main tools for image treatment

báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps

báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps

Ngày tải lên : 10/08/2014, 23:20
... this technique for conventionally fractionated radiation treatment of a lung tumor The application of IGRT using fiducial markers in the spine in our patient allowed for radiation treatment of ... Discussion IGRT has emerged as a method of improving radiation treatment accuracy for tumors near the spinal cord Three forms of IGRT for this purpose have been described in the literature: cone-beam ... room These images have a higher resolution than traditionally used megavoltage (MV) images and allow for matching of patient anatomy to bony landmarks on a DRR Yin et al [8] at Henry Ford Hospital...
  • 5
  • 279
  • 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Ngày tải lên : 26/10/2012, 09:32
... re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient ... with a median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of ... patients reported significant pain improvement for at least 36 months postoperatively This durable effect is particularly promising, given the propensity for facet joint pain to return following dorsal...
  • 4
  • 599
  • 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Ngày tải lên : 26/10/2012, 09:57
... laminoforaminotomy for unilateral radiculopathy: results of a new technique in 100 cases J Neurosurg 2001; 95: 51-57 Khoo LT, Fessler RG Microendoscopic decompressive laminotomy for the treatment ... invasive, such as endoscopic laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and ... conflict of interest exists References Kunogi J, Hasue M Diagnosis and operative treatment of intraforaminal and extraforaminal nerve root compression Spine 1991; 16: 1312-1320 Porter RW, Hibbert...
  • 3
  • 506
  • 0
Inside words - Tools for teaching academic vocabulary grade 4-12

Inside words - Tools for teaching academic vocabulary grade 4-12

Ngày tải lên : 04/09/2013, 16:38
... strategies similar to those highlighted in Tools for Teaching Content Literacy It also joins the two formats: I blended the quick overview format from Tools with several classrooms examples, as ... them alphabetically so they could be easily found for teaching as well as for discussion in study groups or professional development These are tools for teachers, and the purpose of a tool is to ... THE FITTEST 101 THINK-PAIR-SHARE: COLLABORATE FOR UNDERSTANDING 105 VOCAB-O-GRAM 109 WORD SORT 115 WORD WALLS 119 Appendix 123 Inside Words: Tools for Teaching Academic Vocabulary, Grades 4-12...
  • 176
  • 625
  • 9
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Ngày tải lên : 05/09/2013, 09:38
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection ... (2001) Different conditions for the implementation of QP-PCR was applied, and the condition was optimized In general, the higher concentration of primers can lead to the formation of primer dimers...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Ngày tải lên : 05/09/2013, 09:38
... increased with the decreasing temperature either for dried sludge (Zhou, 1992; Zhou and Banks, 1993) or for activated carbon (McCreary and Snoeyink, 1980) Therefore, it is hypothesized that there existed ... L (1999) Biological wastewater treatment: Second edition, Marcel Dekker, Inc Huang J C and Li L (2000) An innovative approach to maximize primary treatment performance Water Sci and Tech., 42(12), ... taken from the incubation reactors and were then centrifuged and washed using tap water for three times Before the adsorption tests, the sludge was diluted to the required MLSS level with the same...
  • 8
  • 686
  • 0
Tools for management, workshop and consulting

Tools for management, workshop and consulting

Ngày tải lên : 08/10/2013, 18:11
... many good tools have been added Collaboration with other consultants made it clear that there was a lack of tools for the accurate definition of problems Consequently, eight new tools for the ring-fencing ... needs to work successfully for you That is all that matters The main purpose of tools and techniques is to provide you with a structure for your thoughts and actions The tools NOT replace your own ... which tools I suggest for each activity A similar overview is provided in table format in Scenario: Good practice for project and problem definition (section 9.2) on page 366 2.2 Categories of tools...
  • 383
  • 487
  • 0
Free Software tools for embedded systems

Free Software tools for embedded systems

Ngày tải lên : 20/10/2013, 00:15
... kernels, toolchains, utilities, binaries  for impressive lists of target platforms Integrated utilities for automatic kernel  image,  initrd and filesystem generation Development tools available on  multiple platforms: GNU / Linux,  ... Jan 24, 2008 http://free­electrons.com 34 Free Software tools for embedded systems GNU / Linux workstation Various tools Free Software tools for embedded systems © Copyright 2004­2008, Free Electrons ... in particular on the arm platform Kernel development eventually shared with the community.  kernel. Many drivers merged in mainstream Linux Graphical development tools are proprietary Free Software tools for embedded systems...
  • 132
  • 425
  • 0
59 VLSI Architectures for Image Communications

59 VLSI Architectures for Image Communications

Ngày tải lên : 25/10/2013, 02:15
... transform (DCT), quantization (Q), variable length coding (VLC), inverse quantization (Q−1 ), and inverse discrete cosine transform (IDCT or DCT-1) The reconstructed image data are stored in an image ... power required for the discrete cosine transform and motion estimation, these algorithms are the first candidates for a dedicated implementation As typical examples, alternatives for a dedicated ... the following The discrete cosine transform (DCT) is a real-valued frequency transform similar to the Discrete Fourier transform (DFT) When applied to an image block of size L × L, the two dimensional...
  • 23
  • 341
  • 0
Tài liệu Tools for Security Testing ppt

Tài liệu Tools for Security Testing ppt

Ngày tải lên : 11/12/2013, 15:15
... services for several domains, and direct web-based data to a particular namebased virtual host You can specify this on the target line in the form of IP_Address[Virtual_Domain_Name], [JMM6 ]for example, ... common forms of password cracking are brute force and dictionary-based cracking Brute force cracking requires throwing computing resources at a password you wish to crack Usually a brute force ... will output the results of the NMAP scan in XML format This is very useful for populating monitoring tools like Nagios or to provide an input source for a script The second, -oG, outputs the scan...
  • 33
  • 602
  • 0
05  interval tools for ODEs and DAEs swim08 nedialkov

05 interval tools for ODEs and DAEs swim08 nedialkov

Ngày tải lên : 12/01/2014, 21:46
... methods for ODE’s, http://www.eng.mu.edu/corlissg/Pubs/03Lyngby/Slides/ [2] N S Nedialkov, Interval tools for ODEs and DAEs, http://www.cas.mcmaster.ca/∼ nedialk/PAPERS/intvtools/intvtools.pdf ... methods for classes of problems may be a feasible approach • An efficient method for stiff problems is needed • An “interval version“ of DETEST, a test set for assessing approximate solvers for IVP ... IVP for a DAE system with n equations fi in n dependent variables xj = xj (t) of the form fi t, the xj and derivatives of them = 0, 1≤i≤n Fully implicit; derivatives of order > are allowed Informally,...
  • 39
  • 297
  • 0
Tài liệu Professional VSTO 2005 Visual Studio 2005 Tools for Office docx

Tài liệu Professional VSTO 2005 Visual Studio 2005 Tools for Office docx

Ngày tải lên : 17/01/2014, 06:20
... particular forum emailed to you, click the Subscribe to this Forum icon by the forum name in the forum listing For more information about how to use the Wrox P2P, be sure to read the P2P FAQs for answers ... Professional VSTO 2005 Visual Studio® 2005 Tools for Office Professional VSTO 2005 Visual Studio® 2005 Tools for Office Professional VSTO 2005 Visual Studio® 2005 Tools for Office Alvin Bruney Professional ... provides tools for working with the NET framework Although it is optional, you should install it Visual Studio Tools for Office Figure 1-3 Creating VSTO Projects Once Visual Studio Tools for Office...
  • 339
  • 1.1K
  • 24
Tài liệu Blanking tools for the automotive industry pdf

Tài liệu Blanking tools for the automotive industry pdf

Ngày tải lên : 22/01/2014, 02:20
... 2664.06 for ball-lock Punches light duty 2664.07 heavy duty 2664.10 2664.08 2664.09 E79- E83 E86- E88 Accessories for Retainers triangular, for ball-lock Punches 2664.02 Triangle Retainers E89 E94 for ... Retainers E89 E94 for round Punches, ISO 8020 for Punches, ISO 8020 2664.04 2276 Pilot Units to DC-Standard E60 Accessories for Retainers triangular, for Precision Punches, ISO 8020 2606 2616 2626 ... 03_17363 07.08.2006 14:04 Uhr Seite 2·17363· 2002· ° Blanking tools for the automotive industry 04_InhVerz 08.08.2006 8:27 Uhr Seite Table of contents Page FIBRO...
  • 79
  • 936
  • 0
Tài liệu Practical mod_perl-CHAPTER 9:Essential Tools for Performance Tuning pptx

Tài liệu Practical mod_perl-CHAPTER 9:Essential Tools for Performance Tuning pptx

Ngày tải lên : 26/01/2014, 07:20
... Concurrency Level: Time taken for tests: Complete requests: Failed requests: 324 Apache/1.3.25-dev localhost 8000 10 5.843 seconds 5000 | Chapter 9: Essential Tools for Performance Tuning This is the ... an array before generating the output The easiest way to get an answer is to try each approach, so we wrote the benchmark shown in Example 9-3 328 | Chapter 9: Essential Tools for Performance Tuning ... swapped out) There are many other things GTop can for you—please refer to its manpage for more information We are going to use this module in our performance tuning tips later in this chapter, so...
  • 26
  • 372
  • 0
Tài liệu 50 Software Tools for Speech Research and Development doc

Tài liệu 50 Software Tools for Speech Research and Development doc

Ngày tải lên : 27/01/2014, 03:20
... variety of standard and specialized formats Sphere works well for sampled data files, but is limited for more general speech data files A general purpose, public-domain format (Esignal) has recently ... will be used, for example, to show aspects of vector quantization or HMM clustering.) Public-domain file formats will dominate proprietary formats Networked computers will be used for parallel ... spreadsheet-style interface for speech software c 1999 by CRC Press LLC A spreadsheet-style interface provides some means for specifying the “formulas” that relate the various “cells” This formula interface...
  • 13
  • 412
  • 0
Content Brainstorming Tools for 2013

Content Brainstorming Tools for 2013

Ngày tải lên : 09/02/2014, 20:33
... out sh eets with space for a topic or keyword at th e top of th e pag e an d space wh ere ideas can be written It can be a differen t topic for each person or th e same for everyon e Write ideas ... brain stormin g tools available th at can h elp you move past a topic or idea th at seems stuck Online Mind Mapping Tools Bubbl.us h elps to org an ize th oug h ts or jumbled in formation th roug ... treak/2009/11/brain-writing.html Con tin ue th e exercise for an an oth er ute In some cases, tradition al brain stormin g meth ods may best suit your team en viron men t an d g oals For th ose wh o prefer virtual collaboration...
  • 4
  • 347
  • 0
Tài liệu Mathematical Tools for Physics doc

Tài liệu Mathematical Tools for Physics doc

Ngày tải lên : 12/02/2014, 16:20
... for cosh2 θ − sinh2 θ and for − tanh2 θ, Equation (3) 1.3 Derive the expressions for cosh−1 y, tanh−1 y, and coth−1 y Pay particular attention to the domains and explain why these are valid for ... because the numerator for small x is approximately 1, you immediately have that Γ(x) ≈ 1/x for small x (15) The integral definition, Eq (12), for the Gamma function is defined only for the case that ... toss a coin It’s straight-forward to derive this from Stirling’s formula In fact it is just as easy to a version of it for which the coin is biased, or more generally, for any case that one of...
  • 456
  • 1.1K
  • 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Ngày tải lên : 14/02/2014, 22:20
... reserved This material may be freely reproduced for educational and not -for- profit purposes No reproduction by or for commercial organisations, or for commercial purposes, is allowed without the ... not recommended for the first-line treatment of metastatic colorectal cancer 1.2 Cetuximab in combination with irinotecan is not recommended for the secondline or subsequent treatment of metastatic ... receive seven vials per loading dose and five vials per maintenance dose, equating to a cost of £955.50 for the loading dose and £682.50 for each maintenance dose Patients in the key registration trial...
  • 34
  • 853
  • 0
Tài liệu Risk Factors in Implant Denistry: Simplified Clinical Analysis for Predictable Treatment ppt

Tài liệu Risk Factors in Implant Denistry: Simplified Clinical Analysis for Predictable Treatment ppt

Ngày tải lên : 16/02/2014, 15:20
... Regular Platform implants, a mesiodistal distance of mm, center to center, is necessary for avoiding interference between implants or implant and teeth For Narrow Platform, mm is required, and for Wide ... oral hygiene is not relevant for the implant treatment per se However, attention should be paid to patients who have been edentulous for a long time They have often forgotten the simple measures ... is an indicator of the potential risk for complications of implant treatment Availability Certain treatment requires frequent availability of the patient For example, after a guided bone regeneration...
  • 168
  • 380
  • 1
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Ngày tải lên : 19/02/2014, 12:20
... subunit contains four transmembrane domains, with five subunits assembling to form an ion channel The second transmembrane domain of each subunit contributes to the formation of the hydrophilic pore ... target for prey capture However, the genetic information for ÔunderdevelopedÕ a-conotoxins targeting other nAChR subtypes might still be present in the snails and could supply novel ligands for ... pharmacological tools, they provide information for structure-activity studies Comparison of their primary structures with those of more ÔspecialisedÕ a-conotoxins can reveal first clues for critical...
  • 15
  • 757
  • 0

Xem thêm