k dans s c s c and purication of the rab7c k dans s c gg s c gg rep 1 complex

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Ngày tải lên : 14/02/2014, 19:20

... 702 CD2 -1- 7 668 CD2 -1- 8 635 CD2 -1- 6 -1 702 CD2 -1- 6-2 CD2 -1- 6-3 Interaction PD Input GST CD2 -1- 1 CD2 -1- 2 CD2 -1- 3 CD2 -1- 4 CD2 -1 767 250 15 0 PD 734 Input GST CD2 -1- 5 CD2 -1- 6 CD2 -1- 7 CD2 -1- 8 CD2 -1 600 ... assay of combinations of EGFP-fused KIND1 or KIND2 of v-KIND with GST-fused CD2 -1- 6 -1 or CD2 -1- 6-2 of MAP2 We successfully detected a pull down for the combination of EGFP-KIND2 and GST-CD2 -1- 6-2, ... axons The expression of three other KIND2-containing constructs (DKIND1, DRasN and DGEF) was restricted to dendrites and soma (Fig 1B) On the other hand, two KIND2 domainlacking constructs, DKIND2...

11
658
0

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Ngày tải lên : 16/02/2014, 09:20

... reducing the basal level of Itch reduces cell survival and increases caspase activity, consistent with increased tBid levels in these cells Interestingly, Itch interacts speciﬁcally with tBid, and ... analyses were carried out using spss 16 .0 .1 (SPSS, Chicago, IL, USA) The statistical signiﬁcance of the differ- FEBS Journal 277 (2 010 ) 13 19 13 30 ª 2 010 The Authors Journal compilation ª 2 010 FEBS ... Azakir et al ences was assessed using one-way analysis of variance (anova) and posthoc Tukey s test The densitometry analysis was carried out in adobe photoshop CS (Adobe Systems, San Jose, CA,...

12
718
0

Tài liệu Báo cáo khóa học: Non-speciﬁc depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20

... perfect crystal structure and increases CrI In chitosan, this band appeared at 33 71 cm )1 and there was a slight shifting of the same in LMWC (3368 cm )1) , indicating a decrease in the ordered structure ... mutagenesis, identiﬁed the involvement of crucial Glu and Asp residues during the chitinolytic activity of chitinase A1 from Bacillus circulans W -12 Replacement of SerﬁAla decreased the catalytic activity ... reference for comparison of band absorbance Absence of a sharp and convoluted spectral band around 3600–3000 cm )1 in the spectra of both chitosan and LMWC indicated the absence of free -OH groups and...

11
673
0

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Ngày tải lên : 06/03/2014, 11:20

... signals; and (C) amide 15 N resonances C the a-helices on one side of the b-sheet and two on the other side The rmsd of the heavy atoms (Ca, C, and N) of the protein core, when the NMR structures of ... Bank accession code 1DT9; and the complex of eRF1 with eRF3, Protein Data Bank accession code 3E1Y] contain the coordinates of the rigid protein core However, these structures not show the coordinates ... backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated from the chemical shift values of backbone atoms 13 Ca, 13 Cb, 1 3C , 1Ha, 1HN,...

17
490
0

Báo cáo khoa học: Relation between domain evolution, speciﬁcity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Ngày tải lên : 08/03/2014, 08:20

... Thermoanaerobacter thermosulfurogenes Thermococcus sp B10 01 Aspnd Aspka Bacsp Crcsp Stral Strgr Strli 21 Strli24 Strve Thscu Psesa Psest Psesp Bacst Actsp Bac 11 Bac17 Bac38 Bac663 Bac1 011 BacA2 Bac1 018 BacE1 ... Bacillus sp B1 018 Bacillus sp E -1 Bacillus sp KC2 01 Bacillus brevis Bacillus circulans Bacillus circulans 2 51 Bacillus circulans A 11 Bacillus clarkii Bacillus licheniformis Bacillus macerans ... TS-23 Cryptococcus sp S2 Streptomyces albidoﬂavus Streptomyces griseus Streptomyces lividans TK 21 Streptomyces lividans TK24 Streptomyces venezuelae Thermomonospora curvata Pseudomonas saccharophila...

11
615
0

Bad Bank(s) and Recapitalization of the Banking Sector docx

Ngày tải lên : 15/03/2014, 10:20

... market as neither the value of assets nor the amounts of hidden losses of some large banks were disclosed The comeback of trust into the business models of the banking sector would most likely ... 11 4 .1 Classification of Historical Precedents and Proposed Models 12 4.2 Successful historical examples 13 4.3 Proposed Models for the Current Crisis 13 Efficient Design ... banking sectors worldwide still suffering from the effects of the financial crisis, public discussion of plans to place toxic assets in one or more bad banks has gained steam in recent weeks The...

31
417
0

The Benefits and Costs of the Clean Air Act from 1990 to 2020: U.S. Environmental Protection Agency Office of Air and Radiation potx

Ngày tải lên : 15/03/2014, 16:20

... between the emissions analysis and the direct cost analysis discussed in this chapter is that, whereas the emissions analysis considered emissions of six major criteria pollutants (VOCs, NOx, SO2, CO, ... summarizes our approach to estimating direct compliance costs In the second section we present the results of the cost analysis In the third section, we discuss how cost estimates in the Second Prospective ... without-CAAA Emissions 1st Prospective 2nd Prospective with-CAAA Emissions 1st Prospective 2nd Prospective Emissions Reductions 2 -15 The Benefits and Costs of the Clean Air Act fron 19 90 to 2020 FIRST...

238
463
0

Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt

Ngày tải lên : 16/03/2014, 18:20

... *** *C* ** *C* ** *GG* GA*********** *C* ****G*CAG****GGCTCG*G*GA*** *C* A*T*A******T*G***GGGG***G**TC***G*CGG MZF1 WHZF +245 M TCCGAGCCCAGGGGAGCCAGTCCCAGGGGCCGTGGCGCACGGGTGCTAGAGGCCGGGGACGCGGGCGCGCAGACCGACTGACTTACTGACCGATCGCCGC H ... GGTGGCCGCGGCCAGGTAGCTGAGGACTGGAGGCGGCGCAGAGGGGAGGGTCGGGCGGAGACCTCACTTGGCCGGCCTTCCTGCCGCCCTGTTTCCGGAT H T* ***** ***G** -G**G*GC***A *C* *A*CCCC***CCC*G* *C* *CTC*G****TGGGCT* *C* *TCC***T**-** ***** *C* - 318 M C CCGACCGCCCGGCGCGTGACCTCCAGTGA-GGTCCTGGCAATGAGCA GCGCTGGTGATTAACGGCCCCGAGGTCGCGGGCAGTG-AGGC ... ******G****************************GGA*************** ***G****** *C* ********TG*G*G***G**A**A******** ZF9 +14 5 M GCGCTCGGGGTGGCCCAAGCGGGCGGCCCCAGGCCGGCCAGCGCGGT -CAGTGGGACGCCGGGGAGAGCCGGAGAA CGAAGCGGGCCTG H *** *C* ** *C* ** *GG* GA*********** *C* ****G*CAG****GGCTCG*G*GA*** *C* A*T*A******T*G***GGGG***G**TC***G*CGG...

12
504
0

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue speciﬁc expression and characterization of the lung isoform ppt

Ngày tải lên : 17/03/2014, 09:20

... tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 10 08 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca ... 14 4 CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG...

11
527
0

Gravitation and cosmology principles and applications of the general theory of relativity weinberg s

Ngày tải lên : 17/03/2014, 14:28

685
561
1

coast guard observations on the genesis and progress of the service s pot

Ngày tải lên : 18/03/2014, 18:20

32
371
0

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Ngày tải lên : 23/03/2014, 13:20

... underlined bases show the position of the SacI site, and 5¢- GGCCACT GGATCCAACTACAGCAATTCTCA-3¢ for C- domain– and C- domain+, where underlined bases show the position of the BamHI site PCR was performed ... S (19 81) Cloning of the genes for penicillinase, penP and penI, of Bacillus licheniformis in some vector plasmids and their expression in Escherichia coli, Bacillus subtilis, and Bacillus licheniformis ... protease coupling assay using ALPF as a substrate, is shown in comparison with that of SIB1 FKBP22* ( s ) The catalytic efﬁciency, kcat ⁄ Km, was calculated according to Harrison & Stein [34] The...

11
332
0

Báo cáo khoa học: Puriﬁcation and properties of the glutathione S-transferases from the anoxia-tolerant turtle, Trachemys scripta elegans pdf

Ngày tải lên : 23/03/2014, 15:20

... In conclusion, the lower speci c activities of GSTs in liver from anoxic turtles (using either CDNB or cumeme hydroperoxide as substrates) suggest a possible speci c suppression of GST activity ... nonmammalian GSTs Cytosolic GSTs can generally be assigned to one of four classes (a, l, p and h) based on their pI and kinetic characteristics [37] The isozymes a, l, and p have basic, near-neutral, and ... GSTs showed a higher molecular mass than most known GSTs SDS ⁄ PAGE of Peak GST showed a subunit with a mass of 34 kDa, whereas Peak GST was composed of two subunits of 36.8 and 32.6 kDa This indicated...

13
433
0

Báo cáo Y học: Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Ngày tải lên : 23/03/2014, 21:20

... AATAAATACTTGTGGAATATG Exon 5¢-splice site aaacgttatgtggccTGGGAG … 13 3 (exon 1, 234 bp) tcgtttgtattctagTTGCAG … 310 tggtatgtgtgtcagATGCTG … )10 2 424 gcctttgctttgcagAGCCCC … 496 ttccttctggagcagGGTCTC ... three species In all three species, the encoded NICN1 protein consists of 213 amino acids and has a calculated molecular weight of 24 kDa (Fig 1) The amino acid sequences of the NICN1 proteins are ... RIKEN mouse cDNA project [2; EMBL accession AK 013 602] RESULTS AND DISCUSSION Analysis of the NICN1 cDNA sequence During the detailed analysis of a 16 2-kb dog genomic DNA sequence [3,4], we observed...

6
450
0

Hughes, Mansel & Webster''''s Benign Disorders and Diseases of the Breast pdf

Ngày tải lên : 28/03/2014, 22:20

... cystic disease Schimmelbusch s disease Chronic cystic mastitis Cystic mastopathy DUCT ECTASIA/PERIDUCTAL MASTITIS Plasma cell mastitis Varicocele tumour Comedo mastitis Mastitis obliterans Secretory ... diffusion The cycle of extrusion and resynthesis then restarts The active transport processes across the luminal cell (the blood–milk barrier) are of considerable interest as recent studies of cyst ... nutrients must pass to reach the breast ductal cells.32,34 The ESJ consists of a complex intertwining of fibroblasts, elastic fibres and endothelium and it is possible that the cause for some of the...

349
2K
3

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

Ngày tải lên : 29/03/2014, 07:20

... matter) is issuing covered bonds These bonds would be issued by banks and collateralized by specific pools of assets, such as mortgages If the bank issuing the covered bonds should default, the holders ... risks Do differences in the size or composition of financial sectors in countries necessitate different regulatory regimes? The recent crisis has underscored the fact that financial systems in ... proposed new rules to increase the rates banks pay for deposit insurance, and adjusted the process by which those rates are set On October 14 , 2008, Secretary Paulson signed the systemic risk exception...

51
467
0

Báo cáo khoa học: Regulation of the muscle-speciﬁc AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx

Ngày tải lên : 30/03/2014, 08:20

... AMPK through phosphorylation of Thr172 in the a-subunit, i.e LKB1 [11 13 ], CAMKKb [15 ,48] and TAK1 [16 ] LKB1 is believed to be the major upstream kinase for AMPK in skeletal muscle, as knocking ... dependence curves of the AMPK a2b 2c3 complexes appear hyperbolic rather than sigmoid (Fig 3C) While this manuscript was in preparation, a crystal structure of the Schizosaccharomyces pombe AMPK was reported, ... Thr172, including tumor suppressor LKB1 [11 13 ], Ca2+ ⁄ calmodulin-dependent protein kinase b (CAMKKb) [14 ,15 ] and transforming growth factor b-activating kinase (TAK1) [16 ] The three AMPK c- subunit...

10
553
0

Báo cáo khoa học: Coexpression, puriﬁcation and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Ngày tải lên : 30/03/2014, 15:20

... GGGGGATCCCCATAATCCACTCCACCTGCTAAA GGGGGGGATCCT CATTATTTCCCTTCT AATACCGCCATGTATAATATCTATTACTTC GTAATAGATATTATACATGGCGGTATTGAA GGGGGGGCCATGGAAAGAGCAGACGATTT Large-scale protein expression and puriﬁcation Cultures ... PCR primer names and sequences Primer name Sequence 21 33 40 41 44 66 67 75 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA CCGGAATTCTTATTTCCCTTCTCTCATCTC GCGCGCCATGGAAAAAGATCTACAGTTAAGA GGGGGATCCCCATAATCCACTCCACCTGCTAAA ... association of the Acknowledgements This work was supported by grant NSC 91- 2320-B032-0 01 from the National Science Council, Taiwan, Republic of China (to H.-P Chen) References Somack, R & Costilow,...

5
401
0

Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefﬁciently donates iron to cells via nonspeciﬁc internalization and degradation of the protein pdf

Ngày tải lên : 31/03/2014, 09:20

... fact, sMTf was markedly degraded by the cell MATERIALS AND METHODS Cell culture Human SK-Mel-28 melanoma cells, SK-N-MC neuroepithelioma cells, MRC-5 ﬁbroblasts and MCF-7 breast cancer cells, ... consistent with glycosylation Furthermore, comparison of endoglycosidase H resistance between sMTf from SK-Mel-28 cells [16 ] and that secreted from the BHK TK– cell line [38], suggested that the ... and then routed towards the lysosome for proteolysis The results of the current study have implications for the suggested use of sMTf as a vehicle to deliver chemotherapeutic agents [49,50] These...

11
373
0

Báo cáo khoa học: "Characterization and localization of the unique Marek''''s disease virus type 2 ORF873 gene product" ppsx

Ngày tải lên : 07/08/2014, 17:23

... were prepared by repeated inoculations of each of the virusinfected CEF cells (10 00 PFU per chicken) in to separate specific-pathogen-free chickens Chicken polyclonal antiserum against MDV1 (GA) ... against MDV2 (HERS24) and HVT (FC126) were prepared by repeated inoculations of each of the virusinfected CEF (10 00 PFU per chicken) into specificpathogen-free chickens Chicken polyclonal antisera ... rAcORF873- and cAcNPVinfected cells were cultured in the presence of 10 µg of tunicamycin per ml as previously described [13 ] Results Recombinant baculovirus expression and characterization of...

7
344
1