)-Luc] resulted in higher activity than that of pCMV-Luc. This finding suggests that negative regulatory elements are located in a region between )740 and )507 bp. Deletion up to the )301 bp position did not significantly affect the luciferase activity, whereas progressive deletion in the region )300 to )130 bp dramatically decreased the activity. Therefore, the two NF-jB sites and one AP-1 site located in the region appear to be critical for basal activation of the promoter. To define the LPS-responsive elements of the CMV IE enhancer/promoter, deletion constructs were transiently transfected into RAW 264.7 cells, which were treated with 100 ngÆmL )1 LPS (Fig. 5B). Deletion of the upstream sequence of )507 bp resulted in higher LPS-induced promoter activation than that of pCMV-Luc. Removal of aregionfrom)507 to )301 bp [pCMV()300)-Luc], which contains an NF-jB site, reduced LPS-induced promoter activation by  35%. In addition, deletion to )185 bp, which lacks another NF-jB site, further reduced the LPS- induced response. Furthermore, deletion to )130 bp removed a region that contained the AP-1 and NF-jBsites and abolished the LPS-induced promoter activity. These results imply that NF-jB and AP-1 sites are required for the LPS-induced CMV IE enhancer/promoter activity in the macrophage. The contribution of NF-jB and AP-1 binding sites to the CMV IE enhancer/promoter To better evaluate the individual contribution of NF-jBand AP-1 to the activity of the CMV promoter, the constructs of the deletion mutant promoter were transiently cotransfected with expression plasmids encoding NF-jB p65 or c-Jun into RAW 264.7 cells (Fig. 6). Cotransfection of an NF-jBp65 expression vector at a concentration of 50 ngÆmL )1 with a full-length promoter (pCMV-Luc) conferred about three- fold increase in activation over basal transcriptional levels. Deletion of the upstream sequence of )507bpcausedthe activity of the promoter to be higher than the activity of pCMV-Luc. However, progressive deletion of the NF-jB binding sites from the CMV IE enhancer/promoter Fig. 4. Degradation of IjBa required for CMV IE enhancer/promoter activation in LPS stimulated RAW 264.7 cells. (A) Inhibition of LPS-induced CMV IE enhancer/promoter activation by IjBaSR. RAW 264.7 cells were cotransfected with pCMV-Luc and indicated amounts of plasmid expressing IjBaSR. The cells were treated with LPS (100 ngÆmL )1 ) for 6 h and assayed for luciferase activity. (B) Inhibition of LPS-induced IjBa degradation by IjBaSR. Equivalent amounts of cell extracts from RAW cells transfected with pCMV-Luc (0.2 lgÆmL )1 ) and increasing amounts of IjBaSR expression con- structs were analyzed by Western blotting. IjBa and IjBaSR were detected with the antibody against IjBa. (C) Ectopic expression of IjBaSR in the presence or absence of LPS. RAW 264.7 cells were transfected with 0.2 lgofIjBaSR expression vector. After 24 h, cells were stimulated with 100 ngÆmL )1 of LPS for 6 h. Cell lysates were analyzed by Western blotting with polyclonal antibodies specific for IjBa and a-actin. Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1099 [pCMV()300)-Luc,pCMV()185)-Luc and pCMV()130)- Luc)] reduced enhancement of the promoter activity by NF-jB p65 (Fig. 6A). In conclusion, NF-jB and its recog- nition sites are clearly involved in the CMV IE enhancer/ promoter activation. When the AP-1 site-deleted CMV IE enhancer/promoter [pCMV()130)-Luc] was cotransfected with a c-Jun expres- sion vector, the luciferase activities decreased in comparison with the cells cotransfected with pCMV-Luc (Fig. 6B). In contrast, the deletion of the upstream sequences of )185 bp [pCMV()507)-Luc,pCMV()300)-Luc and pCMV()185)- Luc] had no significant effect in c-Jun-induced promoter activation. Cotransfection of both NF-jB p65 and c-Jun enhanced the activation of the promoters compared with theactivationobservedupontransfectionofNF-jBp65 or c-Jun alone, in an additive manner (Fig. 6C). The observations indicate that each of the transcription factors could activate the CMV IE enhancer/promoter in the mouse macrophage cell line RAW 264.7. We next investigated functional significance of the tran- scription factors after stimulation with LPS. Ectopic expres- sion of NF-jB p65 or c-Jun significantly increased CMV IE enhancer/promoter activity in RAW 264.7 cells treated with LPS (Fig. 6D,E). To define the LPS-responsive elements of the CMV IE enhancer/promoter, the 5¢-deletion series of constructs were transiently cotransfected with expression plasmids encoding NF-jB p65 or c-Jun into RAW 264.7 cells, which were then treated with 100 ngÆmL )1 LPS. The expression of NF-jB p65 or c-Jun dramatically increased the LPS-induced transactivation in the two promoter-reporter constructs pCMV-Luc and pCMV()507)-Luc (Fig. 6D,E). However, this phenomenon was greatly reduced when the promoter sequence upstream of )300 bp was deleted [pCMV()300)-Luc]. Progressive deletion of the region including NF-jB and AP-1 binding sites [pCMV()300)- Luc,pCMV()185)-Luc and pCMV()130)-Luc] reduced the promoter activity stimulated by LPS in the presence of ectopically expressed NF-jB p65 or c-Jun (Fig. 6D,E). This result indicates that the region, between )507 and )130 bp of the CMV IE enhancer/promoter including NF-jBandAP-1 binding sites, is required for NF-jB p65 or c-Jun to enhance the LPS-induced transcriptional activation. Effects of site-specific mutations in the NF-jB or AP-1 binding sites on the CMV IE enhancer/promoter activity To further clarify the individual roles of NF-jBandAP-1 sites on activation of the CMV IE enhancer/promoter, we Fig. 5. Effects of the 5¢-promoter sequence deletion mutations on the activity of the CMV IE enhancer/promoter. (A) Relative activities of the CMV IE enhancer/promoter constructs. RAW cells were transfected with each reporter construct and cultured for 24 h before assaying for luciferase activity. The results are presented as relative activation compared with the pCMV-Luc construct. (B) LPS induction of the promoter constructs. RAW cells were transfected with each reporter construct and cultured in the presence or absence of LPS (100 ngÆmL )1 )for6 h.Thefold activation represents the ratio of luciferase activity in LPS stimulated cells versus unstimulated cells. Essential regions for basal promoter activity (A) and LPS-responsiveness (B) were indicated. 1100 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004 performed mutational analysis of these sites in the context of the full-length promoter (Fig. 7). The full-length promo- ter pCMV-Luc had strong luciferase activity and mutation of the NF-jB1 site had minimal effect on the promoter activity. Mutation in the NF-jB2, NF-jB3 and NF-jB4 sites reduced the promoter activity by 62, 72 and 51%, respectively (Fig. 7B). Mutation in the AP-1 binding site also reduced promoter activity by 27% (Fig. 7B). There- fore, the three NF-jB sites and one AP-1 site appear to be critical for basal activation of the promoter. To determine which transcription factor binding sites are required for maximal induction of the CMV IE enhancer/ promoter by LPS, mutant constructs were transiently transfected into RAW 264.7 cells, which were treated with 100 ngÆmL )1 LPS. Mutation in the NF-jB1 site had minimal effect on the LPS-induced promoter activity. The NF-jB1 site is located in the region between )507 and )300 bp of the CMV IE enhancer/promoter which, based on promoter deletion analysis, is required for the LPS- induced transcriptional activation (Figs 5B and 6D,E). Therefore, it is likely that factor(s) other than NF-jBand AP-1 may be also involved in LPS-induced promoter activation. Significant reduction of the promoter activity was observed by mutation of NF-jB2, NF-jB3, NF-jB4 and AP-1 sites in LPS-stimulated cells (Fig. 7C). We conclude that LPS activation of CMV IE enhancer/promo- ter is mediated by a concerted action of transcription factor binding sites and each of the NF-jB and AP-1 sites is important for maximal activation. We investigated involvement of NF-jBp65andc-Junin transcriptional activation of the CMV IE enhancer/promo- ter using the site-specific mutant constructs (Fig. 7A) and ectopic expression of NF-jB p65 or c-Jun (Fig. 7D,E). Mutations in the NF-kB binding sites from the CMV IE enhancer/promoter (pCMVmNF-jB2-Luc, pCMVmNF- jB3-Luc and pCMVmNF-jB4-Luc) reduced promoter activation after ectopic expression of NF-jBp65(Fig.7D). Among the four NF-jB binding sites, NF-jB3 appears to have the most significant effect on the transcriptional activation. When AP-1 site was mutated, promoter activity after ectopic expression of c-Jun was decreased compared to wild type promoter. Taken together, these results confirm that the NF-jB and AP-1 sites both contribute to CMV IE enhancer/promoter activity. Activation of the CMV IE enhancer/promoter by CpG-ODN To evaluate the effects of CpG-ODNs on CMV IE enhancer/promoter activation, we used a CMV IE enhan- cer/promoter-luciferase reporter (pCMV-Luc)andexam- ined its regulation in RAW 264.7 cells after stimulation with CpG-ODN 1826, which consists of 20 bases containing two CpG motifs. The CpG-ODN 1826 activated the CMV IE Fig. 6. Activation of the CMV IE enhancer/promoter constructs in response to ectopic expression of NF-jB p65 and c-Jun. (A, B and C) RAW cells were transfected with each reporter construct (0.2 lgeach) and the indicated expression vectors (50 ng each) encoding NF-jBp65 (A), c-Jun (B) or both (C) and cells were cultured for 24 h before assaying for luciferase activity. (D and E) RAW 264.7 cells were cotransfected with each reporter construct and 50 ng of the indicated expression vectors. Six hours before harvest, cultures were treated with LPS. The results are presented as fold activation compared with the control expression vector. Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1101 enhancer/promoter in a time- and dose-dependent manner (Fig. 8A,B). Activation of the promoter reached its maxi- mum level when stimulated with 3 l M of the CpG-ODN for 6 h (Fig. 8A,B). Because CpG-ODN 1826 has two CpG motifs, we decided to identify the contribution of the individual CpG dinucleotide sequence to the promoter activation. We synthesized the phosphorothioate backbone oligonucleotides of CpG-ODN 1826(S-1), 1826(S-2) and 1826(S-3), which differ only in the reversal of the CpG dinucleotides to the GpC dinucleotides compared to the CpG-ODN 1826(S) sequence. As shown in Fig. 8C, luci- ferase activity decreased by  15% when the cells were treated with CpG-ODN 1826(S-2) compared to the activity in CpG-ODN 1826(S)-treated cells. Compared with CpG- ODN 1826(S), a much lower level of luciferase activity (up to 40% reduction) was induced by CpG-ODN 1826(S-1). With the reversal of the two CpG dinucleotides to GpC dinucleotides, CpG-ODN 1826(S-3) lost its capacity for CMV promoter activation. Basal luciferase activity was detected in the control cells stimulated with non-CpG- ODN 2041. These results clearly indicate that the CpG- ODN 1826 sequence induced CMV IE enhancer/promoter activation in a CpG sequence-dependent manner. Regulation of CMV IE enhancer/promoter activity by CpG-ODN and LPS via MyD88-dependent modulation of NF-jB activation The signaling by CpG-DNA and LPS through their respective TLRs requires the participation of the adaptor protein MyD88 and results in activation of the common transcription factors NF-jB and AP-1 [32,34]. To determine if MyD88 is involved in the CMV IE enhancer/promoter activation, we cotransfected an expression plasmid encoding a mutant MyD88 (DMyD88) into RAW 264.7 cells, along with the promoter. Acting as a dominant negative molecule in TLR/IL-1R-dependent signaling, the mutant inhibited LPS-mediated and CpG-ODN1826-mediated CMV IE enhancer/promoter activation (Fig. 9A,B). We then exam- ined whether the promoter activation is modulated by CpG- ODN signaling-dependent IjBa degradation. When RAW 264.7 cells were transfected with a mutant IjBa protein (IjBaSR), activation of the promoter by CpG-ODN 1826 stimulation was inhibited, further confirming that the degradation of IjBa is necessary for CMV IE enhancer/ promoter activation that is induced by CpG-ODN 1826 (Fig. 9B). Fig. 7. Effects of site-specific mutations in transcription factor recognition site on the activity of the CMV IE enhancer/promoter. (A) Positions and sequences of the NF-jB and AP-1 sites are indicated. Mutated sites are indicated with lower case letters. (B) Relative activities of the mutated CMV IE enhancer/promoter construct. RAW cells were transfected with each mutated reporter construct and cultured for 24 h before assaying for luciferase activity. The results are presented as relative activation compared with the pCMV-Luc construct. (C) LPS induction of the promoter constructs. RAW cells were transfected with each mutated reporter construct and cultured in the presence or absence of LPS (100 ngÆmL )1 )for6 h, (D and E) RAW cells were transfected with each mutated reporter construct (0.2 lg each) and the indicated expression vectors (0.2 lgeach) encoding NF-jB p65 (D), c-Jun (E) and cultured for 24 h before luciferase activity assay. The results are presented as relative activation compared with the pCMV-Luc construct. 1102 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Discussion Although many investigators use vectors such as pRC/CMV and pcDNA to introduce target genes under the control of a CMV promoter, only a few studies have revealed regulation of the promoter in detail. Reportedly, interferon-a inhibits murine CMV immediate-early gene expression by downreg- ulating NF-jB activity [44]. In contrast, TNF-a and LPS have been shown to stimulate CMV IE enhancer/promoter activity by upregulating NF-jB activity [17,18]. In this study, we demonstrate that LPS and CpG-ODNs activate the CMV IE enhancer/promoter and that both NF-jBand c-Jun contribute to this phenomenon in the mouse macro- phage cell line RAW 264.7. LPS stimulation drastically induced activation of the CMV IE enhancer/promoter (Fig. 1). In other studies, the NF-jB and c-Jun binding sites were identified in the CMV IE enhancer/promoter [7,10,12]. Our study extends this observation by identifying the dominant role of ectopically expressed NF-jB p65. The expression of NF-jB p65 in RAW 264.7 cells led to an increase of the CMV IE enhancer/promoter basal activity in a dose- dependent fashion (Fig. 2A), while NF-jB p65 enhanced the capacity of LPS to dramatically induce the promoter activation (Fig. 2D). Using reporter gene assays, we directly demonstrated the major role of NF-jB; preventing nuclear localization of NF-jB by ectopic expression of its specific inhibitor IjBaSR blocked activation of the CMV IE enhancer/promoter in an IjBaSR dose-dependent manner (Figs 3 and 4A). These results suggest that NF-jB activa- tion is required for CMV IE enhancer/promoter activation in the LPS-signaling pathways. Additionally, we confirmed the involvement of NF-jB by using the deletions and site- specific mutations of the promoter region to interfere with NF-jB-mediated activation at the level of DNA binding (Figs 5–7), which suggests that NF-jB and its binding sites are essential for NF-jB-dependent CMV IE enhancer/ promoter activation. The potential function of c-Jun in regulating the CMV IE enhancer/promoter is not fully characterized. Accordingly, Fig. 8. CpG-ODN 1826 stimulates activation of the CMV IE enhancer/ promoter in RAW 264.7 cells. RAW 264.7 cells were transiently trans- fected with CMV IE enhancer/promoter-luciferase construct (pCMV- Luc) for 24 h. The cells were then stimulated with increasing amounts of CpG-ODN 1826 for 6 h (A) or CpG-ODN 1826 (3 l M ) for different time periods (B). RAW 264.7 cells were transfected with pCMV-Luc and treated with 3 l M of the indicated CpG-ODNs for 6 h and luciferase assays were performed (C). Fig. 9. LPS-induced and CpG-ODN 1826-induced CMV IE enhancer/ promoter activity in RAW 264.7 cells is inhibited by IjBaSR and the dominant negative mutant of MyD88. RAW 264.7 cells were transiently cotransfected with the CMV IE enhancer/promoter-luciferase con- struct (pCMV-Luc) and LxSN control vector, IjBaSR or the dom- inant negative mutant of MyD88 for 24 h. The cells were treated with 100 ngÆmL )1 LPS (A) or 3 l M of CpG-ODN 1826 (B) for 6 h before assaying for luciferase activity. The results are represented as fold activation compared with the control vector alone. Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1103 [...]... Cell type-specific induction of the major immediate early enhancer of human cytomegalovirus by cyclic AMP J Gen Virol 71, 105–113 12 Meier, J.L & Stinski, M.F (1996) Regulation of cytomegalovirus immediate early genes Intervirology 39, 331–342 13 Sun, B., Harrowe, G., Reinhard, C., Yoshihara, C., Chu, K & Zhou, S (2001) Modulation of human cytomegalovirus immediate-early gene enhancer by mitogen-activated... response factor and ELK-1 proteins mediate both basal enhancement and phorbol ester responsiveness of primate cytomegalovirus major immediate-early promoters in monocyte and T-lymphocyte cell types J Virol 70, 8590–8605 15 Angulo, A., Suto, C., Heymen, R.A & Ghazal, P (1996) Characterization of the sequences of the human cytomegalovirus enhancer that mediate differential regulation by natural and synthetic... and immediate-early gene expression J Virol 74, 1602–1613 6 Meier, J.L., Keller, M.J & McCoy, J.J (2002) Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication J Virol 76, 313–326 7 Thomsen, D.R., Stenberg, R.M., Goins, W.F & Stinski, M.F (1984) Promoter-regulatory region of the major immediate early gene. .. gene of human cytomegalovirus Proc Natl Acad Sci USA 81, 659–663 8 Jeang, K.T., Rawlins, D.R., Rosenfeld, P.J., Shero, J.H., Kelly, T.J & Hayward, G.S (1987) Multiple tandemly repeated binding sites for cellular nuclear factor 1 that surround the major immediate-early promoters of simian and human cytomegalovirus J Virol 61, 1559–1570 9 Nelson, J.A., Reynolds-Kohler, C & Smith, B.A (1987) Negative and. .. expression of target genes under the control of a CMV IE enhancer/promoter Acknowledgements This work was supported by the MOST grant CBM1-A900-001-0-0-0 of Korea Y Lee was supported by a grant (SC12031) from the Stem Cell Research Center of the 21st Century Frontier Research Program and a KRIBB Innovation grant (KGS2110311) We thank Dr Harikrishna Nakshatri and Dr Jurg Tschopp for the generous gift of the... Reynolds-Kohler, C & Smith, B.A (1987) Negative and positive regulation by a short segment in the 5¢-flanking region of the human cytomegalovirus major immediate-early gene Mol Cell Biol 7, 4125–4129 10 Sambucetti, L.C., Cherrington, J.M., Wilkinson, G.W & Mocarski, E.S (1989) NF-jB activation of the cytomegalovirus enhancer is mediated by a viral transactivator and by T cell stimulation EMBO J 8, 4251–4258 11... motifs in bacterial DNA and their immune effects Annu Rev Immunol 20, 709–760 40 Guha, M & Mackman, N (2001) LPS induction of gene expression in human monocytes Cell Signal 13, 85–94 41 Ueda, A., Takeshita, F., Yamashiro, S & Yoshimura, T (1998) Positive regulation of the human macrophage stimulating protein gene transcription J Biol Chem 273, 19339–19347 42 Liu, J & Kagan, J (1999) Use of a promoterless... stimulation of blood cells from healthy donors Cell 91, 119–126 3 Hahn, G., Jores, R & Mocarski, E (1998) Cytomegalovirus remains latent in a common precursor of dendritic and myeloid cells Proc Natl Acad Sci USA 95, 3937–3942 4 Hummel, M & Abecassis, M.M (2002) A model for reactivation of CMV from latency J Clin Virol 25, S123–S136 5 Meier, J.L & Pruessner, J.A (2000) The human cytomegalovirus major immediate-early. .. IjBaSR and DMyD88 References 1 Mocarski, E.S (1996) Cytomegaloviruses and their replication In Fields Virology (Fields, B.N., Knipe, D.M., Howley, P.M., Chanock, R.M., Melnick, J.L., Monath, T.P., Roizman, B & Straus, S.E., eds), 3rd edition, pp 2447–2492 Lippincott-Raven Publishers, Philadelphia 2 Soderberg-Naucler, C., Fish, K.N & Nelson, J.A (1997) Reactivation of latent human cytomegalovirus by allogeneic... in the recruitment of the common adaptor protein MyD88 [32,34] Activation of both signaling pathways stimulates the transcription factors NF-jB and AP-1, which in turn enhance the transcriptional upregulation of genes downstream of the jB motif [39,40] We have demonstrated that CMV IE enhancer/promoter activation induced by LPS and CpG-ODNs is mediated by the TLR/IL-1R signaling molecule MyD88 through . NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/promoter in response to lipopolysaccharide and bacterial CpG-oligodeoxynucleotides in. The CMV immediate-early (IE) enhancer/promoter regulates the expression of immediate-early gene products and the initiation of CMV replication [5,6]. The enhancer/promoter region of the CMV IE gene. Science and Biotechnology, College of Science, Yonsei University, Seoul, Korea The cytomegalovirus immediate-early (CMV IE) gene enhancer/promoter regulates the expression of immediate- early gene